Filter

Refine by date

—

Refine by access

  • Print
  • Save

Search Results

You are looking at 41 - 50 of 217 items for :

  • "thyroid hormone receptors" x
  • Refine by access: All content x
Clear All
Beatriz S Amorim Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil
Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Beatriz S Amorim in
Google Scholar
PubMed Close
,
Cintia B Ueta Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil
Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Cintia B Ueta in
Google Scholar
PubMed Close
,
Beatriz C G Freitas Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Beatriz C G Freitas in
Google Scholar
PubMed Close
,
Renata J Nassif Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Renata J Nassif in
Google Scholar
PubMed Close
,
Cecília Helena de Azevedo Gouveia Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Cecília Helena de Azevedo Gouveia in
Google Scholar
PubMed Close
,
Marcelo A Christoffolete Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Marcelo A Christoffolete in
Google Scholar
PubMed Close
,
Anselmo S Moriscot Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Anselmo S Moriscot in
Google Scholar
PubMed Close
,
Carmen Lucia Lancelloti Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Carmen Lucia Lancelloti in
Google Scholar
PubMed Close
,
Flávia Llimona Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Flávia Llimona in
Google Scholar
PubMed Close
,
Hermes Vieira Barbeiro Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Hermes Vieira Barbeiro in
Google Scholar
PubMed Close
,
Heraldo Possolo de Souza Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Heraldo Possolo de Souza in
Google Scholar
PubMed Close
,
Sergio Catanozi Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Sergio Catanozi in
Google Scholar
PubMed Close
,
Marisa Passarelli Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Marisa Passarelli in
Google Scholar
PubMed Close
,
Marcelo S Aoki Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Marcelo S Aoki in
Google Scholar
PubMed Close
,
Antonio C Bianco Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Antonio C Bianco in
Google Scholar
PubMed Close
, and
Miriam O Ribeiro Biological Science Course, Division of Endocrinology, Department of Anatomy, Department of Cell and Developmental Biology, Lipids Laboratory (LIM 10) Faculty of Medical Sciences, Clinical Emergency, School of Arts, AFIP and Pathology, CCBS, Presbyterian University Mackenzie, Rua da Consolação, 930 Prédio 38, Curso de Biologia, São Paulo, SP 01302-907, Brazil

Search for other papers by Miriam O Ribeiro in
Google Scholar
PubMed Close

myocardium, bone, brain, and other tissues. Our current understanding of thyroid hormone action allows for the development of such strategies. Tri-iodothyronine (T 3 ) effects are mediated by thyroid hormone receptors (TRs), which are ligand

Article Type:
Research Article
DOI:
https://doi.org/10.1677/JOE-08-0539
Volume/Issue:
Volume 203: Issue 2
Free access
Suzana T Cunha Lima Diabetes Center, Instituto de Biologia, Centro Universitário da Bahia ‐ FIB, University of California, 513 Parnassus Avenue, 94143 San Francisco, California, USA
Diabetes Center, Instituto de Biologia, Centro Universitário da Bahia ‐ FIB, University of California, 513 Parnassus Avenue, 94143 San Francisco, California, USA

Search for other papers by Suzana T Cunha Lima in
Google Scholar
PubMed Close
and
Edson D Rodrigues Diabetes Center, Instituto de Biologia, Centro Universitário da Bahia ‐ FIB, University of California, 513 Parnassus Avenue, 94143 San Francisco, California, USA
Diabetes Center, Instituto de Biologia, Centro Universitário da Bahia ‐ FIB, University of California, 513 Parnassus Avenue, 94143 San Francisco, California, USA

Search for other papers by Edson D Rodrigues in
Google Scholar
PubMed Close

shows early time points on larger scale. Table 1 Kinetics of binding of thyroid hormone receptor expressed and purified by different methods, containing or not a point mutation, or in heterodimer with retinoid X receptor (RXR) Receptor K d (10 −10 M

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-11-0019
Volume/Issue:
Volume 210: Issue 1
Free access
Aline Cordeiro Biophysics Institute Carlos Chagas Filho, Federal University of Rio de Janeiro, Centro de Ciências da Saúde, Avenida Carlos Chagas Filho, 373, Bloco G, Cidade Universitária - Ilha do Fundão, Rio de Janeiro - RJ 21941-902, Brazil

