Fsh stimulates Leydig cell Wnt5a production, enriching zebrafish type A spermatogonia

in Journal of Endocrinology
Correspondence should be addressed to R W Schulz: r.w.schulz@uu.nl

Follicle-stimulating hormone (Fsh) modulates vertebrate spermatogenesis by regulating somatic cell functions in the testis. We have found previously that zebrafish Fsh stimulated the differentiating proliferation of type A undifferentiated spermatogonia (Aund) in an androgen-independent manner by regulating the production of growth factors and other signaling molecules in both Sertoli (SCs) and Leydig cells (LCs). For example, Fsh triggered the release of Igf3 that subsequently activated β-catenin signaling to promote the differentiating proliferation of Aund. In the present study, we report that Fsh moreover uses the non-canonical Wnt pathway to promote the proliferation and accumulation of Aund. Initially, we found that the stimulatory effect of Fsh on the proliferation activity of Aund was further strengthened when β-catenin signaling was inhibited, resulting in an accumulation of Aund. We then showed that this Fsh-induced accumulation of Aund was associated with increased transcript levels of the non-canonical Wnt ligand, wnt5a. In situ hybridization of insl3 mRNA, a gene expressed in LCs, combined with Wnt5a immunocytochemistry identified LCs as the cellular source of Wnt5a in the adult zebrafish testis. Addition of an antagonist of Wnt5a to incubations with Fsh decreased both the proliferation activity and the relative section area occupied by Aund, while an agonist of Wnt5a increased these same parameters for Aund. Taken together, our data suggest that Fsh triggered LCs to release Wnt5a, which then promoted the proliferation and accumulation of Aund. Hence, Fsh uses non-canonical Wnt signaling to ensure the production of Aund, while also triggering β-catenin signaling via Igf3 to ensure spermatogonial differentiation.

Abstract

Follicle-stimulating hormone (Fsh) modulates vertebrate spermatogenesis by regulating somatic cell functions in the testis. We have found previously that zebrafish Fsh stimulated the differentiating proliferation of type A undifferentiated spermatogonia (Aund) in an androgen-independent manner by regulating the production of growth factors and other signaling molecules in both Sertoli (SCs) and Leydig cells (LCs). For example, Fsh triggered the release of Igf3 that subsequently activated β-catenin signaling to promote the differentiating proliferation of Aund. In the present study, we report that Fsh moreover uses the non-canonical Wnt pathway to promote the proliferation and accumulation of Aund. Initially, we found that the stimulatory effect of Fsh on the proliferation activity of Aund was further strengthened when β-catenin signaling was inhibited, resulting in an accumulation of Aund. We then showed that this Fsh-induced accumulation of Aund was associated with increased transcript levels of the non-canonical Wnt ligand, wnt5a. In situ hybridization of insl3 mRNA, a gene expressed in LCs, combined with Wnt5a immunocytochemistry identified LCs as the cellular source of Wnt5a in the adult zebrafish testis. Addition of an antagonist of Wnt5a to incubations with Fsh decreased both the proliferation activity and the relative section area occupied by Aund, while an agonist of Wnt5a increased these same parameters for Aund. Taken together, our data suggest that Fsh triggered LCs to release Wnt5a, which then promoted the proliferation and accumulation of Aund. Hence, Fsh uses non-canonical Wnt signaling to ensure the production of Aund, while also triggering β-catenin signaling via Igf3 to ensure spermatogonial differentiation.

Introduction

Spermatogenesis is a stem cell-based process that that requires communication between germ and somatic cells in the testis. When proliferating, the spermatogonial stem cells (SSCs) can either produce more SSCs or can produce differentiating daughter cells committed to develop into spermatozoa (De Rooij 2017). In fish, as in all vertebrates, SSCs form part of the population of type Aund spermatogonia (Lacerda et al. 2010, Nóbrega et al. 2010, Sato et al. 2017). In fish and amphibians, Aund are enveloped by Sertoli cells (SCs), thereby forming a spermatogenic cyst. These cysts are formed based on the production and hence proliferation of SCs, which associate with a type Aund spermatogonium to form a new spermatogenic cyst. SCs also proliferate while accompanying the development of a germ cell clone derived from a given Aund spermatogonium in its growing cyst (Schulz et al. 2010). The balance between self-renewal and differentiation is determined by the microenvironment the type Aund spermatogonium is exposed to in its cyst. For this microenvironment, the cyst-forming SCs are important contributors that are sensitive to reproductive hormones.

The pituitary hormones luteinizing hormone (LH) and follicle-stimulating hormone (Fsh) are major modulators of vertebrate spermatogenesis. Upon gonadotropin signaling, somatic cells such as SCs, LCs and myoid cells produce paracrine factors modulating spermatogonial activity (Oatley et al. 2009, Ding et al. 2011, Chen et al. 2016, de Rooij 2017, Lord & Oatley 2017). In mammals, Fsh regulates SC activities to support spermatogenesis (Mullaney & Skinner 1992, Ding et al. 2011, Pitetti et al. 2013), while LH stimulates LC androgen production. Different from mammals, fish Fsh modulates the function of both SCs and LCs (Ohta et al. 2007, García-López et al. 2010), so that Fsh can regulate spermatogenesis in an androgen-dependent and -independent manner. With regard to androgen-independent regulation of spermatogenesis, zebrafish Fsh stimulated spermatogonial differentiation by modulating the release of inhibitory and stimulatory growth factors such as Amh and Igf3, respectively, from SCs (Skaar et al. 2011, Nóbrega et al. 2015), and by promoting the production of Insl3 in LCs (Assis et al. 2016, Crespo et al. 2016). Indeed, the androgen dependency of spermatogenesis in fish seems less prominent than that in mammals, considering that spermatogenesis, but not secondary sex characteristics, were normal after preventing the production of androgens by mutating the cyp17 gene in medaka (Sato et al. 2008). Also, after loss of androgen receptor function, spermato- and spermiogenesis were still possible, though clearly compromised quantitatively (e.g. Crowder et al. 2018). Evidently, androgen-independent mechanisms promoting spermatogenesis function efficiently in fish, and information is available already on the role of a few signaling systems, such as Amh, Igf3 or Insl3 (see above) or Gsdf in trout (Sawatari et al. 2007). Nonetheless, other pathways mediating androgen-independent Fsh effects remain to be investigated. Notably, a recent study reported that close to 200 testicular transcripts responded to zebrafish Fsh, including genes belonging to the Wnt pathway (Crespo et al. 2016).

The Wnt signaling system is a conserved cell-to-cell communication system that consists of several Wnt ligands and receptors. This system operates in branches that differ in their intracellular signaling pathways. The canonical Wnt pathway relies on the availability of β-catenin (Salic et al. 2000), which interacts with transcription factors to modulate gene expression. The non-canonical Wnt pathway activates different intracellular pathways (e.g. calcium-dependent or Jun N-terminal kinases) in a β-catenin-independent manner (Van Amerongen 2012). In mice, recent studies have shown that the canonical pathway is relevant for modulating spermatogenesis. Takase & Nusse (2016) reported that the β-catenin-target gene Axin2 is expressed specifically in Aund spermatogonia and β-catenin knockout in Axin2-positive spermatogonia reduced the number of differentiating type A spermatogonia (Adiff). Similarly, Tokue et al. (2017) found that activating the canonical Wnt pathway reduced the number of GFRa1-positive cells (a marker for SSCs) and that an inhibitor of the canonical Wnt pathway, Shisa6, maintains the number of GFRa1-positive cells. On the other hand, less is known on the function of the non-canonical Wnt pathways in spermatogenesis. An in vitro study showed that only Adiff spermatogonia responded to canonical Wnt signaling, while the SC-derived, non-canonical ligand WNT5a maintained the number of SSCs by reducing their apoptosis (Yeh et al. 2011). In addition, Tanaka et al. (2016) showed that LH-dependent androgen production downregulated Wnt5a transcript levels in SCs, which promoted SSC differentiation. In zebrafish, we have shown recently that β-catenin signaling is activated in germ cells through the SC-derived Igf3 in response to Fsh, thereby stimulating the differentiation of type A spermatogonia (Safian et al. 2018). However, information on the role, if any, of non-canonical Wnt signaling in zebrafish spermatogenesis is missing.

Here, we report that Fsh, via the non-canonical Wnt signaling system, triggers LC Wnt5a production, leading to an expansion of the population of type Aund spermatogonia.

Materials and methods

Animals

Adult WT male zebrafish (AB strain) between 4 and 12 months of age were used in this study. All experiments carried out in this study followed the Dutch National regulations for animal care and all experimental protocols were approved by the Utrecht University Experimental Animal Committee (2013.III.06.045 and NVWA 10800).

