Search Results
Search for other papers by Bohan Wang in
Google Scholar
PubMed
Search for other papers by I Stuart Wood in
Google Scholar
PubMed
Search for other papers by Paul Trayhurn in
Google Scholar
PubMed
factor (VEGF), while the non-adipokines include the GLUT-1 and GLUT-3 facilitative glucose transporters ( Lolmède et al . 2003 , Hosogai et al . 2007 , Wang et al . 2007 , Wood et al . 2007 , Ye et al . 2007 ). By contrast, adiponectin and
Search for other papers by Dang-Dang Li in
Google Scholar
PubMed
Search for other papers by Ying-Jie Gao in
Google Scholar
PubMed
Search for other papers by Xue-Chao Tian in
Google Scholar
PubMed
Search for other papers by Zhan-Qing Yang in
Google Scholar
PubMed
Search for other papers by Hang Cao in
Google Scholar
PubMed
Search for other papers by Qiao-Ling Zhang in
Google Scholar
PubMed
Search for other papers by Bin Guo in
Google Scholar
PubMed
Search for other papers by Zhan-Peng Yue in
Google Scholar
PubMed
_010088 119 TGATCCATGCACCCATAAAA Aryl hydrocarbon receptor ( Ahr ) CCGAAGCACACGCAAATCAA NM_013464 244 CCCTTCCAGGGAAGTCCAAC Cyclooxygenase 2 ( Cox2 ) CATCCCCTTCCTGCGAAGTT NM_011198 178 CATGGGAGTTGGGCAGTCAT Vascular endothelial growth factor ( Vegf
Search for other papers by J Gloddek in
Google Scholar
PubMed
Search for other papers by U Pagotto in
Google Scholar
PubMed
Search for other papers by M Paez Pereda in
Google Scholar
PubMed
Search for other papers by E Arzt in
Google Scholar
PubMed
Search for other papers by GK Stalla in
Google Scholar
PubMed
Search for other papers by U Renner in
Google Scholar
PubMed
There is increasing evidence that hormones play an important role in the control of endothelial cell function and growth by regulating the production of vascular endothelial growth factor (VEGF). VEGF regulates vascular permeability and represents the most powerful growth factor for endothelial cells. In the normal anterior pituitary, VEGF has been detected only in folliculostellate (FS) cells. In the present study, the regulation of the release of VEGF from FS-like mouse TtT/GF cells, and from FS cells of rat pituitary monolayer cell cultures was investigated using a specific VEGF ELISA. Basal release of VEGF was demonstrated in cultures of both TtT/GF cells and rat pituitary cells. Interestingly, the VEGF secretion was stimulated by both forms of pituitary adenylate cyclase-activating polypeptide (PACAP-38 and PACAP-27), indicating that this hypothalamic peptide regulates endothelial cell function and growth within the pituitary. VEGF secretion was also stimulated by interleukin-6 (IL-6) whereas basal, IL-6- and PACAP-stimulated secretion was inhibited by the synthetic glucocorticoid dexamethasone. The inhibitory action of dexamethasone was reversed by the glucocorticoid receptor antagonist RU486, suggesting that in FS cells functional glucocorticoid receptors mediate the inhibitory action of glucocorticoids on the VEGF secretion. The endocrine and auto-/paracrine control of VEGF production in pituitary FS cells by PACAP, IL-6 and glucocorticoids may play an important role both in angiogenesis and vascular permeability regulation within the pituitary under physiological and pathophysiological conditions.