Search for other papers by Aline Cordeiro in
Google Scholar
PubMed Close
,
Luana Lopes Souza Biophysics Institute Carlos Chagas Filho, Federal University of Rio de Janeiro, Centro de Ciências da Saúde, Avenida Carlos Chagas Filho, 373, Bloco G, Cidade Universitária - Ilha do Fundão, Rio de Janeiro - RJ 21941-902, Brazil

Search for other papers by Luana Lopes Souza in
Google Scholar
PubMed Close
,
Marcelo Einicker-Lamas Biophysics Institute Carlos Chagas Filho, Federal University of Rio de Janeiro, Centro de Ciências da Saúde, Avenida Carlos Chagas Filho, 373, Bloco G, Cidade Universitária - Ilha do Fundão, Rio de Janeiro - RJ 21941-902, Brazil

Search for other papers by Marcelo Einicker-Lamas in
Google Scholar
PubMed Close
, and
Carmen Cabanelas Pazos-Moura Biophysics Institute Carlos Chagas Filho, Federal University of Rio de Janeiro, Centro de Ciências da Saúde, Avenida Carlos Chagas Filho, 373, Bloco G, Cidade Universitária - Ilha do Fundão, Rio de Janeiro - RJ 21941-902, Brazil

Search for other papers by Carmen Cabanelas Pazos-Moura in
Google Scholar
PubMed Close

functionally with the thyroid hormone receptor (TR) to regulate malic enzyme gene expression ( Chou et al . 2007 ). The elevated S14 expression is important to increase lipogenic enzyme expressions induced by T 3 ( Cunningham et al . 1998 ). In this way

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-12-0542
Volume/Issue:
Volume 216: Issue 3
Free access
S Ando
Search for other papers by S Ando in
Google Scholar
PubMed Close
,
H Nakamura
Search for other papers by H Nakamura in
Google Scholar
PubMed Close
,
S Sasaki
Search for other papers by S Sasaki in
Google Scholar
PubMed Close
,
K Nishiyama
Search for other papers by K Nishiyama in
Google Scholar
PubMed Close
,
A Kitahara
Search for other papers by A Kitahara in
Google Scholar
PubMed Close
,
S Nagasawa
Search for other papers by S Nagasawa in
Google Scholar
PubMed Close
,
T Mikami
Search for other papers by T Mikami in
Google Scholar
PubMed Close
,
H Natsume
Search for other papers by H Natsume in
Google Scholar
PubMed Close
,
R Genma
Search for other papers by R Genma in
Google Scholar
PubMed Close
, and
T Yoshimi
Search for other papers by T Yoshimi in
Google Scholar
PubMed Close

Abstract

Clinical resistance to thyroid hormone (RTH) has been classified into generalized resistance to thyroid hormone (GRTH) and pituitary resistance to thyroid hormone (PRTH) types. Since similar mutations have been identified in tri-iodothyronine (T3) receptor (TR) β gene in GRTH and PRTH, and since considerable overlap has been seen in the clinical manifestations in patients with GRTH and PRTH, two subtypes of RTH are now considered to be a continuous spectrum with the same genetic defect. A point mutation at amino acid Arg 338 to Trp (R338W) which we identified in a patient with PRTH is very interesting, since R338W has been found in several other patients with PRTH, raising the possibility that this mutation may tend to associate with a phenotype of PRTH.

In our previous study, we found that R338W had relatively less impaired transcriptional potency, weaker dominant negative activity on various T3 response elements and poor homodimer formation, as compared with another GRTH mutant. In this study, to investigate the functional properties of R338W further, especially in terms of the relation between transcriptional activity and dimer formations, we introduced the R338W mutation into the mutant receptors, K443E and F451X, constructing the double mutants, R338W/K443E and R338W/F451X. Both R338W/K443E and R338W/F451X showed negligible T3 binding and transcriptional activities. The dominant negative activities of K443E and F451X were, however, significantly weakened by introducing the R338W mutation. As a control, a double mutant G345R/K443E was constructed by introducing a point mutation, G345R, located in the same exon 9 as R338W, into the K443E mutant. Dominant negative activity did not differ between G345R/K443E and K443E. Homodimer formation was significantly reduced in the double mutants containing R338W, but not G345R.