Tissue culture

To study if Fsh uses the Wnt signaling system to regulate Aund spermatogonial fate in zebrafish, adult testes were dissected for tissue culture experiments using a previously described system (Leal et al. 2009), in which one testis was incubated under control conditions, the other under experimental conditions.

We have reported previously that 100 ng/mL Fsh-stimulated both self-renewal division of Aund and differentiating proliferation toward Adiff spermatogonia (Nóbrega et al. 2015, Safian et al. 2016), the latter by activating β-catenin signaling via Igf3 (Safian et al. 2018). To study the potential involvement of Wnt signaling in Aund proliferation and accumulation (i.e. self-renewal of Aund spermatogonia), zebrafish testes were incubated for 5 days in the presence of recombinant zebrafish Fsh (100 ng/mL) (García-López et al. 2010) with or without XAV939 (10 µM in dimethyl sulfoxide (0.01%); Sigma-Aldrich) (Safian et al. 2018), an inhibitor of the β-catenin-dependent pathway (Huang et al. 2009, Shimizu et al. 2012). In all experiments, incubation media for control and experimental groups contained the same final concentration of dimethyl sulfoxide.

To further study the role of the Wnt signaling system on Fsh-stimulated spermatogonial proliferation, zebrafish testes were incubated for 5 days in the presence of Fsh (100 ng/mL) with or without IWP-12 (50 µM in dimethyl sulfoxide (0.05%); Sigma-Aldrich) (Safian et al. 2018), an inhibitor of porcupine, a protein required to release Wnt ligands (Chen et al. 2009, Dodge et al. 2012) or in the presence of Fsh (100 ng/mL) and XAV939 (10 µM), with or without 50 µM IWP-12. Testes also were incubated in the absence or presence of XAV939 (10 µM; Sigma-Aldrich) or IWP-12 (50 µM; Sigma-Aldrich) for 5 days, to test for potential effects of these inhibitors alone.

To study changes in transcript levels of Wnt-related genes, testes were incubated in basal conditions with Fsh (100 ng/mL), recombinant zebrafish luteinizing hormone (Lh) (500 ng/mL) or with 11-ketotestosterone (11-KT) (200 nM in ethanol (0.01%); Sigma) (García-López et al. 2010) for 5 days. Based on results obtained with the above experiments, zebrafish testes were incubated for 5 days in the presence of Fsh (100 ng/mL) with or without Wnt antagonist III, Box5 (WAIIIB5; 100 µM, Merck). WAIIIB5 is a N-terminally butyloxycarbonyl (Boc) hexapeptide derived from the human WNT5a sequence that inhibits the effect of WNT5a and shares 100% identity with the zebrafish Wnt5a sequence (Jenei et al. 2009). In a parallel experiment, testes were incubated under basal conditions or in the presence of the Wnt5a agonist Foxy-5 (100 µM, Tocris), which is a modified WAIIIB5 (formyl instead of Boc in the N-terminal sequence) that mimics the effects of Wnt5a (Säfholm et al. 2008, Mehdawi et al. 2016).

The production of biologically active steroids was blocked by including trilostane (25 µg/mL in dimethyl sulfoxide (0.01%); Chemos), an inhibitor of 3β-hydroxysteroid dehydrogenase activity, in all experiments with Fsh or Lh, both potent steroidogenic hormones in zebrafish (García-López et al. 2010).

At the end of the incubation period, testis tissues of the experiments described earlier was snap-frozen in liquid nitrogen and stored at −80°C until RNA extraction and quantification of transcript levels of selected genes (see ‘Transcript levels’ section) or was fixed for morphological analysis (see ‘Quantification of spermatogonial proliferation and of proportions of section surface areas’ section).

Transcript levels

The relative transcript levels of germ cell markers and other genes of interest (Table 1) were analyzed by real-time, qPCR assays.

Table 1

Primers used for gene expression studies.

Target genesPrimers nameSequence (5′-3′)Gene information
elf1a2476 (Fw)GCCGTCCCACCGACAAGReference gene (Morais et al. 2013)
2477 (Rv)CCACACGACCCACAGGTACAG
foxa25741 (Fw)GTCAAAATGGAGGGACACGAACPotential marker for type A undifferentiated spermatogonia (Safian et al. 2017)
5743 (Rv)CATGTTGCTGACCGAGGTGTAA
nanos24817 (Fw)AAACGGAGAGACTGCGCAGATExpressed in type Aund spermatogonia (Beer & Draper 2013, Bellaiche et al. 2014)
4818 (Rv)CGTCCGTCCCTTGCCTTT
piwil22994 (Fw) TGATACCAGCAAGAAGAGCAGATCTExpressed in all germ cell type except type Aund and spermatozoa (Houwing et al. 2008)
2995 (Rv) ATTTGGAAGGTCACCCTGGAGTA
dazl3104 (Fw) AGTGCAGACTTTGCTAACCCTTATGTAExpressed by B spermatogonia and primary spermatocytes (Chen et al. 2013)
3105 (Rv)GTCCACTGCTCCAAGTTGCTCT
aldh1a24359 (Fw)CGCTGGATGGGCAGATAAGAEnzyme require for retinoic acid synthesis (Pradhan & Olsson 2015)
4360 (Rv)TCTGGTGAGGGTGAAAAATTCTC
cyp26a14383 (Fw)TGGGCTTGCCGTTCATTGEnzyme involved in retinoic acid degradation (Feng et al. 2015)
4384 (Rv)CATGCGCAGAAACTTCCTTCTC
wnt5a5431 (Fw)TGGAGATCGTGGACGCAAANon-canonical Wnt ligand (this paper)
5432 (Rv)CACTTCAGGAATCAGCAGAGGATT
wnt115439 (Fw)CTGAGCGTCATTTATCCATGCANon-canonical Wnt ligand (this paper)
5440 (Rv)ACGGAGCTCCCGTTTATCGT

Fw, forward; Rv, reverse.

Total RNA was isolated from the tissue using an RNAqueous Micro kit (Ambion), according to the manufacturer’s protocol. cDNA synthesis from total RNA and quantification of transcript levels were carried out as described previously (Bogerd et al. 2001). In brief, 2 µg of total RNA were reverse transcribed using 250 U of Superscript II RNase reverse transcriptase (Life Technologies). qPCRs were performed in SYBR Green assay mix (Applied Biosystems), specific qPCR primers (900 nM each) and 5 µL cDNA in a total volume of 20 µL. The quantification cycle (Cq) values were determined in aViiA7 Real-Time PCR System (Applied Biosystems) using default settings. The relative amounts of mRNA in the cDNA samples were calculated using the arithmetic comparative method (ΔΔCt method Livak & Schmittgen 2001)), as described in Bogerd et al. (2001). Transcript levels of the elongation factor 1a (ef1a) were stable and therefore, ef1a was used to normalize gene expression. All results were expressed as fold changes with respect to the control group.

Quantification of spermatogonial proliferation and of proportions of section surface areas

To quantify the proliferation activity of type A spermatogonia, 100 μg/mL of the proliferation marker 5-bromo-2′-deoxyuridine (BrdU; Sigma-Aldrich) was added to the tissue culture medium during the last 6 h of the incubation period. After fixation in methacarn (60% (v/v) absolute methanol, 30% chloroform and 10% acetic acid), the samples were dehydrated in graded ethanol (70, 96 and 100%), embedded in Technovit 7100 (Heraeus Kulzer) and sectioned at a thickness of 4 μm. To determine the proliferation activity, one set of sections was used to localize BrdU as described previously (Leal et al. 2009). The BrdU-labeling index was determined by analyzing 100 cysts (Adiff spermatogonia) or 100 Aund cells, discriminating between BrdU-positive and -negative cysts and cells, respectively. Furthermore, for one set of experiments, the number of BrdU-positive free SCs (apparently not associated with germ cells), SCs contacting BrdU-positive or -negative Aund, and SCs contacting BrdU-positive or -negative Adiff was determined using ten randomly chosen, non-overlapping fields at ×400 magnification.

To quantify the proportion of section area occupied by Aund and Adiff spermatogonia, another set of sections was stained with toluidine blue and ten randomly chosen, non-overlapping fields were photographed at ×400 magnification with a digital camera. The images were analyzed quantitatively based on the number of points counted over the germ cell types investigated (Aund and Adiff), using the ImageJ freeware (National Institute of Health, Bethesda, MD, USA, http://rsbweb.nih.gov/ij) with a 540-point grid, i.e. 5400 data points were analyzed per individual.

