Filter

Refine by date

—

Refine by collections

Refine by access

  • Print
  • Save

Search Results

You are looking at 91 - 100 of 386 items for :

  • adiponectin x
  • Refine by access: All content x
Clear All
Ali Aflatounian Fertility and Research Centre, School of Women’s & Children’s Health, University of New South Wales Sydney, New South Wales, Australia

Search for other papers by Ali Aflatounian in
Google Scholar
PubMed Close
,
Melissa C Edwards Fertility and Research Centre, School of Women’s & Children’s Health, University of New South Wales Sydney, New South Wales, Australia
Andrology Laboratory, ANZAC Research Institute, University of Sydney, Concord Hospital, Sydney, New South Wales, Australia

Search for other papers by Melissa C Edwards in
Google Scholar
PubMed Close
,
Valentina Rodriguez Paris Fertility and Research Centre, School of Women’s & Children’s Health, University of New South Wales Sydney, New South Wales, Australia

Search for other papers by Valentina Rodriguez Paris in
Google Scholar
PubMed Close
,
Michael J Bertoldo Fertility and Research Centre, School of Women’s & Children’s Health, University of New South Wales Sydney, New South Wales, Australia
Laboratory for Ageing Research, School of Medical Sciences, University of New South Wales Sydney, New South Wales, Australia

Search for other papers by Michael J Bertoldo in
Google Scholar
PubMed Close
,
Reena Desai Andrology Laboratory, ANZAC Research Institute, University of Sydney, Concord Hospital, Sydney, New South Wales, Australia

Search for other papers by Reena Desai in
Google Scholar
PubMed Close
,
Robert B Gilchrist Fertility and Research Centre, School of Women’s & Children’s Health, University of New South Wales Sydney, New South Wales, Australia

Search for other papers by Robert B Gilchrist in
Google Scholar
PubMed Close
,
William L Ledger Fertility and Research Centre, School of Women’s & Children’s Health, University of New South Wales Sydney, New South Wales, Australia

Search for other papers by William L Ledger in
Google Scholar
PubMed Close
,
David J Handelsman Andrology Laboratory, ANZAC Research Institute, University of Sydney, Concord Hospital, Sydney, New South Wales, Australia

Search for other papers by David J Handelsman in
Google Scholar
PubMed Close
, and
Kirsty A Walters Fertility and Research Centre, School of Women’s & Children’s Health, University of New South Wales Sydney, New South Wales, Australia
Andrology Laboratory, ANZAC Research Institute, University of Sydney, Concord Hospital, Sydney, New South Wales, Australia

Search for other papers by Kirsty A Walters in
Google Scholar
PubMed Close

three sections of the fat pad, with at least 200 µm separating these sections, as described ( Caldwell et al. 2014 ). Adiponectin assay Total full-length mouse adiponectin concentrations were measured in serum using a Quantikine ELISA Kit from

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-19-0530
Volume/Issue:
Volume 245: Issue 3
Restricted access
Stephanie L Clookey Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, Missouri, USA

Search for other papers by Stephanie L Clookey in
Google Scholar
PubMed Close
,
Rebecca J Welly Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, Missouri, USA

Search for other papers by Rebecca J Welly in
Google Scholar
PubMed Close
,
Terese M Zidon Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, Missouri, USA

Search for other papers by Terese M Zidon in
Google Scholar
PubMed Close
,
Michelle L Gastecki Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, Missouri, USA

Search for other papers by Michelle L Gastecki in
Google Scholar
PubMed Close
,
Makenzie L Woodford Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, Missouri, USA

Search for other papers by Makenzie L Woodford in
Google Scholar
PubMed Close
,
Zachary I Grunewald Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, Missouri, USA

Search for other papers by Zachary I Grunewald in
Google Scholar
PubMed Close
,
Nathan C Winn Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, Missouri, USA

Search for other papers by Nathan C Winn in
Google Scholar
PubMed Close
,
Dusti Eaton Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, Missouri, USA

Search for other papers by Dusti Eaton in
Google Scholar
PubMed Close
,
Natalia G Karasseva Transgenic Animal Core, University of Missouri, Columbia, Missouri, USA

Search for other papers by Natalia G Karasseva in
Google Scholar
PubMed Close
,
Harold S Sacks Endocrine and Diabetes Division, Veterans Greater Los Angeles Healthcare System, Los Angeles, California, USA

Search for other papers by Harold S Sacks in
Google Scholar
PubMed Close
,
Jaume Padilla Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, Missouri, USA
Dalton Cardiovascular Research Center, University of Missouri, Columbia, Missouri, USA
Department of Child Health, University of Missouri, Columbia, Missouri, USA