Search for other papers by Y Taniguchi in
Google Scholar
PubMed
Search for other papers by I Morita in
Google Scholar
PubMed
Search for other papers by T Kubota in
Google Scholar
PubMed
Search for other papers by S Murota in
Google Scholar
PubMed
Search for other papers by T Aso in
Google Scholar
PubMed
It has been recognized that tissue-specific growth factors and angiogenic factors play important roles in the growth of tumors and in the tissue-repair system. In uterine myometrial smooth muscle cells, it has also been reported that the platelet-derived growth factor (PDGF) binds to PDGF receptors and stimulates proliferation. In this paper, we examine whether or not PDGF is able to stimulate production of vascular endothelial growth factor (VEGF) in cultured human myometrial smooth muscle cells. PDGF treatment enhanced immunoreactive VEGF production as well as cell proliferation. Production of VEGF121 and VEGF165 in the cells was detected by reverse transcription-polymerase chain reaction analysis, but the PDGF treatment did not change the ratio of VEGF165 to VEGF121. The effect of PDGF on cell proliferation leveled off at 10 ng/ml, whereas its effect on VEGF production continued to increase linearly at concentrations above 10 ng/ml. Upon treatment of the cells with antibody against VEGF, the cell proliferation increased linearly even at PDGF concentrations above 10 ng/ml. The enhanced [3H]thymidine incorporation by PDGF was abolished by either mitogen-activated protein kinase kinase (MAPKK) inhibitor or protein kinase C (PKC) inhibitor. In contrast, VEGF production was abolished by MAPKK inhibitor, but not by PKC inhibitor. These results indicate that PDGF stimulates both cell proliferation and VEGF production in partly different signal pathways, and thus PDGF might play a role in the physiology and pathology of the myometrium.
Search for other papers by AL Ochoa in
Google Scholar
PubMed
Search for other papers by NA Mitchner in
Google Scholar
PubMed
Search for other papers by CD Paynter in
Google Scholar
PubMed
Search for other papers by RE Morris in
Google Scholar
PubMed
Search for other papers by N Ben-Jonathan in
Google Scholar
PubMed
Vascular endothelial growth factor (VEGF), an endothelial cell mitogen and permeability factor, participates in tumor angiogenesis, but less is known about its regulation or function in normal vascular homeostasis. In the uterus, which undergoes cyclic changes in its vasculature, VEGF is induced by estrogen. Since the pituitary gland contains highly permeable capillaries and is estrogen-responsive, our objectives were to localize VEGF expression within the pituitary and to determine whether it is regulated by estrogen in both the pituitary and the somatolactotrope cell line, GH(3). Ovariectomized rats were injected with estradiol, and pituitaries and uteri were subjected to in situ hybridization or quantitative reverse transcription-polymerase chain reaction (RT-PCR). VEGF expression was strong and punctate in the neural lobe, weaker and diffuse in the anterior lobe and undetectable in the intermediate lobe. Two VEGF isoforms, 164 and 120, were detected in all tissues. In the posterior pituitary, VEGF expression was 3- to 6-fold higher than in the anterior pituitary or uterus and was unaltered by estrogen. In contrast, anterior pituitary VEGF was induced by estrogen within 1 h, peaked at 3 h, and returned to basal levels by 24 h. Similar dynamics, albeit 10-fold higher, were seen in the uterus. Translated VEGF proteins were detected by Western blot in both the anterior pituitary and uterus. GH(3) cells also showed a dose- and time-dependent induction of VEGF expression by estrogen. In conclusion: (1) VEGF expression is higher in the neural lobe than in the anterior lobe and is undetectable in the intermediate lobe, (2) the expression of VEGF164 and VEGF120 is rapidly upregulated by estrogen in the anterior pituitary but is unchanged in the posterior pituitary, and (3) the pituitary lactotrope cell line, GH(3), also increases VEGF expression in response to estradiol.
