Search Results
Search for other papers by H. Klandorf in
Google Scholar
PubMed
Search for other papers by S. Harvey in
Google Scholar
PubMed
Search for other papers by H. M. Fraser in
Google Scholar
PubMed
ABSTRACT
Immature cockerels (4- to 5-weeks old) were passively immunized, with antiserum raised in sheep, against thyrotrophin-releasing hormone (TRH). The administration of TRH antiserum (anti-TRH) at doses of 0·5, 1·0 or 2·0 ml/kg lowered, within 1 h, the basal concentration of plasma GH for at least 24 h. The administration of normal sheep serum had no significant effect on the GH concentration in control birds. Although the GH response to TRH (1·0 or 10·0 μg/kg) was not impaired in birds treated 1 h previously with anti-TRH, prior incubation (at 39 °C for 1 h) of TRH (20 μg/ml) with an equal volume of anti-TRH completely suppressed the stimulatory effect of TRH (10 pg/kg) on GH secretion in vivo. These results suggest that TRH is physiologically involved in the hypothalamic control of GH secretion in the domestic fowl.
J. Endocr. (1985) 105, 351–355
Search for other papers by Z Zhang in
Google Scholar
PubMed
Search for other papers by P H Bisschop in
Google Scholar
PubMed
Search for other papers by E Foppen in
Google Scholar
PubMed
Search for other papers by H C van Beeren in
Google Scholar
PubMed
Hypothalamic Integration Mechanisms, Netherlands Institute for Neuroscience (NIN), Amsterdam, Amsterdam, the Netherlands
Search for other papers by A Kalsbeek in
Google Scholar
PubMed
Search for other papers by A Boelen in
Google Scholar
PubMed
Search for other papers by E Fliers in
Google Scholar
PubMed
GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCAA 84 Thyrotropin releasing hormone, prepropeptide Trh TCTGCAGAGTCTCCACTTCG AGAGCCAGCAGCAACCAA 59 Deiodinase type 3 Dio3 AGCGCAGCAAGAGTACTTCAG CCATCGTGTCCAGAACCAG 61 Hairless Hr
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina
Search for other papers by Alicia J Klecha in
Google Scholar
PubMed
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina
Search for other papers by Ana M Genaro in
Google Scholar
PubMed
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina
Search for other papers by Gabriela Gorelik in
Google Scholar
PubMed
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina
Search for other papers by María Laura Barreiro Arcos in
Google Scholar
PubMed
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina
Search for other papers by Dafne Magalí Silberman in
Google Scholar
PubMed
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina
Search for other papers by Mariano Schuman in
Google Scholar
PubMed
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina
Search for other papers by Silvia I Garcia in
Google Scholar
PubMed
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina
Search for other papers by Carlos Pirola in
Google Scholar
PubMed
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina
Search for other papers by Graciela A Cremaschi in
Google Scholar
PubMed
standards (reagents kindly provided by Dr A F Parlow from the National Hormone and Peptide Program, Bethesda, MD, USA). Hypothalamic TSH-releasing hormone (TRH) was determined by RIA as described elsewhere ( García et al. 1992 ). Briefly, animals were
Search for other papers by K O Akinsanya in
Google Scholar
PubMed
Search for other papers by H Jamal in
Google Scholar
PubMed
Search for other papers by M A Ghatei in
Google Scholar
PubMed
Search for other papers by S R Bloom in
Google Scholar
PubMed
Abstract
The novel peptide, pyroglutamyl-glutamyl-proline amide (pGlu-Glu-ProNH2; EEP), which has structural and immunological similarities to TRH (pGlu-His-ProNH2) has recently been shown to contribute to total TRH-like immunoreactivity (t-TRH-LI) detected in the rabbit prostate and rat and porcine anterior pituitary. In this study, the effects of dexamethasone (DEX) on rat pituitary TRH-like peptide levels in the rat were determined. TRH-like immunoreactivity (TRH-LI) was separated by ion exchange chromatography and detected by TRH RIA. Anion exchange chromatographic analysis suggested that EEP-like immunoreactivity (EEP-LI) accounted for 15·0 ± 1·2 pmol t-TRH-LI/g (70·4 ± 3·9%) in the control anterior pituitary with the remaining t-TRH-LI being due to TRH-LI.
