Search Results
Ashley Patton
Ashley Patton
Department of Specialty Medicine, Heritage College of Osteopathic Medicine, Ohio University, Athens, Ohio, USA
Diabetes Institute, Ohio University, Athens, Ohio, USA
Department of Biological Sciences, Ohio University, Athens, Ohio, USA
Molecular & Cellular Biology Program, College of Arts and Sciences, Ohio University, Athens, Ohio, USA
Search for other papers by Ashley Patton in
Google Scholar
PubMed
Diabetes Institute, Ohio University, Athens, Ohio, USA
Department of Biological Sciences, Ohio University, Athens, Ohio, USA
Molecular & Cellular Biology Program, College of Arts and Sciences, Ohio University, Athens, Ohio, USA
Search for other papers by Ashley Patton in
Google Scholar
PubMed
Tyler Church
Tyler Church
Department of Specialty Medicine, Heritage College of Osteopathic Medicine, Ohio University, Athens, Ohio, USA
Diabetes Institute, Ohio University, Athens, Ohio, USA
Search for other papers by Tyler Church in
Google Scholar
PubMed
Diabetes Institute, Ohio University, Athens, Ohio, USA
Search for other papers by Tyler Church in
Google Scholar
PubMed
Caroline Wilson
Caroline Wilson
Department of Chemical and Biomolecular Engineering, Russ College of Engineering and Technology, Ohio University, Athens, Ohio, USA
Search for other papers by Caroline Wilson in
Google Scholar
PubMed
Search for other papers by Caroline Wilson in
Google Scholar
PubMed
Jean Thuma
Jean Thuma
Department of Specialty Medicine, Heritage College of Osteopathic Medicine, Ohio University, Athens, Ohio, USA
Diabetes Institute, Ohio University, Athens, Ohio, USA
Search for other papers by Jean Thuma in
Google Scholar
PubMed
Diabetes Institute, Ohio University, Athens, Ohio, USA
Search for other papers by Jean Thuma in
Google Scholar
PubMed
Douglas J Goetz
Douglas J Goetz
Department of Chemical and Biomolecular Engineering, Russ College of Engineering and Technology, Ohio University, Athens, Ohio, USA
Molecular & Cellular Biology Program, College of Arts and Sciences, Ohio University, Athens, Ohio, USA
Biomedical Engineering Program, Ohio University, Athens, Ohio, USA
Search for other papers by Douglas J Goetz in
Google Scholar
PubMed
Molecular & Cellular Biology Program, College of Arts and Sciences, Ohio University, Athens, Ohio, USA
Biomedical Engineering Program, Ohio University, Athens, Ohio, USA
Search for other papers by Douglas J Goetz in
Google Scholar
PubMed
Darlene E Berryman
Darlene E Berryman
Diabetes Institute, Ohio University, Athens, Ohio, USA
Department of Biomedical Sciences, Ohio University, Athens, Ohio, USA
The Edison Biotechnology Institute, Ohio University, Athens, Ohio, USA
Search for other papers by Darlene E Berryman in
Google Scholar
PubMed
Department of Biomedical Sciences, Ohio University, Athens, Ohio, USA
The Edison Biotechnology Institute, Ohio University, Athens, Ohio, USA
Search for other papers by Darlene E Berryman in
Google Scholar
PubMed
Edward O List
Edward O List
Department of Specialty Medicine, Heritage College of Osteopathic Medicine, Ohio University, Athens, Ohio, USA
Diabetes Institute, Ohio University, Athens, Ohio, USA
The Edison Biotechnology Institute, Ohio University, Athens, Ohio, USA
Search for other papers by Edward O List in
Google Scholar
PubMed
Diabetes Institute, Ohio University, Athens, Ohio, USA
The Edison Biotechnology Institute, Ohio University, Athens, Ohio, USA
Search for other papers by Edward O List in
Google Scholar
PubMed
Frank Schwartz
Frank Schwartz
Department of Specialty Medicine, Heritage College of Osteopathic Medicine, Ohio University, Athens, Ohio, USA
Diabetes Institute, Ohio University, Athens, Ohio, USA
Search for other papers by Frank Schwartz in
Google Scholar
PubMed
Diabetes Institute, Ohio University, Athens, Ohio, USA
Search for other papers by Frank Schwartz in
Google Scholar
PubMed
Kelly D McCall
Kelly D McCall
Department of Specialty Medicine, Heritage College of Osteopathic Medicine, Ohio University, Athens, Ohio, USA