Search for other papers by M Klein in
Google Scholar
PubMed
Search for other papers by E Picard in
Google Scholar
PubMed
Search for other papers by JM Vignaud in
Google Scholar
PubMed
Search for other papers by B Marie in
Google Scholar
PubMed
Search for other papers by L Bresler in
Google Scholar
PubMed
Search for other papers by B Toussaint in
Google Scholar
PubMed
Search for other papers by G Weryha in
Google Scholar
PubMed
Search for other papers by A Duprez in
Google Scholar
PubMed
Search for other papers by J Leclere in
Google Scholar
PubMed
Angiogenesis is implicated in several pathological conditions, such as inflammation and tumor growth. Vascular endothelial growth factor (VEGF), also known as vascular permeability factor, is a potent stimulator of endothelial cell proliferation in vitro and in vivo. The present work aimed to compare VEGF expression in human normal thyroid glands, thyroiditis tissue and thyroid carcinomas using immunohistochemistry and in situ hybridization (ISH). Both chronic lymphocytic thyroiditis and differentiated thyroid carcinomas were found to strongly express VEGF mRNA and encode larger amounts of VEGF than normal thyroid tissue as attested by a VEGF immunostaining score. In addition, tumor samples from patients with metastases showed a higher immunostaining score than their non-metastatic counterparts (P<0.05). Carcinomas with the greatest contents of VEGF mRNA and VEGF protein had the most intense mitogenic activity. Special focus on endothelial cells showed intense mitogenic activity in neoplastic tissues in contrast to the total quiescence of endothelial cells in non-tumoral tissues. An intense VEGF production by differentiated thyroid carcinoma, attested either by a higher immunostaining score or a strong VEGF mRNA expression using ISH, could be a promising marker of tumor aggressiveness and may also be useful as a predictor of metastatic potential.
Search for other papers by JF Wang in
Google Scholar
PubMed
Search for other papers by V Milosveski in
Google Scholar
PubMed
Search for other papers by C Schramek in
Google Scholar
PubMed
Search for other papers by GH Fong in
Google Scholar
PubMed
Search for other papers by GP Becks in
Google Scholar
PubMed
Search for other papers by DJ Hill in
Google Scholar
PubMed
Angiogenesis is an important component in the development of thyroid goitre. Vascular endothelial growth factor (VEGF) represents a family of specific endothelial cell mitogens involved in normal angiogenesis and in tumour development. The purpose of this study was to determine the distribution of VEGF in thyroid tissues during goitre formation, and to study the actions of VEGF on the regulation of thymidine incorporation and iodine uptake by thyroid follicular cells. Goitre was induced in adult rats by administration of methimazole together with a low iodine diet. Thyroid from normal or goitrous rats was removed, fixed and sectioned. Immunocytochemistry performed for VEGF using the avidin-biotin system showed that VEGF is present in normal thyroid and is located mainly in the vascular endothelium and interfollicular stromal tissue. After administration of goitrogen for 2 weeks, which caused a two- to threefold increase in thyroid weight, staining of VEGF was less apparent within the interfollicular stroma, but strongly increased throughout the thyroid follicular and endothelial cells. Uptake of [125I] and incorporation of [3H]thymidine by Fisher rat thyroid cells (FRTL-5) were measured after 72 h culture with or without TSH or VEGF, or both. In the absence of TSH, incubation with VEGF caused a significant reduction in [3H]thymidine incorporation, but did not significantly alter [125I] uptake. Incubation with TSH (1 mU/ml) caused a fourfold increase in [3H]thymidine incorporation that was diminished by co-incubation with 10 ng/ml or greater VEGF. Similarly, 10 ng/ml or greater VEGF significantly reduced the ability of TSH to increase [125I] uptake. The antagonistic effects of VEGF on TSH-stimulated [3H]thymidine incorporation or [125I] uptake were significantly reduced in the presence of an anti-VEGF antiserum. A DNA fragment representing mRNA encoding the VEGF receptor, flt-1, was identified in FRTL-5 cells by reverse transcription PCR analysis, and the abundance of this fragment was increased in FRTL-5 cells cultured in the medium containing TSH (1 mU/ml) or fibroblast growth factor (FGF)-2 (25 ng/ml). These results indicated that VEGF and one of its receptors, Flt-1, are present in epithelial cells of the thyroid, and that VEGF could contribute to the regulation of development and function of thyroid epithelial cells.
