Filter

Refine by date

—

Refine by collections

Refine by access

  • Print
  • Save

Search Results

You are looking at 81 - 90 of 215 items for :

  • Refine by access: All content x
Clear All
Yanwen Jiang College of Animal Sciences, Jilin University, Changchun, Jilin, China

Search for other papers by Yanwen Jiang in
Google Scholar
PubMed Close
,
Lu Chen College of Animal Sciences, Jilin University, Changchun, Jilin, China

Search for other papers by Lu Chen in
Google Scholar
PubMed Close
,
Robert N Taylor Departments of Obstetrics and Gynecology and Molecular Medicine and Translational Sciences, Wake Forest School of Medicine, Winston-Salem, North Carolina, USA

Search for other papers by Robert N Taylor in
Google Scholar
PubMed Close
,
Chunjin Li College of Animal Sciences, Jilin University, Changchun, Jilin, China

Search for other papers by Chunjin Li in
Google Scholar
PubMed Close
, and
Xu Zhou College of Animal Sciences, Jilin University, Changchun, Jilin, China

Search for other papers by Xu Zhou in
Google Scholar
PubMed Close

production of various cytokines involved in stromal cell growth, adhesion and differentiation ( Wu et al . 2013 ). Interleukin 6 (IL-6), monocyte chemotactic protein 1 (MCP-1), tumor necrosis factor α (TNF-α), vascular endothelial growth factor (VEGF) and

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JOE-17-0544
Volume/Issue:
Volume 236: Issue 3
Free access
Yang Chen School of Life Science, Xuzhou Medical University, Xuzhou, Jiangsu, China
Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Yang Chen in
Google Scholar
PubMed Close
,
Xin Li School of Life Science, Xuzhou Medical University, Xuzhou, Jiangsu, China

Search for other papers by Xin Li in
Google Scholar
PubMed Close
,
Jing Zhang Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Jing Zhang in
Google Scholar
PubMed Close
,
Mingjiao Zhang Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Mingjiao Zhang in
Google Scholar
PubMed Close
,
Salah Adlat Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Salah Adlat in
Google Scholar
PubMed Close
,
Xiaodan Lu Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Xiaodan Lu in
Google Scholar
PubMed Close
,
Dan Li Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Dan Li in
Google Scholar
PubMed Close
,
Honghong Jin Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Honghong Jin in
Google Scholar
PubMed Close
,
Chenhao Wang Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Chenhao Wang in
Google Scholar
PubMed Close
,
Zin Mar Oo Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Zin Mar Oo in
Google Scholar
PubMed Close
,
Farooq Hayel Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Farooq Hayel in
Google Scholar
PubMed Close
,
Quangang Chen School of Life Science, Xuzhou Medical University, Xuzhou, Jiangsu, China

Search for other papers by Quangang Chen in
Google Scholar
PubMed Close
,
Xufeng Han School of Life Science, Xuzhou Medical University, Xuzhou, Jiangsu, China

Search for other papers by Xufeng Han in
Google Scholar
PubMed Close
,
Renjin Chen School of Life Science, Xuzhou Medical University, Xuzhou, Jiangsu, China

Search for other papers by Renjin Chen in
Google Scholar
PubMed Close
,
Xuechao Feng Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Xuechao Feng in
Google Scholar
PubMed Close
,
Luqing Zhang Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Luqing Zhang in
Google Scholar
PubMed Close
, and
Yaowu Zheng Transgenic Research Center, Northeast Normal University, Changchun, Jilin, China

Search for other papers by Yaowu Zheng in
Google Scholar
PubMed Close

vascular endothelial growth factors (VEGFs) that are important in vasculogenesis and lymphogenesis ( Olsson et al. 2006 , Stuttfeld & Ballmer-Hofer 2009 ). VEGFB is highly expressed in skeletal muscle, heart and BAT ( Grimmond et al. 1996 , Olofsson