Wnt5a quantification by Western blot

To study if Fsh stimulates Wnt5a protein production, zebrafish testes were incubated under basal conditions or in the presence of Fsh (100 ng/mL) for 5 days. After the incubation period, tissue was processed for Western blot according to Safian et al. (2018). Briefly, total proteins were extracted and resolved in 10% SDS-PAGE. Primary Wnt5a antibody incubation was carried out overnight at 4°C (2 µg/mL; AS-55879, Anaspec). After PBS washes, secondary horseradish peroxidase-conjugated goat anti-rabbit (0.2 µg/mL; 111-035-003, Jackson ImmunoResearch Laboratories Inc.) was incubated for 1 h at room temperature. Protein detection was performed using Pierce ECL Plus Substrate (Thermo Scientific) according to the manufacturer’s instructions. Films were scanned and densitometric analysis of the bands was performed with ImageJ freeware. Wnt5a analysis was normalized to Coomassie blue staining of total protein (Fuentes et al. 2013).

Immunofluorescence on paraffin sections

The cell types responsible for Wnt5a production in adult zebrafish testis were identified by immunofluorescence. After fixation in phosphate-buffered 4% paraformaldehyde at 4°C overnight, testis tissue was dehydrated and embedded in paraplast (Sigma-Aldrich). Sections of 5 µm thickness were dewaxed and rehydrated, according to conventional techniques. After antigen retrieval (10 mM sodium citrate, 0.05% Tween 20, pH 6.0; at 98°C for 10 min) nonspecific antibody binding was blocked by pre-incubating slides with 5% normal goat serum (Sigma-Aldrich) and 1% acetylated bovine serum albumin (BSA) (Sigma-Aldrich) for 30 min at room temperature. Then, sections were incubated with a primary antibody raised in rabbit against zebrafish Wnt5a (4 µg/mL; AS-55879, Anaspec) in PBS containing 1% BSA overnight at 4°C. After PBS washes, sections were incubated with secondary goat anti-rabbit Alexa fluor 488 (8 µg/mL, A11034, Sigma-Aldrich) containing 10% normal horse serum (Sigma-Aldrich) for 90 min at room temperature. After PBS washes, the sections were incubated for 3 min with propidium iodide (1 µg/mL, Sigma-Aldrich). Sections were mounted in Vectashield (H-1000, Vector) and images were taken using a confocal laser scanning microscope (LSM 700, Zeiss). As negative control for the anti-Wnt5a staining, 4 µg/mL of primary antibody was pre-incubated with 20 µg/mL Wnt5a blocking peptide (AS-55879P, Anaspec) (volume ratio antibody:blocking peptide of 1:5) for 2 h at room temperature in PBS containing 1% BSA.

Testis whole mount in situ hybridization of insl3 and immunofluorescent detection of Wnt5a

To further characterize the cell type(s) showing immunocytochemical labeling for Wnt5a, zebrafish testis was used to localize Wnt5a by immunofluorescence in combination with localizing transcripts of the LC-specific insl3 gene by fluorescent in situ hybridization. Zebrafish insl3 DIG-riboprobes were generated as described previously (Good-Ávila et al. 2009). We followed previously described methods (Draper 2017) with minor modifications. In brief, tissue was treated with proteinase K (20 µg/mL; Sigma-Aldrich) for 20 min at 37°C and fixed in 4% paraformaldehyde for 20 min. Hybridization with sense and antisense DIG riboprobes was performed overnight at 70°C. After hybridization, tissue was incubated in PBT containing 5% normal goat serum (Sigma-Aldrich) and 1% acetylated BSA (Sigma-Aldrich) for 1 h. Then, tissue was incubated with rabbit anti-zebrafish Wnt5a antibody (see above) and anti-DIG conjugated to alkaline phosphatase (1:2000; Roche). After PBT washes, testis was incubated in 5% normal horse serum (Sigma-Aldrich) for 1 h, followed by secondary goat anti-rabbit Alexa fluor 488 (8 µg/mL, A11034, Sigma-Aldrich) containing 5% normal horse serum (Sigma-Aldrich) overnight at 4°C. After PBT washes, in situ hybridization was developed using HNPP/Fast Red (Roche) according to the manufacturer’s protocol. Images were taken using a confocal laser scanning microscope (LSM 700, Zeiss).

Statistical analysis

Statistical analyses were carried out using the GraphPad Prism 5 software package. Since our tissue culture system compares experiments the two testes of a given fish incubated under control versus experimental conditions, we applied Student’s t-test for paired observation to estimate the statistical significance of fold changes between treated and control conditions. These data are presented as fold of basal (mean ± standard error of the mean (s.e.m.)). We also compared all conditions, so that results were also processed statistically using one-way ANOVA, followed by Tukey’s post-hoc test.

Results

Fsh-stimulated proliferation and accumulation of Aund is further enhanced when blocking the β-catenin-dependent pathway

We reported that Fsh stimulated both self-renewal and differentiating proliferation of type A spermatogonia in zebrafish (Nóbrega et al. 2015, Safian et al. 2016) and that Fsh stimulated the release of Igf3 that in turn activated β-catenin signaling to promote the differentiation of type A spermatogonia (Safian et al. 2018). To study if the Wnt signaling system is involved in Fsh-stimulated self-renewal of Aund, zebrafish testes were exposed to Fsh with or without XAV939, an inhibitor of the β-catenin-dependent pathway. For Aund spermatogonia, both the proliferation activity and the proportion of section surface area increased while these parameters decreased for Adiff (Fig. 1A and B and Supplementary Fig. 1A and B, see section on supplementary data given at the end of this article). In parallel experiments, we quantified the transcript levels of selected genes and found increased mRNA levels of foxa2 and nanos2, markers for type A spermatogonia (Beer & Draper 2013, Bellaiche et al. 2014, Safian et al. 2017), and decreased transcript levels of dazl, expressed by B spermatogonia and primary spermatocytes (Chen et al. 2013) in response to Fsh and XAV939 (Fig. 1C). These experiments suggest that blocking β-catenin signaling reduced the Fsh-stimulated production of type Adiff spermatogonia, while strengthening Fsh effects on the proliferation and accumulation of Aund spermatogonia.

Figure 1

Download Figure

Figure 1

Inhibiting canonical β-catenin signaling increases Fsh-stimulated self-renewal of Aund spermatogonia but compromises the production of Adiff spermatogonia. (A) BrdU-labeling indices of type Aund and type Adiff spermatogonia in the presence of Fsh alone (100 ng/mL; dotted line; control condition) or in combination with 10 µM XAV393, an inhibitor of β-catenin signaling (represented by bars; n = 7). (B) Proportion of section surface area occupied by cysts containing type Aund and type Adiff spermatogonia in the presence of Fsh alone (100 ng/mL; dotted line; control condition) or in combination with 10 µM XAV393 (represented by bars; n = 7). (C) Gene expression analysis of germ cell markers in adult zebrafish testis after 5 days of tissue culture in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with 10 µM XAV393 (represented by bars; n = 7). The quantification cycles (Cq) of the reference gene (elf1a) are shown in the insert. Results are presented as fold changes with respect to the control group (100 ng/mL Fsh). Asterisks indicate significant differences (*P < 0.05; **P < 0.01; ***P < 0.001) between groups.

Citation: Journal of Endocrinology 239, 3; 10.1530/JOE-18-0447

Fsh uses a β-catenin-independent Wnt ligand to promote Aund proliferation

Considering that the non-canonical ligand WNT5A stimulated self-renewal divisions of Aund spermatogonia in mice (Tanaka et al. 2016, Tokue et al. 2017) and the results described earlier, we examined if non-canonical Wnt ligand transcript levels responded to Fsh while blocking β-catenin signaling with XAV939. We found that wnt5a and wnt11 expression was upregulated (Fig. 2A); the transcript levels of three other, non-canonical Wnt ligands expressed in the zebrafish testis (wnt4a and b, wnt5b) did not change significantly (data not shown). This opened the possibility that a β-catenin-independent pathway mediated Fsh effects on the proliferation activity of Aund. We tested this hypothesis with the following experiments. As expected, Fsh stimulated the proliferation of both Aund and Adiff spermatogonia (Fig. 2B and C). In the additional presence of XAV939, the proliferation of Aund was further stimulated, while the proliferation activity of Adiff was reduced (Fig. 2B and Supplementary Fig. 1A and compare to B). An inhibitor of Wnt ligand release (IWP-12) reduced the BrdU-labeling index of Aund, irrespective of the presence of XAV939 (Fig. 2B and Supplementary Fig. 1A and B compare to C and D), whereas Adiff proliferation did not change (Fig. 2C). These experiments suggest that Fsh can stimulate the production of certain non-canonical Wnt ligands and that the Fsh-triggered effect on the proliferation activity of Aund depends on the release of Wnt ligands. Neither XAV939 nor IWP-12 alone modulated the proliferation of Aund and Adiff (Fig. 2B, C and H), suggesting there was little basal Wnt release as well as little basal activity of β-catenin-dependent signaling.