Diabetes Institute, Ohio University, Athens, Ohio, USA
Department of Biological Sciences, Ohio University, Athens, Ohio, USA
Molecular & Cellular Biology Program, College of Arts and Sciences, Ohio University, Athens, Ohio, USA
Biomedical Engineering Program, Ohio University, Athens, Ohio, USA
Department of Biomedical Sciences, Ohio University, Athens, Ohio, USA
Search for other papers by Kelly D McCall in
Google Scholar
PubMed
Diabetes Institute, Ohio University, Athens, Ohio, USA
Department of Biological Sciences, Ohio University, Athens, Ohio, USA
Molecular & Cellular Biology Program, College of Arts and Sciences, Ohio University, Athens, Ohio, USA
Biomedical Engineering Program, Ohio University, Athens, Ohio, USA
Department of Biomedical Sciences, Ohio University, Athens, Ohio, USA
Search for other papers by Kelly D McCall in
Google Scholar
PubMed
to the inflammation present in NAFLD ( Lu et al . 2008 , Broering et al . 2011 ). TLR4 signaling is mediated via two intracellular pathways involving the myeloid differentiation primary response 88 (MyD88) or adaptor proteins translocation
M Giakoumopoulos
M Giakoumopoulos
Wisconsin National Primate Research Center, Obstetrics and Gynecology and, Comparative Biosciences, University of Wisconsin–Madison, 1223 Capitol Court, Madison, Wisconsin 53715-1299, USA
Wisconsin National Primate Research Center, Obstetrics and Gynecology and, Comparative Biosciences, University of Wisconsin–Madison, 1223 Capitol Court, Madison, Wisconsin 53715-1299, USA
Search for other papers by M Giakoumopoulos in
Google Scholar
PubMed
Wisconsin National Primate Research Center, Obstetrics and Gynecology and, Comparative Biosciences, University of Wisconsin–Madison, 1223 Capitol Court, Madison, Wisconsin 53715-1299, USA
Search for other papers by M Giakoumopoulos in
Google Scholar
PubMed
T G Golos
T G Golos
Wisconsin National Primate Research Center, Obstetrics and Gynecology and, Comparative Biosciences, University of Wisconsin–Madison, 1223 Capitol Court, Madison, Wisconsin 53715-1299, USA
Wisconsin National Primate Research Center, Obstetrics and Gynecology and, Comparative Biosciences, University of Wisconsin–Madison, 1223 Capitol Court, Madison, Wisconsin 53715-1299, USA
Wisconsin National Primate Research Center, Obstetrics and Gynecology and, Comparative Biosciences, University of Wisconsin–Madison, 1223 Capitol Court, Madison, Wisconsin 53715-1299, USA
Search for other papers by T G Golos in
Google Scholar
PubMed
Wisconsin National Primate Research Center, Obstetrics and Gynecology and, Comparative Biosciences, University of Wisconsin–Madison, 1223 Capitol Court, Madison, Wisconsin 53715-1299, USA
Wisconsin National Primate Research Center, Obstetrics and Gynecology and, Comparative Biosciences, University of Wisconsin–Madison, 1223 Capitol Court, Madison, Wisconsin 53715-1299, USA
Search for other papers by T G Golos in
Google Scholar
PubMed
cells can be derived from mouse embryos ( Silva & Smith 2008 , Ying et al . 2008 , Nichols & Smith 2009 ). Conversely, hESC require FGF2/ERK to self-renew and can be induced to differentiate by the canonical WNT/β-catenin signaling pathway ( Sumi et
Jie Liu
Jie Liu
College of Veterinary Medicine, South China Agricultural University, Guangzhou, China
Department of Biology, Shantou University, Shantou, China
Search for other papers by Jie Liu in
Google Scholar
PubMed
Department of Biology, Shantou University, Shantou, China
Search for other papers by Jie Liu in
Google Scholar
PubMed
Fei Gao
Fei Gao
Department of Biology, Shantou University, Shantou, China
Search for other papers by Fei Gao in
Google Scholar
PubMed
Search for other papers by Fei Gao in
Google Scholar
PubMed
Yue-Fang Liu
Yue-Fang Liu
College of Veterinary Medicine, South China Agricultural University, Guangzhou, China
Search for other papers by Yue-Fang Liu in
Google Scholar
PubMed
Search for other papers by Yue-Fang Liu in