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-22-0329
Volume/Issue:
Volume 258: Issue 1
Restricted access
Rodrigo S Fortunato Laboratory of Molecular Radiobiology, Laboratory of Endocrine Physiology, Mixed Unity of Research (UMR) 8200 – Genomes and Cancer, Carlos Chagas Filho Institute of Biophysics, Federal University of Rio de Janeiro, Avenida Carlos Chagas Filho, 373, CCS - Bloco G - Subsolo - Sala G0-031, Cidade Universitária - Ilha do Fundão, 21941-902 Rio de Janeiro, RJ, Brazil

Search for other papers by Rodrigo S Fortunato in
Google Scholar
PubMed Close
,
Andrea C F Ferreira Laboratory of Molecular Radiobiology, Laboratory of Endocrine Physiology, Mixed Unity of Research (UMR) 8200 – Genomes and Cancer, Carlos Chagas Filho Institute of Biophysics, Federal University of Rio de Janeiro, Avenida Carlos Chagas Filho, 373, CCS - Bloco G - Subsolo - Sala G0-031, Cidade Universitária - Ilha do Fundão, 21941-902 Rio de Janeiro, RJ, Brazil

Search for other papers by Andrea C F Ferreira in
Google Scholar
PubMed Close
,
Fabio Hecht Laboratory of Molecular Radiobiology, Laboratory of Endocrine Physiology, Mixed Unity of Research (UMR) 8200 – Genomes and Cancer, Carlos Chagas Filho Institute of Biophysics, Federal University of Rio de Janeiro, Avenida Carlos Chagas Filho, 373, CCS - Bloco G - Subsolo - Sala G0-031, Cidade Universitária - Ilha do Fundão, 21941-902 Rio de Janeiro, RJ, Brazil
Laboratory of Molecular Radiobiology, Laboratory of Endocrine Physiology, Mixed Unity of Research (UMR) 8200 – Genomes and Cancer, Carlos Chagas Filho Institute of Biophysics, Federal University of Rio de Janeiro, Avenida Carlos Chagas Filho, 373, CCS - Bloco G - Subsolo - Sala G0-031, Cidade Universitária - Ilha do Fundão, 21941-902 Rio de Janeiro, RJ, Brazil

Search for other papers by Fabio Hecht in
Google Scholar
PubMed Close
,
Corinne Dupuy Laboratory of Molecular Radiobiology, Laboratory of Endocrine Physiology, Mixed Unity of Research (UMR) 8200 – Genomes and Cancer, Carlos Chagas Filho Institute of Biophysics, Federal University of Rio de Janeiro, Avenida Carlos Chagas Filho, 373, CCS - Bloco G - Subsolo - Sala G0-031, Cidade Universitária - Ilha do Fundão, 21941-902 Rio de Janeiro, RJ, Brazil

Search for other papers by Corinne Dupuy in
Google Scholar
PubMed Close
, and
Denise P Carvalho Laboratory of Molecular Radiobiology, Laboratory of Endocrine Physiology, Mixed Unity of Research (UMR) 8200 – Genomes and Cancer, Carlos Chagas Filho Institute of Biophysics, Federal University of Rio de Janeiro, Avenida Carlos Chagas Filho, 373, CCS - Bloco G - Subsolo - Sala G0-031, Cidade Universitária - Ilha do Fundão, 21941-902 Rio de Janeiro, RJ, Brazil

Search for other papers by Denise P Carvalho in
Google Scholar
PubMed Close

/2 phosphorylation, so H 2 O 2 produced by NOX4 could be involved in this signaling pathway ( Manole et al . 2001 , Kumar et al . 2010 ). Vascular endothelial growth factor (VEGF) is a proangiogenic factor with a central role in the function, development, and

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JOE-13-0588
Volume/Issue:
Volume 221: Issue 2
Free access
Koichi Suzuki Cell Regulation Section, Metabolic Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892, USA