Figure 2

Download Figure

Figure 2

Fsh modulates the proliferation activity of type A spermatogonia via non-canonical Wnt ligands. (A) Gene expression analysis in adult zebrafish testis after 5 days of tissue culture in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with 10 µM XAV393 (represented by bars; n = 7). (B) BrdU-labeling indices of type Aund under control (dotted line) or experimental (represented by a bars) conditions after 5 days of incubation: Fsh (n = 8); Fsh+XAV (n = 7); Fsh + XAV + IWP-12 (n = 8); Fsh + IWP-12 (n = 8); XAV (n = 5); IWP-12 (n = 6). (C) BrdU-labeling indices of type Adiff under control (dotted line) or experimental (represented by a bars) conditions after 5 days of incubation: Fsh (n = 8); Fsh + XAV (n = 7); Fsh + XAV + IWP-12 (n = 8); Fsh + IWP-12 (n = 8); XAV (n = 5); IWP-12 (n = 6). Results are presented as fold changes with respect to the control group (see ‘Material and methods’ section). Asterisks indicate significant differences (*P < 0.05; **P < 0.01) between groups and different letters indicate significant differences (P < 0.05) between groups.

Citation: Journal of Endocrinology 239, 3; 10.1530/JOE-18-0447

Fsh but neither Lh nor androgen modulate Wnt5a production in LCs

To test if Fsh stimulates the transcript levels of non-canonical Wnt ligands also in the absence of XAV939, the mRNA levels of wnt5a and wnt11 were analyzed in the absence and presence of Fsh (100 ng/mL) for 5 days. In addition, the transcripts of wnt5a and wnt11 were also analyzed in testes incubated under basal conditions or in the presence of the androgen 11 KT (200 nM) or Lh (500 ng/mL) for 5 days. Only the mRNA levels of wnt5a but not of wnt11 (and neither of wnt4a, wnt4b and wnt5b; data not shown) transcript levels increased in response to Fsh (Fig. 3A). Since transcript levels of wnt5a were induced by Fsh, we also analyzed if Fsh stimulates the production of Wn5a protein. Western blot and densitometric analysis revealed that 100 ng/mL Fsh increased the protein levels of Wnt5a in zebrafish testis after 5 days of incubation (Fig. 3B and C).

Figure 3

Download Figure

Figure 3

Endocrine regulation of Wnt5a protein production and cellular localization of Wnt5a.(A) Transcript levels of wnt5a and wnt11 in basal conditions (dotted line; control condition) or in the presence of Fsh (100 ng/mL; n = 8; represented by black bars), 11-KT (200 nM; n = 6; represented by gray bars) or Lh (500 ng/mL; n = 9; represented by white bars) in adult zebrafish testis. The quantification cycles (Cq) of the reference gene (elf1a) are shown in the insert. Results are presented as fold changes with respect to the control group (basal). (B) Western blot and (C) densitometric analysis of Wnt5a in zebrafish testis under basal conditions or in response to Fsh (100 ng/mL) after 5 days of incubation (n = 4). Asterisks indicate significant differences (*P < 0.05; **P < 0.01) between basal or control and experimental group. (D, E, F, G, H and I) Immunofluorescent detection of Wnt5a in paraffin sections of zebrafish testis. White dotted lines delimitate the spermatogenic tubules compartment. White arrows indicate the interstitial compartment. (G, H and I) Wnt5a antibody (Ab) preabsorbed with blocking peptide (B.P.) in paraffin sections of zebrafish testis.

Citation: Journal of Endocrinology 239, 3; 10.1530/JOE-18-0447

Cellular localization of Wnt5a production

Immunocytochemical studies localized Wnt5a protein to the interstitial compartment of the zebrafish testis (Fig. 3D, E, F, G, H and I). To further characterize the source of Wnt5a production, we performed a double fluorescent-labeling approach combining Wnt5a immunocytochemistry with in situ hybridization of the LC marker, insl3 mRNA (Assis et al. 2016). This analysis showed that Wnt5a protein and insl3 transcript were co-localized in LCs (Supplementary Fig. 1F, G, H and I).

Fsh-regulated Wnt5a stimulated Aund self-renewal

The results presented so far suggest that Fsh-stimulated Wnt5a release from LC increased the proliferation activity of type Aund spermatogonia. Considering that WNT5a promoted self-renewal division of mouse SSCs (Tanaka et al. 2016), we decided to obtain more direct evidence on the biological activity of Wnt5a. We analyzed the effects of an antagonist of Wnt5a (WAIIIB5) on Fsh-stimulated spermatogenesis. The proliferation activity and proportion of section surface area occupied by Aund spermatogonia in the presence of Fsh (100 ng/mL) were reduced when also WAIIIB5 (100 µM) was present (Fig. 4A and B). Furthermore, the transcript levels of piwil2 (expressed by all germ cells except Aund and spermatozoa) (Chen et al. 2013) and dazl increased (Fig. 4C). We also studied the effects of the Wnt5a agonist Foxy-5. The proliferation activity and proportion of area of Aund increased in response to Foxy-5 (100 µM) after 5 days of tissue culture while these parameters did not change for Adiff (Fig. 4D and E). Moreover, the transcript levels of foxa2 increased (Fig. 4F) in the presence of Foxy-5 while those of piwil2 and dazl decreased (Fig. 4F). Collectively, these results suggest that Wnt5a signaling increased the number of Aund spermatogonia by stimulating their proliferation while no change was observed among Adiff spermatogonia.

Figure 4

Download Figure

Figure 4

Effects of the Wnt5a antagonist (WAIIIB5) and the Wnt5a agonist (Foxy-5) on type A spermatogonia. (A) BrdU-labeling indices of type Aund and type Adiff spermatogonia in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with WAIIIB5 (100 µM; n = 7; represented by bars). (B) Proportion of section surface area occupied by cysts containing type Aund and type Adiff spermatogonia in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with WAIIIB5 (100 µM; n = 7; represented by bars). (C) Gene expression analysis of selected genes in adult zebrafish testis after 5 days of tissue culture in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with WAIIIB5 (100 µM; n = 9; represented by bars). The quantification cycles (Cq) of the reference gene (elf1a) are shown in the insert. (D) BrdU-labeling indices of type Aund and type Adiff spermatogonia under basal conditions (dotted line; control condition) or in the presence of Foxy-5 (100 µM; n = 5; represented by bars). (E) Proportion of section surface area occupied by cysts containing type Aund and type Adiff spermatogonia under basal conditions (dotted line; control condition) or in the presence of Foxy-5 (100 µM; n = 5; represented by bars). (F) Gene expression analysis of selected genes in adult zebrafish testis after 5 days of tissue culture under basal conditions (dotted line; control condition) or in the presence of Foxy-5 (100 µM; represented by bars; n = 7). The quantification cycles (Cq) of the reference gene (elf1a) are shown in the insert. Results are presented as fold changes with respect to the control group (basal). Asterisks indicate significant differences (*P < 0.05; **P < 0.01) between control and experimental group.

Citation: Journal of Endocrinology 239, 3; 10.1530/JOE-18-0447

Wnt5a antagonist and agonist modulates the transcript levels of retinoic acid-related genes

To further study the function of Wnt5a in zebrafish testis, the transcript levels of selected genes know to be important for spermatogenesis were analyzed in response to Fsh (100 ng/mL) and WAIIIB5 (100 µM) or in the presence of the Wnt5a agonist, Foxy-5 (100 µM). Wnt5a/Foxy-5 seemed to target mainly undifferentiated spermatogonia. We therefore selected a number of genes known to regulate the differentiation of type Aund spermatogonia. However, neither growth factor (amh, insl3, igf3) nor growth factor-binding protein (igfbp1a, -3 and -6a) transcript levels changed significantly in response to Fsh (100 ng/mL) and WAIIIB5 (100 µM) or in response to the Wnt5a agonist, and neither did the transcript levels of two steroidogenesis-related genes (star and cyp17a1; data not shown). On the other hand, WAIIIB5 (100 µM) decreased the transcript levels of cyp26a1, an enzyme involved in retinoic acid degradation (Feng et al. 2015) in a Fsh-stimulated spermatogenesis (Fig. 5). In contrast, Foxy-5 (100 µM) increased cyp26a1 mRNA levels (Fig. 5). The transcript levels of aldh1a2, an enzyme required for retinoic acid synthesis (Pradhan & Olsson 2015), did not responsd to either Fsh and WAIIIB5 or Foxy-5 (Fig. 5).