In summary, introducing the R338W mutation, but not G345R, into the mutant TR significantly weakened the dominant negative activity, despite further impairment of the T3 binding and transcriptional activities.

Journal of Endocrinology (1996) 151, 293–300

Article Type:
Research Article
DOI:
https://doi.org/10.1677/joe.0.1510293
Volume/Issue:
Volume 151: Issue 2
Restricted access
L A Santiago
Search for other papers by L A Santiago in
Google Scholar
PubMed Close
,
D A Santiago
Search for other papers by D A Santiago in
Google Scholar
PubMed Close
,
L C Faustino
Search for other papers by L C Faustino in
Google Scholar
PubMed Close
,
A Cordeiro
Search for other papers by A Cordeiro in
Google Scholar
PubMed Close
,
P C Lisboa Instituto de Biofísica Carlos Chagas Filho, Departamento de Ciências Fisiológicas, Department of Pediatrics and Medicine, Universidade Federal do Rio de Janeiro, Rio de Janeiro 21941-902, Brazil

Search for other papers by P C Lisboa in
Google Scholar
PubMed Close
,
F E Wondisford Instituto de Biofísica Carlos Chagas Filho, Departamento de Ciências Fisiológicas, Department of Pediatrics and Medicine, Universidade Federal do Rio de Janeiro, Rio de Janeiro 21941-902, Brazil

Search for other papers by F E Wondisford in
Google Scholar
PubMed Close
,
C C Pazos-Moura
Search for other papers by C C Pazos-Moura in
Google Scholar
PubMed Close
, and
T M Ortiga-Carvalho
Search for other papers by T M Ortiga-Carvalho in
Google Scholar
PubMed Close

Willingham MC Cheng CY 2009 Distinct regulation of lipid metabolism by unliganded thyroid hormone receptor isoforms . Molecular Endocrinology 23 308 – 315 . doi:10.1210/me.2008-0311 . Bassett JHD O'Shea PJ Sriskantharajah S Rabier B

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-11-0194
Volume/Issue:
Volume 211: Issue 1
Free access
Márcia Santos Wagner Endocrine Division, Thyroid Section, Hospital de Clínicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, 90035-033, Porto Alegre, RS, Brasil

Search for other papers by Márcia Santos Wagner in
Google Scholar
PubMed Close
,
Simone Magagnin Wajner Endocrine Division, Thyroid Section, Hospital de Clínicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, 90035-033, Porto Alegre, RS, Brasil

Search for other papers by Simone Magagnin Wajner in
Google Scholar
PubMed Close
, and
Ana Luiza Maia Endocrine Division, Thyroid Section, Hospital de Clínicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, 90035-033, Porto Alegre, RS, Brasil

Search for other papers by Ana Luiza Maia in
Google Scholar
PubMed Close

prepubertal life ( Orth et al . 1988 ). These data, in conjunction with the findings that thyroid hormone receptors (TRs) are present in human and rat testes from birth to adult life ( Buzzard et al . 2000 , Jannini et al . 2000 ), further confirm that

Article Type:
Research Article
DOI:
https://doi.org/10.1677/JOE-08-0218
Volume/Issue:
Volume 199: Issue 3
Free access
A Santillo Dipartimento di Scienze e Tecnologie Ambientali, Biologiche e Farmaceutiche, Seconda Università degli Studi di Napoli, via Vivaldi, 43, 81100 Caserta, Italy

Search for other papers by A Santillo in
Google Scholar
PubMed Close
,
L Burrone Dipartimento di Scienze e Tecnologie Ambientali, Biologiche e Farmaceutiche, Seconda Università degli Studi di Napoli, via Vivaldi, 43, 81100 Caserta, Italy

Search for other papers by L Burrone in
Google Scholar
PubMed Close
,
S Falvo Dipartimento di Scienze e Tecnologie Ambientali, Biologiche e Farmaceutiche, Seconda Università degli Studi di Napoli, via Vivaldi, 43, 81100 Caserta, Italy

Search for other papers by S Falvo in
Google Scholar
PubMed Close
,
R Senese Dipartimento di Scienze e Tecnologie Ambientali, Biologiche e Farmaceutiche, Seconda Università degli Studi di Napoli, via Vivaldi, 43, 81100 Caserta, Italy