Google Scholar
PubMed
Hai-Ting Dou
Hai-Ting Dou
College of Veterinary Medicine, South China Agricultural University, Guangzhou, China
Search for other papers by Hai-Ting Dou in
Google Scholar
PubMed
Search for other papers by Hai-Ting Dou in
Google Scholar
PubMed
Jia-Qi Yan
Jia-Qi Yan
College of Veterinary Medicine, South China Agricultural University, Guangzhou, China
Search for other papers by Jia-Qi Yan in
Google Scholar
PubMed
Search for other papers by Jia-Qi Yan in
Google Scholar
PubMed
Zong-Min Fan
Zong-Min Fan
College of Veterinary Medicine, South China Agricultural University, Guangzhou, China
Search for other papers by Zong-Min Fan in
Google Scholar
PubMed
Search for other papers by Zong-Min Fan in
Google Scholar
PubMed
Zeng-Ming Yang
Zeng-Ming Yang
College of Veterinary Medicine, South China Agricultural University, Guangzhou, China
Search for other papers by Zeng-Ming Yang in
Google Scholar
PubMed
Search for other papers by Zeng-Ming Yang in
Google Scholar
PubMed
, we showed that Prss56 expression during decidualization is regulated by HB-EGF/EGFR/ERK/Egr2 signaling pathway. Materials and methods Animals and treatment Mature CD1 mice used in this study were obtained from Hunan Slack Laboratory Animal
Diego Crespo
Diego Crespo
Reproductive Biology Group, Division Developmental Biology, Department Biology, Science Faculty, Utrecht University, Utrecht, The Netherlands
Search for other papers by Diego Crespo in
Google Scholar
PubMed
Search for other papers by Diego Crespo in
Google Scholar
PubMed
Moline Severino Lemos
Moline Severino Lemos
Laboratory of Cell Biology, Department of Morphology, Institute of Biological Sciences, Federal University of Minas Gerais, Belo Horizonte, Minas Gerais, Brazil
Search for other papers by Moline Severino Lemos in
Google Scholar
PubMed
Search for other papers by Moline Severino Lemos in
Google Scholar
PubMed
Yu Ting Zhang
Yu Ting Zhang
State Key Laboratory of Marine Environmental Science, College of Ocean and Earth Sciences, Xiamen University, Fujian, People’s Republic of China
Institute of Oceanography, Minjiang University, Fuzhou, People’s Republic of China
Search for other papers by Yu Ting Zhang in
Google Scholar
PubMed
Institute of Oceanography, Minjiang University, Fuzhou, People’s Republic of China
Search for other papers by Yu Ting Zhang in
Google Scholar
PubMed
Diego Safian
Diego Safian
Reproductive Biology Group, Division Developmental Biology, Department Biology, Science Faculty, Utrecht University, Utrecht, The Netherlands
Search for other papers by Diego Safian in
Google Scholar
PubMed
Search for other papers by Diego Safian in
Google Scholar
PubMed
Birgitta Norberg
Birgitta Norberg
Institute of Marine Research, Austevoll Research Station, Storebø, Norway
Search for other papers by Birgitta Norberg in
Google Scholar
PubMed
Search for other papers by Birgitta Norberg in
Google Scholar
PubMed
Jan Bogerd
Jan Bogerd
Reproductive Biology Group, Division Developmental Biology, Department Biology, Science Faculty, Utrecht University, Utrecht, The Netherlands
Search for other papers by Jan Bogerd in
Google Scholar
PubMed
Search for other papers by Jan Bogerd in
Google Scholar
PubMed
Rüdiger W Schulz
Rüdiger W Schulz
Reproductive Biology Group, Division Developmental Biology, Department Biology, Science Faculty, Utrecht University, Utrecht, The Netherlands
Research Group Reproduction and Developmental Biology, Institute of Marine Research, Bergen, Norway
Search for other papers by Rüdiger W Schulz in
Google Scholar
PubMed
Research Group Reproduction and Developmental Biology, Institute of Marine Research, Bergen, Norway
Search for other papers by Rüdiger W Schulz in
Google Scholar
PubMed
regulatory protein CCTGGAATGCCTGAGCAGAA ATCTGCACTTGGTCGCATGAC ubc ubiquitin C CCATACACCGCACTCTTACAGAAA CCAGTCAGCGTCTTCACAAAGAT wnt5a wingless-type MMTV integration site family, member 5a TGGAGATCGTGGACGCAAA CACTTCAGGAATCAGCAGAGGATT