Figure 5

Download Figure

Figure 5

Transcript levels of retinoic acid-related genes in response to Fsh and the Wnt5a antagonist (WAIIIB5) or in response to the Wnt5a agonist (Foxy-5) after 5 days of incubation. Transcript levels are expressed as fold-change compared to control condition represented by a dotted line (100 ng/mL Fsh or basal conditions), as induced by Fsh (100 ng/mL) and WAIIIB5 (100 µM; n = 8; represented by bars) or Foxy-5 (100 µM; n = 7; represented by bars). Asterisks indicate significant differences (*P < 0.05) between basal and experimental group.

Citation: Journal of Endocrinology 239, 3; 10.1530/JOE-18-0447

Effects of Fsh on Sertoli cell proliferation

SC proliferation is required for fertility in the adult fish testis (De França et al. 2015), either for the production of new spermatogenic cysts to accommodate Aund derived from self-renewal divisions or for the growth of existing cysts to accommodate the growing germ cell clone. Therefore, we have also studied the number of BrdU-positive SCs that were free (i.e. apparently not in contact with germ cells) or that contacted Aund or Adiff spermatogonia. This was examined under basal conditions, in the presence of Fsh (100 ng/mL) alone or in the additional presence of XAV939 (10 µM), inhibiting β-catenin-signaling, the Wnt5a antagonist WAIIIB (100 µM) or of the Wnt5a agonist (Foxy-5, 100 µM). In addition, SC proliferation was also studied in the presence of Fsh (100 ng/mL) with or without either XAV939 (10 µM), inhibiting β-catenin-signaling, or the Wnt5a antagonist WAIIIB (100 µM). Fsh increased the number of proliferating SCs contacting BrdU-positive Aund and Adiff (Fig. 6A). In the additional presence of the β-catenin-pathway inhibitor, proliferation of free SCs increased, but proliferation of SCs contacting BrdU-positive Aund decreased (Fig. 6B). The BrdU-positive free SC and proliferating SCs contacting BrdU-negative Aund decreased in response to Fsh (100 ng/mL) and the Wnt5a inhibitor WAIIIB (100 µM) while the proliferation of free SC increased in the presence of Foxy-5 (Fig. 6C and D).

Figure 6

Download Figure

Figure 6

Effect of Fsh in basal conditions or in the presence of inhibitors or Foxy-5 on Sertoli cell proliferation contacting type A spermatogonia. Number of BrdU-positive ‘free’ Sertoli cells, Sertoli cells contacting BrdU-negative and BrdU-positive Aund, and Sertoli cells contacting BrdU-negative and BrdU-positive Adiff in the presence of: (A) 25 µg/mL trilostane (dotted line; control condition) or in the presence of Fsh (100 ng/mL; n = 8; represented by bars), (B) in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with XAV393 (10 µM; n = 7; represented by bars), (C) in the presence of Fsh (100 ng/mL, dotted line; control condition) or in combination with WAIIIB5 (100 µM; n = 7; represented by bars) and (D) in basal conditions or in the presence of Foxy-5 (100 µM; n = 5). Results are presented as fold changes with respect to the control group. Asterisks indicate significant differences (*P < 0.05; **P < 0.01) between control and experimental group.

Citation: Journal of Endocrinology 239, 3; 10.1530/JOE-18-0447

Discussion

Fsh promotes spermatogenesis by modulating LC (fish-specific, in context with the presence of the Fshr on LCs) and SC (in all vertebrates, in context with the presence of the Fshr on SCs) functions. A previous study showed that zebrafish Fsh activated, in an androgen-independent manner, the differentiating proliferation of type A spermatogonia, but did not change the proportion of Aund while increasing the one for Adiff spermatogonia (Safian et al. 2016). However, it was not known how Fsh acts to prevent depletion of type Aund spermatogonia. Here, we found that the effects of Fsh on Aund self-renewal and differentiating divisions were altered significantly when inhibiting β-catenin signaling, viz. the reduced proliferation activity and proportion of Adiff spermatogonia while these parameters were further increased for Aund spermatogonia. These morphometric results were supported by respective changes in germ cell marker gene transcript levels that suggested increases in type A spermatogonia at the expense of more differentiated germ cell types. We conclude that blocking β-catenin restricted Fsh effects from activating both self-renewal and differentiating divisions of type A spermatogonia toward preferentially facilitating the proliferation and accumulation of Aund spermatogonia in the zebrafish testis. Inhibition of these β-catenin-dependent pro-differentiation effects of Fsh is probably related to a downstream mediator of Fsh, Igf3, which activated β-catenin signaling independent of Wnt ligands to stimulate the differentiation of type A spermatogonia (Safian et al. 2018).

The above results also demonstrate that Fsh does not require β-catenin activity to stimulate the proliferation activity of Aund spermatogonia. This is in line with findings of Yeh et al. (2011) who reported that murine SSCs did not respond to canonical Wnt signaling. However, the findings that Fsh stimulated the proliferation activity and accumulation of zebrafish Aund (i) depended on Wnt ligand release and (ii) that Fsh triggered the production of Wnt5a by LCs jointly suggested an involvement of non-canonical Wnt signaling in regulating the activity of Aund spermatogonia. The relevance of this signaling was supported further by experiments with agonists and antagonists of Wnt5a. A recent study in mice also showed that WNT5A induced an accumulation of type Aund spermatogonia (Tanaka et al. 2016). Intriguingly, the regulation of Wnt5a is quite different in these two models: Tanaka and colleagues found that LH, but not Fsh, downregulated Wnt5a transcript levels in SCs indirectly by stimulating LC androgen production. In zebrafish, on the other hand, neither Lh nor androgen modulated testicular transcript levels of wnt5a while Fsh increased LC wnt5a transcript levels and probably also Wnt5a release. Regarding receptors potentially responding to WNT5a in testis, Yeh et al. (2011) found that in vitro, SSCs express the non-canonical signaling frizzled receptors (FZD) 3, 5 and 7 and also the alternative receptor Ror2. RNA sequencing data from previous experiments showed that zebrafish testis tissue also expresses several non-canonical Wnt receptors (Crespo et al. 2016, Morais et al. 2017). However, no information is available on the question which receptor specifically responds to WNT5a in mice or zebrafish testis tissue. Collectively, the data from the experiments shown in Figs 3 and 4 indicate that the role of Wnt5a in promoting self-renewal divisions of undifferentiated spermatogonia is conserved between zebrafish and mice, while the endocrine regulation and cellular site of expression of this factor differs between the two species.

While this Wnt5a function may be conserved in vertebrates, no information is available so far on signaling mechanisms potentially targeted by Wnt5a. Our initial studies do not provide evidence for an involvement of Amh, Insl3, Igf3 or androgens. However, retinoic acid signaling may be involved. Studies in mice have shown that a diet deficient in the retinoic acid precursor vitamin A resulted in the accumulation of undifferentiated spermatogonia (Van Pelt & de Rooij 1990, Li et al. 2011). Interestingly, it was found recently that somatic cells protect SSC from exogenous retinoic acid while allowing further differentiated cells to respond to retinoic acid in mice (Lord et al. 2018). In zebrafish, exposure to a diet low in vitamin D and also to an inhibitor of Aldh1a2 resulted in lower sperm count and fecundity after 3 weeks (Pradhan & Olsson 2015). In addition, mutation of aldh1a2 delayed the entry into meiosis while disrupting the cyp26a1 gene (encoding the enzyme degrading retinoic acid), accelerated the entry into meiosis in Nile tilapia (Feng et al. 2015). As cyp26a1 expression has been localized in LCs in the adult zebrafish testis (Rodríguez-Marí et al. 2013), it will be interesting to investigate which germ cell types respond to RA signaling in zebrafish. It therefore seems possible that one of the consequences of Wnt5a action in the zebrafish testis is to reduce retinoic acid signaling, thereby favoring the accumulation of Aund spermatogonia.

In addition to the mechanism described in the present study (Fsh-stimulated Wnt5a of LC origin promotes the production of undifferentiated spermatogonia), other mechanisms have alike effects in zebrafish: Amh inhibits the differentiation of Aund, promoting their accumulation, (Skaar et al. 2011) and T3 stimulated the generation of new cysts by increasing the proliferation of Aund spermatogonia and SCs in adult zebrafish testis (Morais et al. 2013). It appears that different, independent mechanisms, making use of distinct hormones and growth factors, operate to ensure that a sufficient number of spermatogenic cysts with a single Aund enveloped by SCs are available to form the basis of the spermatogenic process.

