Filter

Refine by date

—

Refine by collections

Refine by access

  • Print
  • Save

Search Results

You are looking at 101 - 110 of 215 items for :

  • Refine by access: All content x
Clear All
Bethania Mongi-Bragato Universidad Nacional de Córdoba, Facultad de Ciencias Médicas, Centro de Microscopía Electrónica, Córdoba, Argentina
Consejo Nacional de Investigaciones Científicas y Técnicas, Instituto de Investigaciones en Ciencias de la Salud (INICSA), Córdoba, Argentina

Search for other papers by Bethania Mongi-Bragato in
Google Scholar
PubMed Close
,
Ezequiel Grondona Universidad Nacional de Córdoba, Facultad de Ciencias Médicas, Centro de Microscopía Electrónica, Córdoba, Argentina
Consejo Nacional de Investigaciones Científicas y Técnicas, Instituto de Investigaciones en Ciencias de la Salud (INICSA), Córdoba, Argentina

Search for other papers by Ezequiel Grondona in
Google Scholar
PubMed Close
,
Liliana del Valle Sosa Universidad Nacional de Córdoba, Facultad de Ciencias Médicas, Centro de Microscopía Electrónica, Córdoba, Argentina
Consejo Nacional de Investigaciones Científicas y Técnicas, Instituto de Investigaciones en Ciencias de la Salud (INICSA), Córdoba, Argentina

Search for other papers by Liliana del Valle Sosa in
Google Scholar
PubMed Close
,
Natacha Zlocowski Universidad Nacional de Córdoba, Facultad de Ciencias Médicas, Centro de Microscopía Electrónica, Córdoba, Argentina
Consejo Nacional de Investigaciones Científicas y Técnicas, Instituto de Investigaciones en Ciencias de la Salud (INICSA), Córdoba, Argentina

Search for other papers by Natacha Zlocowski in
Google Scholar
PubMed Close
,
Ana Clara Venier Universidad Nacional de Córdoba, Facultad de Ciencias Médicas, Centro de Microscopía Electrónica, Córdoba, Argentina
Consejo Nacional de Investigaciones Científicas y Técnicas, Instituto de Investigaciones en Ciencias de la Salud (INICSA), Córdoba, Argentina

Search for other papers by Ana Clara Venier in
Google Scholar
PubMed Close
,
Alicia Inés Torres Universidad Nacional de Córdoba, Facultad de Ciencias Médicas, Centro de Microscopía Electrónica, Córdoba, Argentina
Consejo Nacional de Investigaciones Científicas y Técnicas, Instituto de Investigaciones en Ciencias de la Salud (INICSA), Córdoba, Argentina

Search for other papers by Alicia Inés Torres in
Google Scholar
PubMed Close
,
Alexandra Latini Laboratório de Bioenergética e Estresse Oxidativo – LABOX, Departamento de Bioquímica, Universidade Federal de Santa Catarina, Campus Universitário, Córrego Grande, Florianópolis, Brasil

Search for other papers by Alexandra Latini in
Google Scholar
PubMed Close
,
Rodrigo Bainy Leal Departamento de Bioquímica e Programa de Pós-graduação em Bioquímica, Centro de Ciências Biológicas, Universidade Federal de Santa Catarina, Florianópolis, Santa Catarina, Brasil

Search for other papers by Rodrigo Bainy Leal in
Google Scholar
PubMed Close
,
Silvina Gutiérrez Universidad Nacional de Córdoba, Facultad de Ciencias Médicas, Centro de Microscopía Electrónica, Córdoba, Argentina
Consejo Nacional de Investigaciones Científicas y Técnicas, Instituto de Investigaciones en Ciencias de la Salud (INICSA), Córdoba, Argentina

Search for other papers by Silvina Gutiérrez in
Google Scholar
PubMed Close
, and
Ana Lucía De Paul Universidad Nacional de Córdoba, Facultad de Ciencias Médicas, Centro de Microscopía Electrónica, Córdoba, Argentina
Consejo Nacional de Investigaciones Científicas y Técnicas, Instituto de Investigaciones en Ciencias de la Salud (INICSA), Córdoba, Argentina

Search for other papers by Ana Lucía De Paul in
Google Scholar
PubMed Close

involved in senescence growth arrest. Also, in the tumour microenvironment, SASP paracrine components such as VEGF ( Lloyd et al . 1999 , Ortiz et al. 2012 ) and matrix metalloproteinase 9 ( Turner et al. 2000 ) possibly contribute to the