Manuel D Gahete
Manuel D Gahete
Maimonides Institute for Biomedical Research of Cordoba (IMIBIC), Córdoba, Spain
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Manuel D Gahete in
Google Scholar
PubMed
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Manuel D Gahete in
Google Scholar
PubMed
Juan M Jiménez-Vacas
Juan M Jiménez-Vacas
Maimonides Institute for Biomedical Research of Cordoba (IMIBIC), Córdoba, Spain
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Juan M Jiménez-Vacas in
Google Scholar
PubMed
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Juan M Jiménez-Vacas in
Google Scholar
PubMed
Emilia Alors-Pérez
Emilia Alors-Pérez
Maimonides Institute for Biomedical Research of Cordoba (IMIBIC), Córdoba, Spain
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Emilia Alors-Pérez in
Google Scholar
PubMed
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Emilia Alors-Pérez in
Google Scholar
PubMed
Vicente Herrero-Aguayo
Vicente Herrero-Aguayo
Maimonides Institute for Biomedical Research of Cordoba (IMIBIC), Córdoba, Spain
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Vicente Herrero-Aguayo in
Google Scholar
PubMed
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Vicente Herrero-Aguayo in
Google Scholar
PubMed
Antonio C Fuentes-Fayos
Antonio C Fuentes-Fayos
Maimonides Institute for Biomedical Research of Cordoba (IMIBIC), Córdoba, Spain
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Antonio C Fuentes-Fayos in
Google Scholar
PubMed
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Antonio C Fuentes-Fayos in
Google Scholar
PubMed
Sergio Pedraza-Arévalo
Sergio Pedraza-Arévalo
Maimonides Institute for Biomedical Research of Cordoba (IMIBIC), Córdoba, Spain
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Sergio Pedraza-Arévalo in
Google Scholar
PubMed
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Sergio Pedraza-Arévalo in
Google Scholar
PubMed
Justo P Castaño
Justo P Castaño
Maimonides Institute for Biomedical Research of Cordoba (IMIBIC), Córdoba, Spain
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Justo P Castaño in
Google Scholar
PubMed
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Justo P Castaño in
Google Scholar
PubMed
Raúl M Luque
Raúl M Luque
Maimonides Institute for Biomedical Research of Cordoba (IMIBIC), Córdoba, Spain
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Raúl M Luque in
Google Scholar
PubMed
Department of Cell Biology, Physiology, and Immunology, Universidad de Córdoba, Córdoba, Spain
Reina Sofia University Hospital, Córdoba, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain
Agrifood Campus of International Excellence (ceiA3), Córdoba, Spain
Search for other papers by Raúl M Luque in
Google Scholar
PubMed
the development of ACTs, particularly in childhood ACTs, as 90% of cases display gains of 9q, which is the chromosomal region containing NR5A1 gene ( Figueiredo et al. 2005 ) The modulation of the classical WNT/β-catenin or associated pathways
Yan Wang
Yan Wang
Department of Endocrinology, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Yan Wang in
Google Scholar
PubMed
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Yan Wang in
Google Scholar
PubMed
Mengqi Zhang
Mengqi Zhang
Department of Endocrinology, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Mengqi Zhang in
Google Scholar
PubMed
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Mengqi Zhang in
Google Scholar
PubMed
Zhikun Huan
Zhikun Huan
Department of Endocrinology, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Zhikun Huan in
Google Scholar
PubMed
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Zhikun Huan in
Google Scholar
PubMed
Shanshan Shao
Shanshan Shao
Department of Endocrinology, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Shanshan Shao in
Google Scholar
PubMed
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Shanshan Shao in
Google Scholar
PubMed
Xiujuan Zhang
Xiujuan Zhang