As mentioned earlier, the generation of new spermatogenic cysts and the growth and differentiation of existing cysts requires SC proliferation in the postpubertal fish testis (Schulz et al. 2005, De França et al. 2015). Therefore, we have also studied SC proliferation. In line with previous results (Safian et al. 2018), Fsh increased the proliferation activity of SCs contacting BrdU-positive Aund and Adiff in the presence of β-catenin signaling inhibitor, indicating a change in the Fsh effects from supporting the further development of existing cysts toward facilitating the formation of new spermatogenic cyst. Inhibiting and stimulating Wnt5a signaling by using a Wnt5a antagonist and agonist, respectively, revealed that Fsh-stimulated Wnt5a supports the formation of new cyst by increasing the proliferation of free SCs, and by supporting the proliferation of SCs associated with non-proliferating Aund. Taken together, these observations suggest that part of the Fsh effect that promotes the expansion of the Aund spermatogonial population includes the production of additional SCs that can then support newly formed Aund, thereby forming new spermatogenic cysts.

In summary, the pituitary hormone Fsh promoted the formation of Aund spermatogonia and SCs by stimulating LC production of the non-canonical Wnt ligand Wnt5a. This Fsh effect takes place in parallel to Fsh-triggered Igf3/β-catenin (Safian et al. 2018), Insl3 (Assis et al. 2016) and androgen signaling (García-López et al. 2010, Crowder et al. 2018) that all stimulate germ cell differentiation. We propose that the capacity of Fsh to induce a balanced stimulation of the spermatogenic process involves both the production of new spermatogenic cysts containing Aund via the non-canonical Wnt pathway and LC-derived Wnt5a, while spermatogonial differentiation is triggered via Igf3/β-catenin signaling (Safian et al. 2018) (Fig. 7). Additional pro-differentiation routes have been identified already as mentioned earlier, and other signaling pathways may be involved in promoting the production of Aund.

Figure 7

Download Figure

Figure 7

Schematic representation of the effects of Fsh on spermatogenesis by modulating canonical and β-catenin signaling. Fsh stimulates the production of the β-catenin-independent ligand Wnt5a in LCs, which modulates the transcription of genes important for spermatogenesis, to stimulate the accumulation of type Aund spermatogonia and the production of new cysts (left). Fsh also stimulates differentiating divisions of spermatogonia by increasing Igf3 release from Sertoli cells (Nóbrega et al. 2015), which activates β-catenin-dependent signaling (Safian et al. 2018). A full color version of this figure is available at https://doi.org/10.1530/JOE-18-0447.

Citation: Journal of Endocrinology 239, 3; 10.1530/JOE-18-0447

Supplementary data

This is linked to the online version of the paper at https://doi.org/10.1530/JOE-18-0447.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by the Research Council of Norway (SALMOSTERILE project nº: 221648/O30), by the European Union Grant LIFECYCLE FP7-222719, and by a scholarship awarded to D Safian from CONICYT/Becas Chile.

Acknowledgement

The authors thank Henk van der Kant for technical assistance in sectioning and immunohistochemistry.

References

  • AssisLHCCrespoDMoraisRDVSFrancaLRBogerdJSchulzRW 2016 Insl3 stimulates spermatogonial differentiation in the adult zebrafish (Danio rerio) testes. Cell and Tissue Research 363 579588. (https://doi.org/10.1007/s00441-015-2213-9)

  • BeerRLDraperBW 2013 nanos3 maintains germline stem cells and expression of the conserved germline stem cell gene nanos2 in the zebrafish ovary. Developmental Biology 374 308318. (https://doi.org/10.1016/j.ydbio.2012.12.003)

  • BellaicheJLareyreJJCautyCYanoAAllemandILe GacF 2014 Spermatogonial stem cell quest: nanos2, marker of a subpopulation of undifferentiated A spermatogonia in trout testis. Biology of Reproduction 90 114. (https://doi.org/10.1095/biolreprod.113.116392)

  • BogerdJBlomenröhrMAnderssonEvan der PuttenHHTensenCPVischerHFGrannemanJCJanssen-DommerholtCGoosHJSchulzRW 2001 Discrepancy between molecular structure and ligand selectivity of a testicular follicle-stimulating hormone receptor of the African catfish (Clarias gariepinus). Biology of Reproduction 64 16331643. (https://doi.org/10.1095/biolreprod64.6.1633)

  • ChenBDodgeMETangWLuJMaZFanCWWeiSHaoWKilgoreJWilliamsNS 2009 Small molecule–mediated disruption of Wnt-dependent signaling in tissue regeneration and cancer. Nature Chemical Biology 5 100107. (https://doi.org/10.1038/nchembio.137)

  • ChenSXBogerdJSchoonenNEMartijnJde WaalPPSchulzRW 2013 A progestin (17a, 20ß-dihydroxy-4-pregnen-3-one) stimulates early stages of spermatogenesis in zebrafish. General and Comparative Endocrinology 185 19. (https://doi.org/10.1016/j.ygcen.2013.01.005)

  • ChenLYWillisWDEddyEM 2016 Targeting the Gdnf gene in peritubular myoid cells disrupts undifferentiated spermatogonial cell development. PNAS 113 18291834. (https://doi.org/10.1073/pnas.1517994113)

  • CrespoDAssisLHFurmanekTBogerdJSchulzRW 2016 Expression profiling identifies Setoli and Leydig cells genes as Fsh targets in adult zebrafish testis. Molecular and Cellular Endocrinology 437 237251. (https://doi.org/10.1016/j.mce.2016.08.033)

  • CrowderCMLassiterCSGorelickDA 2018 Nuclear androgen receptor regulates testes organization and oocyte maturation in zebrafish. Endocrinology 159 980993. (https://doi.org/10.1210/en.2017-00617)

  • De FrançaLRNóbregaRHMoraisRDDe Castro AssisLHSchulzRW 2015 Sertoli Cell Structure and Function in Anamniote Vertebrates2nd edn385407. Amsterdam: Elsevier.

  • De RooijDG 2017 The nature and dynamics of spermatogonial stem cells. Developmental 144 30223030. (https://doi.org/10.1242/dev.146571)

  • DingLJYanGJGeQYYuFZhaoXDiaoZYWangZQYangZZSunYLHuYL 2011 FSH acts on the proliferation of type A spermatogonia via Nur77 that increases GDNF expression in the Sertoli cells. FEBS Letters 585 24372444. (https://doi.org/10.1016/j.febslet.2011.06.013)

  • DodgeMEMoonJTuladharRLuJJacobLSZhangLSShiHWangXMoroEMongeraA 2012 Diverse chemical scaffolds support direct inhibition of the membrane-bound O-acyltransferase porcupine. Journal of Biological Chemistry 287 2324623254. (https://doi.org/10.1074/jbc.M112.372029)

  • DraperBW 2017 Identification of germ-line stem cells in zebrafish. Methods in Molecular Biology 1463 103113. (https://doi.org/10.1007/978-1-4939-4017-2_8)

  • FengRFangLChengYHeXJiangWDongRShiHJiangDSunLWangD 2015 Retinoic acid homeostasis through aldh1a2 and cyp26a1 mediates meiotic entry in Nile tilapia (Oreochromis niloticus). Scientific Reports 5 10131. (https://doi.org/10.1038/srep10131)

  • FuentesENSafianDEinarsdottirIEValdésJAElorzaAAMolinaABjörnssonBT 2013 Nutritional status modulates plasma leptin, AMPK and TOR activation, and mitochondrial biogenesis: implications for cell metabolism and growth in skeletal muscle of the fine flounder. General and Comparative Endocrinology 186 172180. (https://doi.org/10.1016/j.ygcen.2013.02.009)

  • García-LópezÁde JongeHNóbregaRHde WaalPPvan DijkWHemrikaWTarangerGLBogerdJSchulzRW 2010 Studies in zebrafish reveal unusual cellular expression patterns of gonadotropin receptor messenger ribonucleic acids in the testis and unexpected functional differentiation of the gonadotropins. Endocrinology 151 23492360. (https://doi.org/10.1210/en.2009-1227)

  • Good-ÁvilaSVYegorovSHarronSBogerdJGlenPOzonJWilsonBC 2009 Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, and expression analysis. BMC Evolutionary Biology 9 293311. (https://doi.org/10.1186/1471-2148-9-293)

  • HouwingSBerezikovEKettingRF 2008 Zili is required for germ cell differentiation and meiosis in zebrafish. EMBO Journal 27 27022711. (https://doi.org/10.1038/emboj.2008.204)

  • HuangSMAMishinaYMLiuSCheungAStegmeierFMichaudGACharlatOWielletteEZhangYWiessnerS 2009 Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling. Nature 461 614620. (https://doi.org/10.1038/nature08356)

  • JeneiVSherwoodVHowlinJLinnskogRSäfholmAAxelssonLAnderssonT 2009 A t-butyloxycarbonyl-modified Wnt5a-derived hexapeptide functions as a potent antagonist of Wnt5a-dependent melanoma cell invasion. PNAS 106 1947319478. (https://doi.org/10.1073/pnas.0909409106)