Search for other papers by Jaume Padilla in
Google Scholar
PubMed Close
, and
Victoria J Vieira-Potter Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, Missouri, USA

Search for other papers by Victoria J Vieira-Potter in
Google Scholar
PubMed Close

)) and an index of adipose tissue insulin resistance (ADIPO-IR) was calculated as the product of fasting insulin (μU/L) and fasting NEFAs (mmol/L) ( Lomonaco et al. 2012 ). Fasting levels of circulating adipokines, leptin and adiponectin, were measured

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-18-0139
Volume/Issue:
Volume 239: Issue 2
Free access
Joëlle Dupont PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Joëlle Dupont in
Google Scholar
PubMed Close
,
Sophie Tesseraud PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Sophie Tesseraud in
Google Scholar
PubMed Close
,
Michel Derouet PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Michel Derouet in
Google Scholar
PubMed Close
,
Anne Collin PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Anne Collin in
Google Scholar
PubMed Close
,
Nicole Rideau PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Nicole Rideau in
Google Scholar
PubMed Close
,
Sabine Crochet PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Sabine Crochet in
Google Scholar
PubMed Close
,
Estelle Godet PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Estelle Godet in
Google Scholar
PubMed Close
,
Estelle Cailleau-Audouin PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Estelle Cailleau-Audouin in
Google Scholar
PubMed Close
,
Sonia Métayer-Coustard PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Sonia Métayer-Coustard in
Google Scholar
PubMed Close
,
Michel J Duclos PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Michel J Duclos in
Google Scholar
PubMed Close
,
Christian Gespach PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Christian Gespach in
Google Scholar
PubMed Close
,
Tom E Porter PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Tom E Porter in
Google Scholar
PubMed Close
,
Larry A Cogburn PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Larry A Cogburn in
Google Scholar
PubMed Close
, and
Jean Simon PRC (UMR 6175), Station de Recherches Avicoles (UR 83), INSERM, Department of Animal and Avian Sciences, Department of Animal and Food Sciences, INRA, 37380 Nouzilly, France

Search for other papers by Jean Simon in
Google Scholar
PubMed Close

-Deiodinase GGAAATCGTGTCTGATGTTGTCA AACCCCCCCCATAAATAGGA  IGFBP1 CTATTTGCCCAACTGTAACAAG CAGCACCCAGCGGAATCT  Adiponectin GCCAGGTCTACAAGGTGTCA CCATGTGTCCTGGAAATCCT  Adiponectin R1 CCAGGAGAAGGTTGTGTTTG TGATCAGCAGTGCAATTCCT  Adiponectin R2 TCATGGCTCTTCCACACAGT

Article Type:
Research Article
DOI:
https://doi.org/10.1677/JOE-08-0055
Volume/Issue:
Volume 197: Issue 3
Free access
Xiao-Bing Cui Department of Physiology and Pharmacology, Renmin Hospital, Antioxidant and Gene Regulation Laboratory, University of Georgia, 501 D.W. Brooks Drive, Athens, Georgia 30602, USA

Search for other papers by Xiao-Bing Cui in
Google Scholar
PubMed Close
,
Jun-Na Luan Department of Physiology and Pharmacology, Renmin Hospital, Antioxidant and Gene Regulation Laboratory, University of Georgia, 501 D.W. Brooks Drive, Athens, Georgia 30602, USA

Search for other papers by Jun-Na Luan in
Google Scholar
PubMed Close
,
Jianping Ye Department of Physiology and Pharmacology, Renmin Hospital, Antioxidant and Gene Regulation Laboratory, University of Georgia, 501 D.W. Brooks Drive, Athens, Georgia 30602, USA

Search for other papers by Jianping Ye in
Google Scholar
PubMed Close
, and
Shi-You Chen Department of Physiology and Pharmacology, Renmin Hospital, Antioxidant and Gene Regulation Laboratory, University of Georgia, 501 D.W. Brooks Drive, Athens, Georgia 30602, USA
Department of Physiology and Pharmacology, Renmin Hospital, Antioxidant and Gene Regulation Laboratory, University of Georgia, 501 D.W. Brooks Drive, Athens, Georgia 30602, USA

Search for other papers by Shi-You Chen in
Google Scholar
PubMed Close

–Aldrich) at a dose of 1.5 IU/kg body weight, and blood glucose was measured at indicated times. Blood biochemical analysis Serum samples were analyzed for adiponectin, leptin, insulin, triglyceride, and cholesterol using the Adiponectin Mouse ELISA Kit (Abcam

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-14-0548
Volume/Issue:
Volume 224: Issue 2
Free access
Christy M Gliniak Touchstone Diabetes Center, The University of Texas Southwestern Medical Center, Dallas, Texas, United States