Department of Endocrinology, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Xiujuan Zhang in
Google Scholar
PubMed
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Xiujuan Zhang in
Google Scholar
PubMed
Dehuan Kong
Dehuan Kong
Department of Endocrinology, Taian City Central Hospital, Taian, Shandong Province, China
Search for other papers by Dehuan Kong in
Google Scholar
PubMed
Search for other papers by Dehuan Kong in
Google Scholar
PubMed
Jin Xu
Jin Xu
Department of Endocrinology, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Jin Xu in
Google Scholar
PubMed
Shandong Provincial Key Laboratory of Endocrinology and Lipid Metabolism, Jinan, Shandong Province, China
Cheeloo College of Medicine, Shandong University, Jinan, Shandong Province, China
Department of Endocrinology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong Province, China
Search for other papers by Jin Xu in
Google Scholar
PubMed
pathways, we measured the levels of the second messenger cyclic AMP (cAMP) by using an ELISA kit after FSH treatment. Forskolin is known to increase cAMP levels, so we used it as a positive control. The results showed that FSH inhibits cAMP production in
Gina L C Yosten
Gina L C Yosten
Search for other papers by Gina L C Yosten in
Google Scholar
PubMed
Search for other papers by Gina L C Yosten in
Google Scholar
PubMed
Grant R Kolar
Grant R Kolar
Department of Pharmacological and Physiological Science, Department of Pathology and Immunology, Saint Louis University School of Medicine, 1402 S Grand Boulevard, Saint Louis, Missouri 63104, USA
Search for other papers by Grant R Kolar in
Google Scholar
PubMed
Search for other papers by Grant R Kolar in
Google Scholar
PubMed
Lauren J Redlinger
Lauren J Redlinger
Search for other papers by Lauren J Redlinger in
Google Scholar
PubMed
Search for other papers by Lauren J Redlinger in
Google Scholar
PubMed
Willis K Samson
Willis K Samson
Search for other papers by Willis K Samson in
Google Scholar
PubMed
Search for other papers by Willis K Samson in
Google Scholar
PubMed
. ( doi:10.1016/S0092-8674(01)00483-4 ) Glinka A Dolde C Kirsch N Huang YL Kazanskaya O Ingelfinger D Boutros M Cruciat CM Niehrs C 2011 LGR4 and LGR5 are R-spondin receptors mediating Wnt/β-catenin and Wnt/PCP signaling . EMBO
Cátia F Gonçalves
Cátia F Gonçalves
Wellcome Centre for Cell Matrix Research, Division of Cell Matrix Biology and Regenerative Medicine, School of Biological Sciences, Faculty of Biology, Medicine & Health, Manchester Academic Health Science Centre, University of Manchester, Manchester, UK
Search for other papers by Cátia F Gonçalves in
Google Scholar
PubMed
Search for other papers by Cátia F Gonçalves in
Google Scholar
PubMed
Qing-Jun Meng
Qing-Jun Meng
Wellcome Centre for Cell Matrix Research, Division of Cell Matrix Biology and Regenerative Medicine, School of Biological Sciences, Faculty of Biology, Medicine & Health, Manchester Academic Health Science Centre, University of Manchester, Manchester, UK
Search for other papers by Qing-Jun Meng in
Google Scholar
PubMed
Search for other papers by Qing-Jun Meng in
Google Scholar
PubMed
differentiation of bone stromal cells into adipocytes and supressed osteogenic signalling pathways such as BMP, TGF-β and WNT, as well as osteoblast-specific transcription factors (e.g. Runx2 , Sox9 , and Sp7 ) ( Shockley et al. 2009 ). In vivo silencing of
Anna de Lloyd
Anna de Lloyd
Department of Child Health, Centre for Endocrine and Diabetes Sciences
Search for other papers by Anna de Lloyd in
Google Scholar
PubMed
Search for other papers by Anna de Lloyd in
Google Scholar
PubMed
James Bursell
James Bursell
Department of Child Health, Centre for Endocrine and Diabetes Sciences
Search for other papers by James Bursell in
Google Scholar
PubMed
Search for other papers by James Bursell in
Google Scholar
PubMed
John W Gregory
John W Gregory
Department of Child Health, Centre for Endocrine and Diabetes Sciences