  • LacerdaSMBatlouniSRCostaGMSegatelliTMQuirinoBRQueirozBMKalapothakisEDe FrançaLR 2010 A new and fast technique to generate offspring after germ cells transplantation in adult fish: the Nile tilapia (Oreochromis niloticus) model. PLoS ONE 5 e10740. (https://doi.org/10.1371/journal.pone.0010740)

  • LealMCDe WaalPPGarcía-LópezÁChenSXBogerdJSchulzRW 2009 Zebrafish primary testis tissue culture: an approach to study testis function ex vivo. General and Comparative Endocrinology 162 134138. (https://doi.org/10.1016/j.ygcen.2009.03.003)

  • LiHPalczewskiKBaehrWClagett-DameM 2011 Vitamin A deficiency results in meiotic failure and accumulation of undifferentiated spermatogonia in prepubertal mouse testis. Biology of Reproduction 84 336341. (https://doi.org/10.1095/biolreprod.110.086157)

  • LivakKJSchmittgenTD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2??-CT method. Methods 25 402408. (https://doi.org/10.1006/meth.2001.1262)

  • LordTOatleyJM 2017 A revised Asingle model to explain stem cell dynamics in the mouse male germline. Reproduction 154 R55R64. (https://doi.org/10.1530/REP-17-0034)

  • LordTOatleyMJOatleyJM 2018 Testicular architecture is critical for mediation of retinoic acid responsiveness by undifferentiated spermatogonial subtypes in the mouse. Stem Cell Reports 10 538552. (https://doi.org/10.1016/j.stemcr.2018.01.003)

  • MehdawiLMPrasadCPEhrnströmRAnderssonTSjölanderA 2016 Non-canonical WNT5A signaling up-regulates the expression of the tumor suppressor 15-PGDH and induces differentiation of colon cancer cells. Molecular Oncology 10 14151429. (https://doi.org/10.1016/j.molonc.2016.07.011)

  • MoraisRDVSNóbregaRHGomez-GonzalezNESchmidtRBogerdJFrancaLRSchulzRW 2013 Thyroid hormone stimulates the proliferation of Sertoli cells and single type A spermatogonia in adult zebrafish (Danio rerio) testis. Endocrinology 154 43654376. (https://doi.org/10.1210/en.2013-1308)

  • MoraisRDVSCrespoDNóbregaRHLemosMSVan de KantHJGDe FrançaLRMaleRBogerdJSchulzRW 2017 Antagonistic regulation of spermatogonial differentiation in zebrafish (Danio rerio) by Igf3 and Amh. Molecular and Cellular Cndocrinology 454 112124. (https://doi.org/10.1016/j.mce.2017.06.017)

  • MullaneyBPSkinnerMK 1992 Basic fibroblast growth factor (bFGF) gene expression and protein production during pubertal development of the seminiferous tubule: follicle-stimulating hormone-induced Sertoli cell bFGF expression. Endocrinology 131 29282934. (https://doi.org/10.1210/endo.131.6.1446630)

  • NóbregaRHGreebeCDVan de KantHBogerdJDe FrancLRSchulzRW 2010 Spermatogonial stem cell niche and spermatogonial stem cell transplantation in zebrafish. PLoS ONE 5 116. (https://doi.org/10.1371/journal.pone.0012808)

  • NóbregaRHMoraisRDVDSCrespoDDe WaalPPDe FrançaLRSchulzRWBogerdJ 2015 Fsh stimulates spermatogonial proliferation and differentiation in zebrafish via Igf3. Endocrinology 156 38043817. (https://doi.org/10.1210/en.2015-1157)

  • OatleyJMOatleyMJAvarbockMRTobiasJWBrinsterRL 2009 Colony stimulating factor 1 is an extrinsic stimulator of mouse spermatogonial stem cell self-renewal. Development 136 11911199. (https://doi.org/10.1242/dev.032243)

  • OhtaTMiyakeHMiuraCKameiHAidaKMiuraT 2007 Follicle stimulating hormone induces spermatogenesis mediated by androgen production in Japanese eel, Anguilla japonica. Biology of Reproduction 77 970977. (https://doi.org/10.1095/biolreprod.107.062299)

  • PitettiJLCalvelPZimmermannCConneBPapaioannouMDAubryFCederrothCRUrnerFFumelBCrausazM 2013 An essential role for insulin and IGF1 receptors in regulating Sertoli cell proliferation, testis size, and FSH action in mice. Molecular Endocrinology 27 814827. (https://doi.org/10.1210/me.2012-1258)

  • PradhanAOlssonPE 2015 Inhibition of retinoic acid synthesis disrupts spermatogenesis and fecundity in zebrafish. General and Comparative Endocrinology 217 8191. (https://doi.org/10.1016/j.ygcen.2015.02.002)

  • Rodríguez-MaríACañestroCBreMillerRACatchenJMYanYLPostlethwaitJH 2013 Retinoic acid metabolic genes, meiosis, and gonadal sex differentiation in zebrafish. PLOS ONE 8 e73951. (https://doi.org/10.1371/journal.pone.0073951)

  • SäfholmATuomelaJRosenkvistJDejmekJHärkönenPAnderssonT 2008 The Wnt-5a–derived hexapeptide foxy-5 inhibits breast cancer metastasis in vivo by targeting cell motility. Clinical Cancer Research 14 65566563. (https://doi.org/10.1158/1078-0432.CCR-08-0711)

  • SafianDMoraisDBogerdJSchulzRW 2016 Igf binding proteins protect undifferentiated spermatogonia in the zebrafish testis against excessive differentiation. Endocrinology 157 44234433. (https://doi.org/10.1210/en.2016-1315)

  • SafianDvan der KantHJGCrespoDBogerdJSchulzRW 2017 Follicle-stimulating hormone regulates igfbp gene expression directly or via Downstream effectors to modulate Igf3 effects on zebrafish spermatogenesis. Frontier in Endocrinology 8 328. (https://doi.org/10.3389/fendo.2017.00328)

  • SafianDBogerdJSchulzRW 2018 Igf3 activates ß-catenin signaling to stimulate spermatogonial differentiation in zebrafish. Journal of Endocrinology 238 245257. (https://doi.org/10.1530/JOE-18-0124)

  • SalicALeeEMayerLKirschnerMW 2000 Control of ß-catenin stability: reconstitution of the cytoplasmic steps of the wnt pathway in Xenopus egg extracts. Molecular Cell 5 523532. (https://doi.org/10.1016/S1097-2765(00)80446-3)

  • SatoTSuzukiAShibataNSakaizumiMHamaguchiS 2008 The novel mutant scl of the medaka fish, Oryzias latipes, shows no secondary sex characters. Zoological Science 25 299306. (https://doi.org/10.2108/zsj.25.299)

  • SatoMHayashiMYoshizakiG 2017 Stem cell activity of type A spermatogonia is seasonally regulated in rainbow trout. Biology of Reproduction 96 13031316. (https://doi.org/10.1093/biolre/iox049)

  • SawatariEShikinaSTakeuchiTYoshizakiG 2007 A novel transforming growth factor-ß superfamily member expressed in gonadal somatic cells enhances primordial germ cell and spermatogonial proliferation in rainbow trout (Oncorhynchus mykiss). Developmental Biology 301 266275. (https://doi.org/10.1016/j.ydbio.2006.10.001)

  • SchulzRWMentingSBogerdJDe FrançaLRVilelaDAGodinhoHP 2005 Sertoli cell proliferation in the adult testis—evidence from two fish species belonging to different orders. Biology of Reproduction 73 891898. (https://doi.org/10.1095/biolreprod.105.039891)

  • SchulzRWDe FrançaLRLareyreJJLeGacFChiarini-GarciaHNobregaRHMiuraT 2010 Spermatogenesis in fish. General and Comparative Endocrinology 165 390411. (https://doi.org/10.1016/j.ygcen.2009.02.013)

  • ShimizuNKawakamiKIshitaniT 2012 Visualization and exploration of Tcf/Lef function using a highly responsive Wnt/ß-catenin signaling-reporter transgenic zebrafish. Developmental Biology 370 7185. (https://doi.org/10.1016/j.ydbio.2012.07.016)

  • SkaarKSNóbregaRHMagarakiAOlsenLCSchulzRWMaleR 2011 Proteolytically activated, recombinant anti-Müllerian hormone inhibits androgen secretion, proliferation, and differentiation of spermatogonia in adult zebrafish testis organ cultures. Endocrinology 152 35273540. (https://doi.org/10.1210/en.2010-1469)

  • TakaseHMNusseR 2016 Paracrine Wnt/ß-catenin signaling mediates proliferation of undifferentiated spermatogonia in the adult mouse testis. PNAS 113 E1489E1497. (https://doi.org/10.1073/pnas.1601461113)