Search for other papers by SE Dickson in
Google Scholar
PubMed
Search for other papers by R Bicknell in
Google Scholar
PubMed
Search for other papers by HM Fraser in
Google Scholar
PubMed
Vascular endothelial growth factor (VEGF) is essential for the angiogenesis required for the formation of the corpus luteum; however, its role in ongoing luteal angiogenesis and in the maintenance of the established vascular network is unknown. The aim of this study was to determine whether VEGF inhibition could intervene in ongoing luteal angiogenesis using immunoneutralisation of VEGF starting in the mid-luteal phase. In addition, the effects on endothelial cell survival and the recruitment of periendothelial support cells were examined. Treatment with a monoclonal antibody to VEGF, or mouse gamma globulin for control animals, commenced on day 7 after ovulation and continued for 3 days. Bromodeoxyuridine (BrdU), used to label proliferating cells to obtain a proliferation index, was administered one hour before collecting ovaries from control and treated animals. Ovarian sections were stained using antibodies to BrdU, the endothelial cell marker, CD31, the pericyte marker, alpha-smooth muscle actin, and 3' end DNA fragments as a marker for apoptosis. VEGF immunoneutralisation significantly suppressed endothelial cell proliferation and the area occupied by endothelial cells while increasing pericyte coverage and the incidence of endothelial cell apoptosis. Luteal function was markedly compromised by anti-VEGF treatment as judged by a 50% reduction in plasma progesterone concentration. It is concluded that ongoing angiogenesis in the mid-luteal phase is primarily driven by VEGF, and that a proportion of endothelial cells of the mid-luteal phase vasculature are dependent on VEGF support.
Search for other papers by NH Kim in
Google Scholar
PubMed
Search for other papers by HH Jung in
Google Scholar
PubMed
Search for other papers by DR Cha in
Google Scholar
PubMed
Search for other papers by DS Choi in
Google Scholar
PubMed
Diabetic nephropathy associated with hyperglycemia is characterized by glomerular hyperfiltration and endothelial dysfunction. Vascular endothelial growth factor (VEGF) is known to be primarily involved in neoangiogenesis and increased endothelial permeability. The purpose of this study was to investigate VEGF expression in response to high glucose in rat cultured mesangial cells and to identify its signal pathway via protein kinase C (PKC). Rat mesangial cells were cultured with different concentrations of glucose: normal (5 mM d-glucose), medium (15 mM d-glucose) and high (30 mm d-glucose). Calphostin-C as a PKC inhibitor and phorbol myristate acetate (PMA) as a PKC downregulator were instillated into culture media to evaluate the role of PKC in mediating the glucose-induced increase in VEGF expression. High glucose increased expression of VEGF at the mRNA and protein levels, identified by semi-quantitative RT-PCR and western blotting, within 3 h and in a time- and glucose concentration-dependent manner. Calphostin-C and PMA inhibited glucose-induced increases in VEGF expression at the mRNA and protein levels. In conclusion, high glucose can directly increase VEGF expression in rat mesangial cells via a PKC-dependent mechanism. These results suggest that VEGF could be a potential mediator of glomerular hyperfiltration and proteinuria in diabetic nephropathy.
Search for other papers by AR Karuri in
Google Scholar
PubMed
Search for other papers by AM Kumar in
Google Scholar
PubMed
Search for other papers by D Mukhopadhyay in
Google Scholar
PubMed
This study examines the expression of the multi-functional cytokine, vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) in the rat uterus during early proestrus, proestrus, estrus and diestrus. Groups of ovariectomized or hypophysectomized rats served as endocrine controls. Expression of VPF/VEGF mRNA was 2-fold greater in uteri during proestrus and estrus than in other phases of the estrous cycle. In situ hybridization techniques indicated that VPF/VEGF mRNA expression was confined to the luminal epithelium during proestrus, but shifted to the stromal compartment during estrus. Ovariectomized, hypophysectomized or diestrus rats exhibited scattered localization of VPF/VEGF mRNA among glandular epithelium and endometrial stromal compartments. Although VPF/VEGF mRNA was expressed throughout the estrous cycle, but in different compartments of the endometrium depending on the stage of the estrous cycle, VPF/VEGF protein expression appears to be restricted to the epithelial compartment during proestrus and estrus. Results indicate that circulating levels of gonadal steroids and LH may be associated with the differential expression of VPF/VEGF mRNA and its translation activity in the endometrium during different stages of the estrous cycle.