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-19-0506
Volume/Issue:
Volume 245: Issue 2
Restricted access
Shanqi Fu Department of Biochemistry and Molecular Dentistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Shanqi Fu in
Google Scholar
PubMed Close
,
Miho Kuwahara Department of Biochemistry and Molecular Dentistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Miho Kuwahara in
Google Scholar
PubMed Close
,
Yoko Uchida Department of Preventive Dentistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Yoko Uchida in
Google Scholar
PubMed Close
,
Sei Kondo Department of Biochemistry and Molecular Dentistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Sei Kondo in
Google Scholar
PubMed Close
,
Daichi Hayashi Department of Biochemistry and Molecular Dentistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Daichi Hayashi in
Google Scholar
PubMed Close
,
Yuji Shimomura Department of Biochemistry and Molecular Dentistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Yuji Shimomura in
Google Scholar
PubMed Close
,
Asami Takagaki Department of Biochemistry and Molecular Dentistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Asami Takagaki in
Google Scholar
PubMed Close
,
Takashi Nishida Department of Biochemistry and Molecular Dentistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Takashi Nishida in
Google Scholar
PubMed Close
,
Yusuke Maruyama Department of Biology, College of Liberal Arts and Sciences, Tokyo Medical and Dental University, Ichikawa, Chiba, Japan

Search for other papers by Yusuke Maruyama in
Google Scholar
PubMed Close
,
Mika Ikegame Department of Oral Morphology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Mika Ikegame in
Google Scholar
PubMed Close
,
Atsuhiko Hattori Department of Biology, College of Liberal Arts and Sciences, Tokyo Medical and Dental University, Ichikawa, Chiba, Japan

Search for other papers by Atsuhiko Hattori in
Google Scholar
PubMed Close
,
Satoshi Kubota Department of Biochemistry and Molecular Dentistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Satoshi Kubota in
Google Scholar
PubMed Close
, and
Takako Hattori Department of Biochemistry and Molecular Dentistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan

Search for other papers by Takako Hattori in
Google Scholar
PubMed Close

Col10a1 TGCTGCCTCAAATACCCTTTCT TGGCGTATGGGATGAAGTATTG Vegf CCTGGTAATGGCCCCTCCTC CCCCATTGCTCTGTGCCTTG Mmp13 TCCTCGGAGACTGGTAATGG TGATGAAACCTGGACAAGCA Gapdh CAATGACCCCTTCATTGACC GACAAGCTTCCCGTTCTCAG

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-19-0022
Volume/Issue:
Volume 241: Issue 2
Free access
Anna Z Szóstek Department of Reproductive Immunology and Pathology, The Interdisciplinary Centre of Research in Animal Health, Institute of Animal Reproduction and Food Research, Olsztyn, Poland

Search for other papers by Anna Z Szóstek in
Google Scholar
PubMed Close
,
António M Galvão Department of Reproductive Immunology and Pathology, The Interdisciplinary Centre of Research in Animal Health, Institute of Animal Reproduction and Food Research, Olsztyn, Poland
Department of Reproductive Immunology and Pathology, The Interdisciplinary Centre of Research in Animal Health, Institute of Animal Reproduction and Food Research, Olsztyn, Poland

Search for other papers by António M Galvão in
Google Scholar
PubMed Close
,
Graça M Ferreira-Dias Department of Reproductive Immunology and Pathology, The Interdisciplinary Centre of Research in Animal Health, Institute of Animal Reproduction and Food Research, Olsztyn, Poland

Search for other papers by Graça M Ferreira-Dias in
Google Scholar
PubMed Close
, and
Dariusz J Skarzynski Department of Reproductive Immunology and Pathology, The Interdisciplinary Centre of Research in Animal Health, Institute of Animal Reproduction and Food Research, Olsztyn, Poland

Search for other papers by Dariusz J Skarzynski in
Google Scholar
PubMed Close

factors (VEGFs), angiopoietin-1, and angiopoietin-2 ( Tsujii et al . 1998 , Sales et al . 2002 ). Then, these factors stimulate angiogenesis by acting on endothelial cells to cause vessel sprouting and tubular structure formation ( Tsujii et al . 1998

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-13-0185
Volume/Issue:
Volume 220: Issue 3
Free access
Misuzu Yamashita
Search for other papers by Misuzu Yamashita in
Google Scholar
PubMed Close
,
Fumio Otsuka
Search for other papers by Fumio Otsuka in
Google Scholar
PubMed Close
,
Tomoyuki Mukai Department of Medicine and Clinical Science, Department of Rheumatology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, 2-5-1 Shikata-cho, Okayama City 700-8558, Japan