Search for other papers by R Senese in
Google Scholar
PubMed Close
,
A Lanni Dipartimento di Scienze e Tecnologie Ambientali, Biologiche e Farmaceutiche, Seconda Università degli Studi di Napoli, via Vivaldi, 43, 81100 Caserta, Italy

Search for other papers by A Lanni in
Google Scholar
PubMed Close
, and
G Chieffi Baccari Dipartimento di Scienze e Tecnologie Ambientali, Biologiche e Farmaceutiche, Seconda Università degli Studi di Napoli, via Vivaldi, 43, 81100 Caserta, Italy

Search for other papers by G Chieffi Baccari in
Google Scholar
PubMed Close

ATCGAACGTGCTGCTTTCTT ATTTGCCGTAGAGGCTGAGA NM_013200.1 91 Acox CTGATGAAATACGCCCAGGT GGTCCCATACGTCAGCTTGT NM_017340.2 75 Rps12 AAATCGATCGAGAGGGGAAG CTTGGCCTGAGATTCTTTGC NM_031709.3 86 Thra , thyroid hormone receptor α; Thrb , thyroid hormone receptor β; Ppargc1a , PPAR

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-13-0127
Volume/Issue:
Volume 219: Issue 1
Free access
Elena Grasselli Dipartimento di Biologia, Dipartimento di Scienze Biologiche ed Ambientali, Istituto Nazionale Biostrutture e Biosistemi (INBB), Università di Genova, Corso Europa 26, Genova 16132, Italy

Search for other papers by Elena Grasselli in
Google Scholar
PubMed Close
,
Adriana Voci Dipartimento di Biologia, Dipartimento di Scienze Biologiche ed Ambientali, Istituto Nazionale Biostrutture e Biosistemi (INBB), Università di Genova, Corso Europa 26, Genova 16132, Italy

Search for other papers by Adriana Voci in
Google Scholar
PubMed Close
,
Laura Canesi Dipartimento di Biologia, Dipartimento di Scienze Biologiche ed Ambientali, Istituto Nazionale Biostrutture e Biosistemi (INBB), Università di Genova, Corso Europa 26, Genova 16132, Italy
Dipartimento di Biologia, Dipartimento di Scienze Biologiche ed Ambientali, Istituto Nazionale Biostrutture e Biosistemi (INBB), Università di Genova, Corso Europa 26, Genova 16132, Italy

Search for other papers by Laura Canesi in
Google Scholar
PubMed Close
,
Fernando Goglia Dipartimento di Biologia, Dipartimento di Scienze Biologiche ed Ambientali, Istituto Nazionale Biostrutture e Biosistemi (INBB), Università di Genova, Corso Europa 26, Genova 16132, Italy

Search for other papers by Fernando Goglia in
Google Scholar
PubMed Close
,
Silvia Ravera Dipartimento di Biologia, Dipartimento di Scienze Biologiche ed Ambientali, Istituto Nazionale Biostrutture e Biosistemi (INBB), Università di Genova, Corso Europa 26, Genova 16132, Italy

Search for other papers by Silvia Ravera in
Google Scholar
PubMed Close
,
Isabella Panfoli Dipartimento di Biologia, Dipartimento di Scienze Biologiche ed Ambientali, Istituto Nazionale Biostrutture e Biosistemi (INBB), Università di Genova, Corso Europa 26, Genova 16132, Italy

Search for other papers by Isabella Panfoli in
Google Scholar
PubMed Close
,
Gabriella Gallo Dipartimento di Biologia, Dipartimento di Scienze Biologiche ed Ambientali, Istituto Nazionale Biostrutture e Biosistemi (INBB), Università di Genova, Corso Europa 26, Genova 16132, Italy

Search for other papers by Gabriella Gallo in
Google Scholar
PubMed Close
, and
Laura Vergani Dipartimento di Biologia, Dipartimento di Scienze Biologiche ed Ambientali, Istituto Nazionale Biostrutture e Biosistemi (INBB), Università di Genova, Corso Europa 26, Genova 16132, Italy
Dipartimento di Biologia, Dipartimento di Scienze Biologiche ed Ambientali, Istituto Nazionale Biostrutture e Biosistemi (INBB), Università di Genova, Corso Europa 26, Genova 16132, Italy