Search for other papers by Christy M Gliniak in
Google Scholar
PubMed Close
,
Line Pedersen Touchstone Diabetes Center, The University of Texas Southwestern Medical Center, Dallas, Texas, United States

Search for other papers by Line Pedersen in
Google Scholar
PubMed Close
, and
Philipp E Scherer Touchstone Diabetes Center, The University of Texas Southwestern Medical Center, Dallas, Texas, United States

Search for other papers by Philipp E Scherer in
Google Scholar
PubMed Close

adiponectin levels ( Straub & Scherer 2019 ). Although a role for these factors has been well described in other fibrotic tissues, the mechanistic insight of how these factors regulate adipose tissue fibrosis is just beginning to materialize. Leptin is

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JOE-23-0180
Volume/Issue:
Volume 259: Issue 3
Free access
Lewin Small Diabetes and Metabolism Division, Garvan Institute, Sydney, New South Wales, Australia

Search for other papers by Lewin Small in
Google Scholar
PubMed Close
,
Henry Gong The University of Sydney, School of Medical Sciences, Charles Perkins Centre, Sydney, New South Wales, Australia

Search for other papers by Henry Gong in
Google Scholar
PubMed Close
,
Christian Yassmin The University of Sydney, School of Medical Sciences, Charles Perkins Centre, Sydney, New South Wales, Australia

Search for other papers by Christian Yassmin in
Google Scholar
PubMed Close
,
Gregory J Cooney Diabetes and Metabolism Division, Garvan Institute, Sydney, New South Wales, Australia
The University of Sydney, School of Medical Sciences, Charles Perkins Centre, Sydney, New South Wales, Australia

Search for other papers by Gregory J Cooney in
Google Scholar
PubMed Close
, and
Amanda E Brandon Diabetes and Metabolism Division, Garvan Institute, Sydney, New South Wales, Australia
The University of Sydney, School of Medical Sciences, Charles Perkins Centre, Sydney, New South Wales, Australia

Search for other papers by Amanda E Brandon in
Google Scholar
PubMed Close

’ disintegrations per minute (dpm) was calculated by subtraction and corrected for volume and weight of tissue to determine [ 3 H] 2-deoxy-glucose-6-phosphate accumulation as dpm/mg tissue. Biochemical analysis Plasma insulin, adiponectin and leptin levels

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-18-0279
Volume/Issue:
Volume 239: Issue 3
Restricted access
Eva Kassi Department of Biological Chemistry, University of Athens Medical School, 75, Mikras Asias Street, 11527 Athens, Greece

Search for other papers by Eva Kassi in
Google Scholar
PubMed Close
and
Athanasios G Papavassiliou Department of Biological Chemistry, University of Athens Medical School, 75, Mikras Asias Street, 11527 Athens, Greece

Search for other papers by Athanasios G Papavassiliou in
Google Scholar
PubMed Close

in a classic and in an osteoblast-specific manner, found an increase in β-cell proliferation, insulin secretion as well as insulin sensitivity – the latter through increasing the expression of adiponectin, an adipokine known to enhance insulin

Article Type:
Research Article
DOI:
https://doi.org/10.1677/JOE-08-0294
Volume/Issue:
Volume 199: Issue 2
Free access
Kazunari Nohara Division of Endocrinology, Division of Endocrinology, Department of Genetics and Development, INSERM U1048, Metabolism and Molecular Medicine and Comprehensive Center on Obesity, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA

Search for other papers by Kazunari Nohara in
Google Scholar
PubMed Close
,
Suhuan Liu Division of Endocrinology, Division of Endocrinology, Department of Genetics and Development, INSERM U1048, Metabolism and Molecular Medicine and Comprehensive Center on Obesity, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA

Search for other papers by Suhuan Liu in
Google Scholar
PubMed Close
,
Matthew S Meyers Division of Endocrinology, Division of Endocrinology, Department of Genetics and Development, INSERM U1048, Metabolism and Molecular Medicine and Comprehensive Center on Obesity, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA

Search for other papers by Matthew S Meyers in
Google Scholar
PubMed Close
,
Aurélie Waget Division of Endocrinology, Division of Endocrinology, Department of Genetics and Development, INSERM U1048, Metabolism and Molecular Medicine and Comprehensive Center on Obesity, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA

Search for other papers by Aurélie Waget in
Google Scholar
PubMed Close
,
Mathieu Ferron Division of Endocrinology, Division of Endocrinology, Department of Genetics and Development, INSERM U1048, Metabolism and Molecular Medicine and Comprehensive Center on Obesity, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA

Search for other papers by Mathieu Ferron in
Google Scholar
PubMed Close
,
Gérard Karsenty Division of Endocrinology, Division of Endocrinology, Department of Genetics and Development, INSERM U1048, Metabolism and Molecular Medicine and Comprehensive Center on Obesity, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA

Search for other papers by Gérard Karsenty in
Google Scholar
PubMed Close
,
Rémy Burcelin Division of Endocrinology, Division of Endocrinology, Department of Genetics and Development, INSERM U1048, Metabolism and Molecular Medicine and Comprehensive Center on Obesity, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA

Search for other papers by Rémy Burcelin in
Google Scholar
PubMed Close
, and
Franck Mauvais-Jarvis Division of Endocrinology, Division of Endocrinology, Department of Genetics and Development, INSERM U1048, Metabolism and Molecular Medicine and Comprehensive Center on Obesity, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA
Division of Endocrinology, Division of Endocrinology, Department of Genetics and Development, INSERM U1048, Metabolism and Molecular Medicine and Comprehensive Center on Obesity, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA

Search for other papers by Franck Mauvais-Jarvis in
Google Scholar
PubMed Close

National Institutes of Health Guide for the Care and Use of Animals. Metabolic studies Serum leptin and adiponectin concentrations were measured using ELISA (Linco Research, Inc., St Louis, MO, USA). Serum testosterone (Siemens Medical Solutions Diagnostics

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-13-0230
Volume/Issue:
Volume 219: Issue 3
Free access
J Jeyabalan
Search for other papers by J Jeyabalan in
Google Scholar
PubMed Close
,
M Shah
Search for other papers by M Shah in
Google Scholar
PubMed Close
,
B Viollet Royal Veterinary College, Institut Cochin, Royal College Street, London NW1 0TU, UK

Search for other papers by B Viollet in
Google Scholar
PubMed Close
, and
C Chenu
Search for other papers by C Chenu in
Google Scholar
PubMed Close

al . 1996 , Ducy 2000 ). The bone loss in age-related osteoporosis is associated with more adipogenesis and less bone formation ( Pei & Tontonoz 2004 ). Second, there are direct actions on bone of hormones produced by adipocytes, such as adiponectin

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-11-0306
Volume/Issue:
Volume 212: Issue 3
Free access
Pongpan Tanajak Cardiac Electrophysiology Research and Training Center, Cardiac Electrophysiology Unit, Center of Excellence in Cardiac Electrophysiology Research, Department of Oral Biology and Diagnostic Sciences, Faculty of Medicine
Cardiac Electrophysiology Research and Training Center, Cardiac Electrophysiology Unit, Center of Excellence in Cardiac Electrophysiology Research, Department of Oral Biology and Diagnostic Sciences, Faculty of Medicine

Search for other papers by Pongpan Tanajak in
Google Scholar
PubMed Close
,
Siriporn C Chattipakorn Cardiac Electrophysiology Research and Training Center, Cardiac Electrophysiology Unit, Center of Excellence in Cardiac Electrophysiology Research, Department of Oral Biology and Diagnostic Sciences, Faculty of Medicine
Cardiac Electrophysiology Research and Training Center, Cardiac Electrophysiology Unit, Center of Excellence in Cardiac Electrophysiology Research, Department of Oral Biology and Diagnostic Sciences, Faculty of Medicine
Cardiac Electrophysiology Research and Training Center, Cardiac Electrophysiology Unit, Center of Excellence in Cardiac Electrophysiology Research, Department of Oral Biology and Diagnostic Sciences, Faculty of Medicine

Search for other papers by Siriporn C Chattipakorn in
Google Scholar
PubMed Close
, and
Nipon Chattipakorn Cardiac Electrophysiology Research and Training Center, Cardiac Electrophysiology Unit, Center of Excellence in Cardiac Electrophysiology Research, Department of Oral Biology and Diagnostic Sciences, Faculty of Medicine
Cardiac Electrophysiology Research and Training Center, Cardiac Electrophysiology Unit, Center of Excellence in Cardiac Electrophysiology Research, Department of Oral Biology and Diagnostic Sciences, Faculty of Medicine
Cardiac Electrophysiology Research and Training Center, Cardiac Electrophysiology Unit, Center of Excellence in Cardiac Electrophysiology Research, Department of Oral Biology and Diagnostic Sciences, Faculty of Medicine

Search for other papers by Nipon Chattipakorn in
Google Scholar
PubMed Close

heart from apoptosis and remodeling through the activation of adiponectin release to activate the adiponectin signaling pathways ( Joki et al . 2015 ). Currently, the biological and pharmacological mechanism of FGF21 in cardioprotection is still to be

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JOE-15-0289
Volume/Issue:
Volume 227: Issue 2
Free access