Search for other papers by Koichi Suzuki in
Google Scholar
PubMed Close
and
Leonard D Kohn Cell Regulation Section, Metabolic Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892, USA

Search for other papers by Leonard D Kohn in
Google Scholar
PubMed Close

factor/vascular permeability (VEGF/VPF) is maximal (Fig. 5B, i ). With low concentrations of follicular Tg, PDS gene expression is weakly induced, but expression of the other genes is still maintained (Fig. 5B, ii ). However, under higher concentrations

Article Type:
Research Article
DOI:
https://doi.org/10.1677/joe.1.06677
Volume/Issue:
Volume 189: Issue 2
Free access
K A Staines
Search for other papers by K A Staines in
Google Scholar
PubMed Close
,
A S Pollard
Search for other papers by A S Pollard in
Google Scholar
PubMed Close
,
I M McGonnell
Search for other papers by I M McGonnell in
Google Scholar
PubMed Close
,
C Farquharson Comparative Biomedical Sciences, Roslin Institute and R(D)SVS, The Royal Veterinary College, Royal College Street, London NW1 0TU, UK

Search for other papers by C Farquharson in
Google Scholar
PubMed Close
, and
A A Pitsillides
Search for other papers by A A Pitsillides in
Google Scholar
PubMed Close

bone (SB). Bar=0.1 mm. Primary ossification originates in the centre of the diaphysis of the developing skeletal element. The growth cartilage is invaded by blood vessels, seemingly attracted by VEGF expression by hypertrophic chondrocyte ( Zelzer et

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JOE-13-0276
Volume/Issue:
Volume 219: Issue 1
Open access
Linda Vignozzi Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy
Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Linda Vignozzi in
Google Scholar
PubMed Close
,
Ilaria Cellai Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy
Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Ilaria Cellai in
Google Scholar
PubMed Close
,
Raffaella Santi Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Raffaella Santi in
Google Scholar
PubMed Close
,
Letizia Lombardelli Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Letizia Lombardelli in
Google Scholar
PubMed Close
,
Annamaria Morelli Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy
Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Annamaria Morelli in
Google Scholar
PubMed Close
,
Paolo Comeglio Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy
Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Paolo Comeglio in
Google Scholar
PubMed Close
,
Sandra Filippi Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Sandra Filippi in
Google Scholar
PubMed Close
,
Federica Logiodice Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Federica Logiodice in
Google Scholar
PubMed Close
,
Marco Carini Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Marco Carini in
Google Scholar
PubMed Close
,
Gabriella Nesi Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Gabriella Nesi in
Google Scholar
PubMed Close
,
Mauro Gacci Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Mauro Gacci in
Google Scholar
PubMed Close
,
Marie-Pierre Piccinni Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Marie-Pierre Piccinni in
Google Scholar
PubMed Close
,
Luciano Adorini Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Luciano Adorini in
Google Scholar
PubMed Close
, and
Mario Maggi Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy
Sexual Medicine and Andrology Unit, CIRMAR (Centro Interuniversitario di Ricerca sulle Basi Molecolari della Malattie della Riproduzione), Interdepartmental Laboratory of Functional and Cellular Pharmacology of Reproduction, Department of Human Pathology and Oncology, Immunoallergology Unit, Department of Urology, Intercept Pharmaceuticals, Department of Clinical Physiopathology, University of Florence, Viale Pieraccini 6, Florence 50139, Italy

Search for other papers by Mario Maggi in
Google Scholar
PubMed Close

and chemokines: IL1β, IL1Ra, IL2, IL4, IL5, IL6, IL8, IL9, IL10, IL12, IL13, IL15, IL17A, IFN-γ, TNFα, G-CSF, GM-CSF, VEGF, PDGF, basic fibroblast growth factor (bFGF) interferon γ/inducible protein-10 (IP-10), monocyte chemotactic protein-1 (MCP-1