Search for other papers by Laura Vergani in
Google Scholar
PubMed Close

TRα1 and TRβ1 in FaO cells. Basal expression of the thyroid hormone receptors quantified in FaO cells by RT-qPCR with respect to the rat liver. (A) Amplification curves of TRα1 and of the reference gene GAPDH in the rat liver and FaO cells. (B

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-11-0074
Volume/Issue:
Volume 210: Issue 1
Free access
Marcelo A Christoffolete
Search for other papers by Marcelo A Christoffolete in
Google Scholar
PubMed Close
,
Márton Doleschall Human and Natural Sciences Center, Laboratory of Endocrine Neurobiology, Division of Endocrinology, Division of Endocrinology, Federal University of ABC, Santo Andre-SP 09210-370, Brazil

Search for other papers by Márton Doleschall in
Google Scholar
PubMed Close
,
Péter Egri Human and Natural Sciences Center, Laboratory of Endocrine Neurobiology, Division of Endocrinology, Division of Endocrinology, Federal University of ABC, Santo Andre-SP 09210-370, Brazil

Search for other papers by Péter Egri in
Google Scholar
PubMed Close
,
Zsolt Liposits Human and Natural Sciences Center, Laboratory of Endocrine Neurobiology, Division of Endocrinology, Division of Endocrinology, Federal University of ABC, Santo Andre-SP 09210-370, Brazil

Search for other papers by Zsolt Liposits in
Google Scholar
PubMed Close
,
Ann Marie Zavacki Human and Natural Sciences Center, Laboratory of Endocrine Neurobiology, Division of Endocrinology, Division of Endocrinology, Federal University of ABC, Santo Andre-SP 09210-370, Brazil

Search for other papers by Ann Marie Zavacki in
Google Scholar
PubMed Close
,
Antonio C Bianco Human and Natural Sciences Center, Laboratory of Endocrine Neurobiology, Division of Endocrinology, Division of Endocrinology, Federal University of ABC, Santo Andre-SP 09210-370, Brazil

Search for other papers by Antonio C Bianco in
Google Scholar
PubMed Close
, and
Balázs Gereben Human and Natural Sciences Center, Laboratory of Endocrine Neurobiology, Division of Endocrinology, Division of Endocrinology, Federal University of ABC, Santo Andre-SP 09210-370, Brazil

Search for other papers by Balázs Gereben in
Google Scholar
PubMed Close

Introduction Thyroid hormone receptor (TR) and liver X-receptors (LXRs) are the key regulators of lipid metabolism. Both these receptors prefer to bind to a direct repeat of the consensus DNA-binding site separated by a 4 bp spacing (DR-4), and thus

Article Type:
Research Article
DOI:
https://doi.org/10.1677/JOE-09-0448
Volume/Issue:
Volume 205: Issue 2
Free access
Shiao Y Chan School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Shiao Y Chan in
Google Scholar
PubMed Close
,
Laura A Hancox School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Laura A Hancox in
Google Scholar
PubMed Close
,
Azucena Martín-Santos School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Azucena Martín-Santos in
Google Scholar
PubMed Close
,
Laurence S Loubière School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Laurence S Loubière in
Google Scholar
PubMed Close
,
Merlin N M Walter School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Merlin N M Walter in
Google Scholar
PubMed Close
,
Ana-Maria González School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Ana-Maria González in
Google Scholar
PubMed Close
,
Phillip M Cox School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Phillip M Cox in
Google Scholar
PubMed Close
,
Ann Logan School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Ann Logan in
Google Scholar
PubMed Close
,
Christopher J McCabe School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Christopher J McCabe in
Google Scholar
PubMed Close
,
Jayne A Franklyn School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Jayne A Franklyn in
Google Scholar
PubMed Close
, and
Mark D Kilby School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK
School of Clinical and Experimental Medicine, Department of Pathology, Fetal Medicine Centre, College of Medical and Dental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

Search for other papers by Mark D Kilby in
Google Scholar
PubMed Close

al . 1998 ) and decreased expression of cerebral thyroid hormone receptor (TR) expression ( Kilby et al . 2000 ) in growth-restricted human fetuses are postulated to contribute to this neurodevelopmental morbidity. Examination of growth

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-13-0400
Volume/Issue:
Volume 220: Issue 2
Open access