  • TanakaTKanatsu-ShinoharaMLeiZRaoCVShinoharaT 2016 The luteinizing hormone-testosterone pathway regulates mouse spermatogonial stem cell self-renewal by suppressing WNT5A expression in Sertoli cells. Stem Cell Reports 7 279291. (https://doi.org/10.1016/j.stemcr.2016.07.005)

  • TokueMIkamiKMizunoSTakagiCMiyagiATakadaRNodaCKitadateYHaraKMizuguchiH 2017 SHISA6 confers resistance to differentiation-promoting Wnt/ß-catenin signaling in mouse spermatogenic stem cells. Stem Cell Reports 8 561575. (https://doi.org/10.1016/j.stemcr.2017.01.006)

  • Van AmerongenR 2012 Alternative Wnt pathways and receptors. Cold Spring Harbor Perspectives in Biology 4 a007914. (https://doi.org/10.1101/cshperspect.a007914)

  • Van PeltAMde RooijDG 1990 Synchronization of the seminiferous epithelium after vitamin A replacement in vitamin A-deficient mice. Biology of Reproduction 43 363367. (https://doi.org/10.1095/biolreprod43.3.363)

  • YehJRZhangXNaganoMC 2011 Wnt5a is a cell-extrinsic factor that supports self-renewal of mouse spermatogonial stem cells. Journal of Cell Science 124 23572366. (https://doi.org/10.1242/jcs.080903)

 

An official journal of

Society for Endocrinology

Sections

Figures

  • View in gallery

    Inhibiting canonical β-catenin signaling increases Fsh-stimulated self-renewal of Aund spermatogonia but compromises the production of Adiff spermatogonia. (A) BrdU-labeling indices of type Aund and type Adiff spermatogonia in the presence of Fsh alone (100 ng/mL; dotted line; control condition) or in combination with 10 µM XAV393, an inhibitor of β-catenin signaling (represented by bars; n = 7). (B) Proportion of section surface area occupied by cysts containing type Aund and type Adiff spermatogonia in the presence of Fsh alone (100 ng/mL; dotted line; control condition) or in combination with 10 µM XAV393 (represented by bars; n = 7). (C) Gene expression analysis of germ cell markers in adult zebrafish testis after 5 days of tissue culture in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with 10 µM XAV393 (represented by bars; n = 7). The quantification cycles (Cq) of the reference gene (elf1a) are shown in the insert. Results are presented as fold changes with respect to the control group (100 ng/mL Fsh). Asterisks indicate significant differences (*P < 0.05; **P < 0.01; ***P < 0.001) between groups.

  • View in gallery

    Fsh modulates the proliferation activity of type A spermatogonia via non-canonical Wnt ligands. (A) Gene expression analysis in adult zebrafish testis after 5 days of tissue culture in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with 10 µM XAV393 (represented by bars; n = 7). (B) BrdU-labeling indices of type Aund under control (dotted line) or experimental (represented by a bars) conditions after 5 days of incubation: Fsh (n = 8); Fsh+XAV (n = 7); Fsh + XAV + IWP-12 (n = 8); Fsh + IWP-12 (n = 8); XAV (n = 5); IWP-12 (n = 6). (C) BrdU-labeling indices of type Adiff under control (dotted line) or experimental (represented by a bars) conditions after 5 days of incubation: Fsh (n = 8); Fsh + XAV (n = 7); Fsh + XAV + IWP-12 (n = 8); Fsh + IWP-12 (n = 8); XAV (n = 5); IWP-12 (n = 6). Results are presented as fold changes with respect to the control group (see ‘Material and methods’ section). Asterisks indicate significant differences (*P < 0.05; **P < 0.01) between groups and different letters indicate significant differences (P < 0.05) between groups.

  • View in gallery

    Endocrine regulation of Wnt5a protein production and cellular localization of Wnt5a.(A) Transcript levels of wnt5a and wnt11 in basal conditions (dotted line; control condition) or in the presence of Fsh (100 ng/mL; n = 8; represented by black bars), 11-KT (200 nM; n = 6; represented by gray bars) or Lh (500 ng/mL; n = 9; represented by white bars) in adult zebrafish testis. The quantification cycles (Cq) of the reference gene (elf1a) are shown in the insert. Results are presented as fold changes with respect to the control group (basal). (B) Western blot and (C) densitometric analysis of Wnt5a in zebrafish testis under basal conditions or in response to Fsh (100 ng/mL) after 5 days of incubation (n = 4). Asterisks indicate significant differences (*P < 0.05; **P < 0.01) between basal or control and experimental group. (D, E, F, G, H and I) Immunofluorescent detection of Wnt5a in paraffin sections of zebrafish testis. White dotted lines delimitate the spermatogenic tubules compartment. White arrows indicate the interstitial compartment. (G, H and I) Wnt5a antibody (Ab) preabsorbed with blocking peptide (B.P.) in paraffin sections of zebrafish testis.

  • View in gallery

    Effects of the Wnt5a antagonist (WAIIIB5) and the Wnt5a agonist (Foxy-5) on type A spermatogonia. (A) BrdU-labeling indices of type Aund and type Adiff spermatogonia in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with WAIIIB5 (100 µM; n = 7; represented by bars). (B) Proportion of section surface area occupied by cysts containing type Aund and type Adiff spermatogonia in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with WAIIIB5 (100 µM; n = 7; represented by bars). (C) Gene expression analysis of selected genes in adult zebrafish testis after 5 days of tissue culture in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with WAIIIB5 (100 µM; n = 9; represented by bars). The quantification cycles (Cq) of the reference gene (elf1a) are shown in the insert. (D) BrdU-labeling indices of type Aund and type Adiff spermatogonia under basal conditions (dotted line; control condition) or in the presence of Foxy-5 (100 µM; n = 5; represented by bars). (E) Proportion of section surface area occupied by cysts containing type Aund and type Adiff spermatogonia under basal conditions (dotted line; control condition) or in the presence of Foxy-5 (100 µM; n = 5; represented by bars). (F) Gene expression analysis of selected genes in adult zebrafish testis after 5 days of tissue culture under basal conditions (dotted line; control condition) or in the presence of Foxy-5 (100 µM; represented by bars; n = 7). The quantification cycles (Cq) of the reference gene (elf1a) are shown in the insert. Results are presented as fold changes with respect to the control group (basal). Asterisks indicate significant differences (*P < 0.05; **P < 0.01) between control and experimental group.

  • View in gallery

    Transcript levels of retinoic acid-related genes in response to Fsh and the Wnt5a antagonist (WAIIIB5) or in response to the Wnt5a agonist (Foxy-5) after 5 days of incubation. Transcript levels are expressed as fold-change compared to control condition represented by a dotted line (100 ng/mL Fsh or basal conditions), as induced by Fsh (100 ng/mL) and WAIIIB5 (100 µM; n = 8; represented by bars) or Foxy-5 (100 µM; n = 7; represented by bars). Asterisks indicate significant differences (*P < 0.05) between basal and experimental group.

  • View in gallery

    Effect of Fsh in basal conditions or in the presence of inhibitors or Foxy-5 on Sertoli cell proliferation contacting type A spermatogonia. Number of BrdU-positive ‘free’ Sertoli cells, Sertoli cells contacting BrdU-negative and BrdU-positive Aund, and Sertoli cells contacting BrdU-negative and BrdU-positive Adiff in the presence of: (A) 25 µg/mL trilostane (dotted line; control condition) or in the presence of Fsh (100 ng/mL; n = 8; represented by bars), (B) in the presence of Fsh (100 ng/mL; dotted line; control condition) or in combination with XAV393 (10 µM; n = 7; represented by bars), (C) in the presence of Fsh (100 ng/mL, dotted line; control condition) or in combination with WAIIIB5 (100 µM; n = 7; represented by bars) and (D) in basal conditions or in the presence of Foxy-5 (100 µM; n = 5). Results are presented as fold changes with respect to the control group. Asterisks indicate significant differences (*P < 0.05; **P < 0.01) between control and experimental group.

  • View in gallery

    Schematic representation of the effects of Fsh on spermatogenesis by modulating canonical and β-catenin signaling. Fsh stimulates the production of the β-catenin-independent ligand Wnt5a in LCs, which modulates the transcription of genes important for spermatogenesis, to stimulate the accumulation of type Aund spermatogonia and the production of new cysts (left). Fsh also stimulates differentiating divisions of spermatogonia by increasing Igf3 release from Sertoli cells (Nóbrega et al. 2015), which activates β-catenin-dependent signaling (Safian et al. 2018). A full color version of this figure is available at https://doi.org/10.1530/JOE-18-0447.

Index Card

PubMed

Google Scholar

Related Articles

Altmetrics

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 71 71 71
PDF Downloads 20 20 20