Following DEX treatment pituitary EEP-LI and TRH-LI increased by 200% and 400% (P<0·001) respectively, constituting a 2·5-fold increase in t-TRH-LI in the pituitary. TRH-LI now accounted for 45·7±5·3% of t-TRH-LI compared with 29·6 ±4·1% in the controls. TRH-LI, but not EEP-LI, was detected in the hypothalamus and posterior pituitary, suggesting that EEP-LI is synthesised within the anterior pituitary. DEX also caused a 2·6-fold rise (P<0·001) in t-TRH-LI in dispersed, cultured anterior pituitary cells. Chromatographic analysis of cultured pituitary cell extracts revealed that the majority of t-TRH-LI (>98%) was due to TRH-LI. A possible explanation for the change in EEP-LI and TRH-LI levels in the in vivo and in vitro pituitary samples is that hypothalamic influences are necessary for the continued production of EEP-LI and are not present in vitro. Alternatively, the dissociation of the cell–cell interactions and/or the accumulation of cell products, particularly pituitary hormones in vitro, may result in a loss of the in vivo paracrine influences or the introduction of factors which inhibit EEP-LI and stimulate TRH-LI.
Journal of Endocrinology (1995) 145, 333–341
Search for other papers by S. L. JEFFCOATE in
Google Scholar
PubMed
Search for other papers by N. WHITE in
Google Scholar
PubMed
SUMMARY
Hypothalamic extracts from three mammalian species (rat, rabbit and sheep) were found to contain several ng of immunoreactive thyrotrophin releasing hormone (TRH)-like activity. This substance chromatographed on ion exchange chromatography (carboxymethyl cellulose) as a single peak that was indistinguishable from synthetic TRH. Hypothalamic TRH was also inactivated by normal human plasma at a rate (1·21–1·46%/μl plasma/h and 1·59–1·77%/50 μl plasma/min) similar to that of synthetic TRH (1·42%/μl plasma/h and 1·73%/50 μl plasma/min). This combination of chromatographic and enzymic techniques can be applied to the identification of immunoreactive TRH in body fluids.
Search for other papers by J. del Rio-Garcia in
Google Scholar
PubMed
Search for other papers by D. G. Smyth in
Google Scholar
PubMed
ABSTRACT
A rapid and sensitive chromatographic method is presented for determining TRH and TRH-like peptides in small quantities of tissues and fluids. The procedure was applied to screen a comprehensive range of tissues from the central nervous system (CNS) and periphery of the rat. When hydrochloric acid (100 mmol/l) was used for extraction, the TRH immunoreactivity obtained was identified solely with the known tripeptide hormone. In contrast, when weakly acidic conditions were used for extraction, neutral or acidic TRH-like peptides which lacked the histidine residue at position 2 of the hormone, but reacted with TRH antibodies, were shown to be present in addition to TRH. The TRH-like peptides in the brain were located principally in the hippocampus, brain stem and dorsal colliculi. In the periphery, TRH-like peptides were shown to be present in the male reproductive system and certain endocrine tissues. In addition, the presence of TRH-like peptides was confirmed in portal blood. The results indicate that peptides with a neutral or acidic TRH-like sequence at their C-terminus are widely distributed in the CNS and periphery of the rat. These peptides appear to occur mainly or exclusively in precursor forms from which TRH immunoreactivity can be released during extraction under weakly acidic conditions.