Search for other papers by John W Gregory in
Google Scholar
PubMed
Search for other papers by John W Gregory in
Google Scholar
PubMed
D Aled Rees
D Aled Rees
Department of Child Health, Centre for Endocrine and Diabetes Sciences
Search for other papers by D Aled Rees in
Google Scholar
PubMed
Search for other papers by D Aled Rees in
Google Scholar
PubMed
Marian Ludgate
Marian Ludgate
Department of Child Health, Centre for Endocrine and Diabetes Sciences
Search for other papers by Marian Ludgate in
Google Scholar
PubMed
Search for other papers by Marian Ludgate in
Google Scholar
PubMed
of the TSHR leads to over activation of the cAMP pathway that in turn causes thyroid hyperplasia and hyperthyroidism. This process occurs in Graves' disease (GD), the commonest cause of hyperthyroidism in which thyroid stimulating antibodies (TSAB
Gen Chen
Gen Chen
School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, China
Search for other papers by Gen Chen in
Google Scholar
PubMed
Search for other papers by Gen Chen in
Google Scholar
PubMed
Xiangjuan Chen
Xiangjuan Chen
Department of Obstetrics and Gynecology, the First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China
Search for other papers by Xiangjuan Chen in
Google Scholar
PubMed
Search for other papers by Xiangjuan Chen in
Google Scholar
PubMed
Chao Niu
Chao Niu
The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, China
Search for other papers by Chao Niu in
Google Scholar
PubMed
Search for other papers by Chao Niu in
Google Scholar
PubMed
Xiaozhong Huang
Xiaozhong Huang
The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, China
Search for other papers by Xiaozhong Huang in
Google Scholar
PubMed
Search for other papers by Xiaozhong Huang in
Google Scholar
PubMed
Ning An
Ning An
School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, China
Search for other papers by Ning An in
Google Scholar
PubMed
Search for other papers by Ning An in
Google Scholar
PubMed
Jia Sun
Jia Sun
School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, China
Search for other papers by Jia Sun in
Google Scholar
PubMed
Search for other papers by Jia Sun in
Google Scholar
PubMed
Shuai Huang
Shuai Huang
School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, China
Search for other papers by Shuai Huang in
Google Scholar
PubMed
Search for other papers by Shuai Huang in
Google Scholar
PubMed
Weijian Ye
Weijian Ye
The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, China
Search for other papers by Weijian Ye in
Google Scholar
PubMed
Search for other papers by Weijian Ye in
Google Scholar
PubMed
Santie Li
Santie Li
School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, China
Search for other papers by Santie Li in
Google Scholar
PubMed
Search for other papers by Santie Li in
Google Scholar
PubMed
Yingjie Shen
Yingjie Shen
School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, China
Search for other papers by Yingjie Shen in
Google Scholar
PubMed
Search for other papers by Yingjie Shen in
Google Scholar
PubMed
Jiaojiao Liang
Jiaojiao Liang
School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, China
Search for other papers by Jiaojiao Liang in
Google Scholar
PubMed
Search for other papers by Jiaojiao Liang in
Google Scholar
PubMed
Weitao Cong
Weitao Cong
School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, China
Search for other papers by Weitao Cong in
Google Scholar
PubMed
Search for other papers by Weitao Cong in
Google Scholar
PubMed
Litai Jin
Litai Jin
School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, China
Search for other papers by Litai Jin in
Google Scholar
PubMed
Search for other papers by Litai Jin in
Google Scholar
PubMed
-activated receptor gamma and the canonical WNT/β-Catenin pathway in chronic inflammation and oxidative stress during carcinogenesis . Frontiers in Immunology 9 745 . ( https://doi.org/10.3389/fimmu.2018.00745 ) 10.3389/fimmu.2018.00745 29706964 Waisundara VY