Search for other papers by Tomoyuki Mukai in
Google Scholar
PubMed Close
,
Hiroyuki Otani
Search for other papers by Hiroyuki Otani in
Google Scholar
PubMed Close
,
Kenichi Inagaki
Search for other papers by Kenichi Inagaki in
Google Scholar
PubMed Close
,
Tomoko Miyoshi
Search for other papers by Tomoko Miyoshi in
Google Scholar
PubMed Close
,
Junko Goto
Search for other papers by Junko Goto in
Google Scholar
PubMed Close
,
Masahiro Yamamura Department of Medicine and Clinical Science, Department of Rheumatology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, 2-5-1 Shikata-cho, Okayama City 700-8558, Japan

Search for other papers by Masahiro Yamamura in
Google Scholar
PubMed Close
, and
Hirofumi Makino
Search for other papers by Hirofumi Makino in
Google Scholar
PubMed Close

response to a number of factors including BMPs, TGFs, insulin-like growth factor-I (IGF-I), vascular endothelial growth factor (VEGF), and steroids ( McCarthy et al . 1989 , Noda & Camilliere 1989 , Celeste et al . 1990 , Midy & Plouet 1994 , Hughes

Article Type:
Research Article
DOI:
https://doi.org/10.1677/JOE-07-0532
Volume/Issue:
Volume 196: Issue 3
Free access
Elisabete A Forsberg The Rolf Luft Research Center for Diabetes and Endocrinology, Department of Endocrinology, Center for Pediatric and Adolescent Medicine, Karolinska Institutet, Stockholm, Sweden

Search for other papers by Elisabete A Forsberg in
Google Scholar
PubMed Close
,
Ileana R Botusan The Rolf Luft Research Center for Diabetes and Endocrinology, Department of Endocrinology, Center for Pediatric and Adolescent Medicine, Karolinska Institutet, Stockholm, Sweden

Search for other papers by Ileana R Botusan in
Google Scholar
PubMed Close
,
Jing Wang The Rolf Luft Research Center for Diabetes and Endocrinology, Department of Endocrinology, Center for Pediatric and Adolescent Medicine, Karolinska Institutet, Stockholm, Sweden

Search for other papers by Jing Wang in
Google Scholar
PubMed Close
,
Verena Peters The Rolf Luft Research Center for Diabetes and Endocrinology, Department of Endocrinology, Center for Pediatric and Adolescent Medicine, Karolinska Institutet, Stockholm, Sweden

Search for other papers by Verena Peters in
Google Scholar
PubMed Close
,
Ishrath Ansurudeen The Rolf Luft Research Center for Diabetes and Endocrinology, Department of Endocrinology, Center for Pediatric and Adolescent Medicine, Karolinska Institutet, Stockholm, Sweden

Search for other papers by Ishrath Ansurudeen in
Google Scholar
PubMed Close
,
Kerstin Brismar The Rolf Luft Research Center for Diabetes and Endocrinology, Department of Endocrinology, Center for Pediatric and Adolescent Medicine, Karolinska Institutet, Stockholm, Sweden
The Rolf Luft Research Center for Diabetes and Endocrinology, Department of Endocrinology, Center for Pediatric and Adolescent Medicine, Karolinska Institutet, Stockholm, Sweden

Search for other papers by Kerstin Brismar in
Google Scholar
PubMed Close
, and
Sergiu Bogdan Catrina The Rolf Luft Research Center for Diabetes and Endocrinology, Department of Endocrinology, Center for Pediatric and Adolescent Medicine, Karolinska Institutet, Stockholm, Sweden
The Rolf Luft Research Center for Diabetes and Endocrinology, Department of Endocrinology, Center for Pediatric and Adolescent Medicine, Karolinska Institutet, Stockholm, Sweden

Search for other papers by Sergiu Bogdan Catrina in
Google Scholar
PubMed Close

manufacturer's instructions (Invitrogen). Real-time PCR was carried out using gene specific primer pairs for Igfbp1 (forward, 5′-ATCAGCCCATCCTGTGGAAC-3′ and reverse 5′-TGCAGCTAATCTCTCTAGCACTT-3′), Vegf a (forward, 5′-TTATGCGGATCAAACCTCAC-3′ and reverse 5

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-14-0571
Volume/Issue:
Volume 225: Issue 3
Free access
Caitlin S Wyrwoll School of Human Sciences, University of Western Australia, Crawley, Western Australia, Australia
Telethon Kids Institute, Perth, Australia
Healthy Environments and Lives (HEAL) Network

Search for other papers by Caitlin S Wyrwoll in
Google Scholar
PubMed Close

expression of PlGF, VEGF and their receptors in a placental insufficiency model of fetal growth restriction . Journal of Physiology 550 641 – 656 . ( https://doi.org/10.1113/jphysiol.2003.039511 ) Regnault TRH Orbus RJ de Vrijer B Davidsen ML Galan HL