Journal of Endocrinology (1990) 127, 445–450
Search for other papers by Emmely M de Vries in
Google Scholar
PubMed
Search for other papers by Eric Fliers in
Google Scholar
PubMed
Search for other papers by Anita Boelen in
Google Scholar
PubMed
( Boelen et al . 1995 ). Chronic infusions with IL1 and IL6 on the other hand mimick certain symptoms such as decreased serum T 4 and T 3 and decreased thyrotropin-releasing hormone (TRH) expression in the hypothalamus in mice ( van Haasteren et al
Search for other papers by S. M. Cockle in
Google Scholar
PubMed
Search for other papers by J. M. Morrell in
Google Scholar
PubMed
Search for other papers by D. G. Smyth in
Google Scholar
PubMed
ABSTRACT
TRH-related peptides were extracted from the hypothalamus and prostate gland of the rabbit. The peptides were fractionated by gel exclusion chromatography and located by trypsin digestion and radioimmunoassay with antibodies to TRH amide and TRH–Gly Lys. In the hypothalamus TRH-related peptides containing approximately 16 and 30 residues were observed: in these peptides the extensions to the TRH sequence were exclusively in the C-terminal direction. In addition, the three-residue form of TRH was also present. In the prostate complex, the predominant TRH-related peptide contained approximately 50 residues and the extension to the TRH tripeptide was on the N-terminal side; a three-residue form of immunoreactive TRH was also demonstrated. The same pattern of TRH-related peptides was shown to be present in rabbit semen. The results reveal the existence of a novel TRH-related polypeptide in the prostate and semen which does not occur in the hypothalamus. This peptide appears to undergo secretion.
Journal of Endocrinology (1989) 120, 31–36
Search for other papers by LG Luo in
Google Scholar
PubMed
Search for other papers by N Yano in
Google Scholar
PubMed
Thyrotropin-releasing hormone (TRH), a hypothalamic tripeptide, is expressed in pancreatic islets at peak levels during the late gestation and early neonate period. TRH increases insulin production in cultured beta-cells, suggesting that it might play a role in regulating pancreatic beta-cell function. However, there is limited information on TRH receptor expression in the pancreas. The aim of the present study was to explore the distribution of the TRH receptor in the pancreas and its function in pancreatic beta-cells. TRH receptor type 1 (TRHR1) gene expression was detected by RT-PCR and verified by Northern blotting and immunoblotting in the beta-cell lines, INS-1 and betaTC-6, and the rat pancreatic organ. The absence of TRH receptor type 2 expression in the tissue and cells indicated the tissue specificity of TRH receptor expression in the pancreas. The TRHR1 signals (detected by in situ hybridization) were distributed not only in islets but also in the surrounding areas of the pancreatic ductal and vasal epithelia. The apparent dissociation constant value for the affinity of [(3)H]3-methyl-histidine TRH (MeTRH) is 4.19 in INS-1 and 3.09 nM in betaTC-6. In addition, TRH induced epidermal growth factor (EGF) receptor phosphorylation with a half-maximum concentration of approximately 50 nM, whereas the high affinity analogue of TRH, MeTRH, was 1 nM. This suggested that the affinity of TRH ligands for the TRH receptor influences the activation of EGF receptor phosphorylation in betaTC-6 cells. Our observations suggested that the biological role of TRH in pancreatic beta-cells is via the activation of TRHR1. Further research is required to identify the role of TRHR1 in the pancreas aside from the islets.
Search for other papers by S. Harvey in
Google Scholar
PubMed
Search for other papers by R. W. Lea in
Google Scholar
PubMed
Search for other papers by C. Ahene in
Google Scholar
PubMed
ABSTRACT
Peripheral plasma concentrations of GH in adult chickens were increased, in a dose-related manner, between 5 and 30 min after the intracerebroventricular (i.c.v.) injection of 0·1 or 10 μg TRH. In contrast, i.v. administration of comparable doses of TRH had no significant effect on circulating GH concentrations. [3H]3-methyl-histidine2-TRH ([3H]Me-TRH) was located in the pituitary gland and peripheral plasma within 5 min of its i.c.v. administration, although in amounts that were unlikely to affect directly pituitary function. [3H]Me-TRH rapidly accumulated in the hypothalamus following its i.c.v. administration (but not after i.v. injection), and the central effect of TRH on GH secretion in birds is therefore likely to be induced by effects at hypothalamic sites.
Journal of Endocrinology (1990) 126, 83–88