Article Type:
Review Article
Collections:
Rising Stars special collection
DOI:
https://doi.org/10.1530/JOE-23-0030
Volume/Issue:
Volume 259: Issue 1
Free access
Carla Tatone Department of Life, Health and Environmental Sciences, University of L’Aquila, L’Aquila, Italy

Search for other papers by Carla Tatone in
Google Scholar
PubMed Close
,
Giovanna Di Emidio Department of Life, Health and Environmental Sciences, University of L’Aquila, L’Aquila, Italy

Search for other papers by Giovanna Di Emidio in
Google Scholar
PubMed Close
,
Martina Placidi Department of Life, Health and Environmental Sciences, University of L’Aquila, L’Aquila, Italy

Search for other papers by Martina Placidi in
Google Scholar
PubMed Close
,
Giulia Rossi Department of Life, Health and Environmental Sciences, University of L’Aquila, L’Aquila, Italy

Search for other papers by Giulia Rossi in
Google Scholar
PubMed Close
,
Stefania Ruggieri Department of Obstetrics and Gynecology, Catholic University of the Sacred Heart, Fondazione Policlinico Agostino Gemelli IRCCS, Rome, Italy

Search for other papers by Stefania Ruggieri in
Google Scholar
PubMed Close
,
Chiara Taccaliti Department of Obstetrics and Gynecology, Catholic University of the Sacred Heart, Fondazione Policlinico Agostino Gemelli IRCCS, Rome, Italy

Search for other papers by Chiara Taccaliti in
Google Scholar
PubMed Close
,
Angela D’Alfonso Department of Life, Health and Environmental Sciences, University of L’Aquila, L’Aquila, Italy

Search for other papers by Angela D’Alfonso in
Google Scholar
PubMed Close
,
Fernanda Amicarelli Department of Life, Health and Environmental Sciences, University of L’Aquila, L’Aquila, Italy

Search for other papers by Fernanda Amicarelli in
Google Scholar
PubMed Close
, and
Maurizio Guido Department of Life, Health and Environmental Sciences, University of L’Aquila, L’Aquila, Italy

Search for other papers by Maurizio Guido in
Google Scholar
PubMed Close

using this model, it was demonstrated that VEGF, IL6/8, and PEDF mRNA correlated with hyperangiogenesis and chronic inflammation. Exposure to rPEDF reduced AGE-induced elevation of VEGF and IL6/8 ( Silber et al. 2020 ). In 2016, Wang et al. by

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JOE-21-0143
Volume/Issue:
Volume 251: Issue 2
Free access
Eduardo Esteban-Zubero Department of Pharmacology and Physiology, University of Zaragoza, Zaragoza, Spain

Search for other papers by Eduardo Esteban-Zubero in
Google Scholar
PubMed Close
,
Francisco Agustín García-Gil Department of Surgery, Gynaecology and Obstetrics, University of Zaragoza, Zaragoza, Spain

Search for other papers by Francisco Agustín García-Gil in
Google Scholar
PubMed Close
,
Laura López-Pingarrón Department of Medicine, Psychiatry and Dermatology, University of Zaragoza, Zaragoza, Spain

Search for other papers by Laura López-Pingarrón in
Google Scholar
PubMed Close
,
Moisés Alejandro Alatorre-Jiménez Department of Cellular and Structural Biology, University of Texas Health Science Center at San Antonio, San Antonio, Texas, USA

Search for other papers by Moisés Alejandro Alatorre-Jiménez in
Google Scholar
PubMed Close
,
Pablo Iñigo-Gil Department of Medicine, Psychiatry and Dermatology, University of Zaragoza, Zaragoza, Spain

Search for other papers by Pablo Iñigo-Gil in
Google Scholar
PubMed Close
,
Dun-Xian Tan Department of Cellular and Structural Biology, University of Texas Health Science Center at San Antonio, San Antonio, Texas, USA

Search for other papers by Dun-Xian Tan in
Google Scholar
PubMed Close
,
José Joaquín García Department of Pharmacology and Physiology, University of Zaragoza, Zaragoza, Spain

Search for other papers by José Joaquín García in
Google Scholar
PubMed Close
, and
Russel J Reiter Department of Cellular and Structural Biology, University of Texas Health Science Center at San Antonio, San Antonio, Texas, USA

Search for other papers by Russel J Reiter in
Google Scholar
PubMed Close

and tissue MDA levels than was oxytetracycline. The indoleamine (240mg/L orally) was also compared with hyaluronan (HA), vascular endothelial growth factor A (VEGF-A) (200ng/mL), and vitamin E (400IU/mL) in a human ovarian material study after its

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JOE-16-0117
Volume/Issue:
Volume 229: Issue 3
Free access
Tetsuhiro Kakimoto Safety Research Laboratory, Department I, Pharmacology Research Laboratories II, Research Division, Mitsubishi Tanabe Pharma Corporation, 2-2-50, Kawagishi, Toda-shi, Saitama 335-8505, Japan

Search for other papers by Tetsuhiro Kakimoto in
Google Scholar
PubMed Close
,
Hirotaka Kimata Safety Research Laboratory, Department I, Pharmacology Research Laboratories II, Research Division, Mitsubishi Tanabe Pharma Corporation, 2-2-50, Kawagishi, Toda-shi, Saitama 335-8505, Japan

Search for other papers by Hirotaka Kimata in
Google Scholar
PubMed Close
,
Satoshi Iwasaki Safety Research Laboratory, Department I, Pharmacology Research Laboratories II, Research Division, Mitsubishi Tanabe Pharma Corporation, 2-2-50, Kawagishi, Toda-shi, Saitama 335-8505, Japan

Search for other papers by Satoshi Iwasaki in
Google Scholar
PubMed Close
,
Atsushi Fukunari Safety Research Laboratory, Department I, Pharmacology Research Laboratories II, Research Division, Mitsubishi Tanabe Pharma Corporation, 2-2-50, Kawagishi, Toda-shi, Saitama 335-8505, Japan

Search for other papers by Atsushi Fukunari in
Google Scholar
PubMed Close
, and
Hiroyuki Utsumi Safety Research Laboratory, Department I, Pharmacology Research Laboratories II, Research Division, Mitsubishi Tanabe Pharma Corporation, 2-2-50, Kawagishi, Toda-shi, Saitama 335-8505, Japan

Search for other papers by Hiroyuki Utsumi in
Google Scholar
PubMed Close

Tanaka M Fukunari A 2011 Expression of vascular endothelial growth factor (VEGF) associated with histopathological changes in rodent models of osteoarthritis . Journal of Toxicologic Pathology 24 137 – 142 . ( doi:10.1293/tox.24.137 ) Yoon

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-12-0456
Volume/Issue:
Volume 216: Issue 1
Free access
Min Liu Institute of Cardiovascular Sciences and Key Laboratory of Molecular Cardiovascular Sciences, Peking University Health Science Center, Beijing, China

Search for other papers by Min Liu in
Google Scholar
PubMed Close
,
Shuo Xie Department of Geriatric Medicine, Peking University First Hospital, Beijing, China

Search for other papers by Shuo Xie in
Google Scholar
PubMed Close
,
Weiwei Liu Institute of Cardiovascular Sciences and Key Laboratory of Molecular Cardiovascular Sciences, Peking University Health Science Center, Beijing, China

Search for other papers by Weiwei Liu in
Google Scholar
PubMed Close
,
Jingjin Li Institute of Cardiovascular Sciences and Key Laboratory of Molecular Cardiovascular Sciences, Peking University Health Science Center, Beijing, China

Search for other papers by Jingjin Li in
Google Scholar
PubMed Close
,
Chao Li Institute of Cardiovascular Sciences and Key Laboratory of Molecular Cardiovascular Sciences, Peking University Health Science Center, Beijing, China

Search for other papers by Chao Li in
Google Scholar
PubMed Close
,
Wei Huang Institute of Cardiovascular Sciences and Key Laboratory of Molecular Cardiovascular Sciences, Peking University Health Science Center, Beijing, China

Search for other papers by Wei Huang in
Google Scholar
PubMed Close
,
Hexin Li Biological Sample Management Center, Beijing Hospital, Beijing, China

Search for other papers by Hexin Li in
Google Scholar
PubMed Close
,
Jinghai Song Department of Surgery, Beijing Hospital, Beijing, China

Search for other papers by Jinghai Song in
Google Scholar
PubMed Close
, and
Hong Zhang Institute of Cardiovascular Sciences and Key Laboratory of Molecular Cardiovascular Sciences, Peking University Health Science Center, Beijing, China

Search for other papers by Hong Zhang in
Google Scholar
PubMed Close

1 receptor genes, signaling through VEGFR2 and VEGF-A bioavailability can be activated, promoting lacteal junction zippering, inhibiting chylomicron uptake, and ultimately protecting against dietary obesity ( Feng et al . 2018 ). Our results showed

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-19-0029
Volume/Issue:
Volume 244: Issue 1
Restricted access