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-12-0142
Volume/Issue:
Volume 214: Issue 1
Free access
Sunita M C De Sousa Endocrine & Metabolic Unit, Royal Adelaide Hospital, Adelaide, Australia
South Australian Adult Genetics Unit, Royal Adelaide Hospital, Adelaide, Australia
Adelaide Medical School, University of Adelaide, Adelaide, Australia

Search for other papers by Sunita M C De Sousa in
Google Scholar
PubMed Close
,
Nèle F Lenders Department of Endocrinology, St Vincent’s Hospital, Sydney, NSW, Australia
Garvan Institute of Medical Research, Sydney, NSW, Australia
St Vincent’s Clinical School, University of New South Wales, Sydney, NSW, Australia

Search for other papers by Nèle F Lenders in
Google Scholar
PubMed Close
,
Lydia S Lamb Garvan Institute of Medical Research, Sydney, NSW, Australia
St Vincent’s Clinical School, University of New South Wales, Sydney, NSW, Australia

Search for other papers by Lydia S Lamb in
Google Scholar
PubMed Close
,
Warrick J Inder Department of Diabetes and Endocrinology, Princess Alexandra Hospital, Brisbane, Australia
Academy for Medical Education, Faculty of Medicine, the University of Queensland, Brisbane, Australia

Search for other papers by Warrick J Inder in
Google Scholar
PubMed Close
, and
Ann McCormack Department of Endocrinology, St Vincent’s Hospital, Sydney, NSW, Australia
Garvan Institute of Medical Research, Sydney, NSW, Australia
St Vincent’s Clinical School, University of New South Wales, Sydney, NSW, Australia

Search for other papers by Ann McCormack in
Google Scholar
PubMed Close

hypoxia Dysregulation of cell signalling pathways – including growth factors and their receptors, intracellular signalling pathways and the cell cycle – contributes to pituitary tumorigenesis. The vascular endothelial growth factor (VEGF) signalling

Article Type:
Review Article
Collections:
Endocrine Society of Australia special collection
DOI:
https://doi.org/10.1530/JOE-22-0291
Volume/Issue:
Volume 257: Issue 3
Free access
Katherine A Staines The Roslin Institute and Royal (Dick) School of Veterinary Studies, The University of Edinburgh, Easter Bush, Edinburgh, Midlothian EH25 9RG, UK

Search for other papers by Katherine A Staines in
Google Scholar
PubMed Close
,
Vicky E MacRae The Roslin Institute and Royal (Dick) School of Veterinary Studies, The University of Edinburgh, Easter Bush, Edinburgh, Midlothian EH25 9RG, UK

Search for other papers by Vicky E MacRae in
Google Scholar
PubMed Close
, and
Colin Farquharson The Roslin Institute and Royal (Dick) School of Veterinary Studies, The University of Edinburgh, Easter Bush, Edinburgh, Midlothian EH25 9RG, UK

Search for other papers by Colin Farquharson in
Google Scholar
PubMed Close

chondrocytes express factors such as vascular endothelial growth factor (VEGF) that induce vascular invasion, allowing the infiltration of osteoclasts and differentiating osteoblasts that resorb the cartilaginous mineralised matrix and replace it with

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-12-0143
Volume/Issue:
Volume 214: Issue 3
Free access
Amy Hughes Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA
Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA

Search for other papers by Amy Hughes in
Google Scholar
PubMed Close
,
Darling Rojas-Canales Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA
Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA

Search for other papers by Darling Rojas-Canales in
Google Scholar
PubMed Close
,
Chris Drogemuller Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA
Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA
Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA
Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA

Search for other papers by Chris Drogemuller in
Google Scholar
PubMed Close
,
Nicolas H Voelcker Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA
Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA

Search for other papers by Nicolas H Voelcker in
Google Scholar
PubMed Close
,
Shane T Grey Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA

Search for other papers by Shane T Grey in
Google Scholar
PubMed Close
, and
P T H Coates Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA
Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA
Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA
Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA
Department of Physiology and Biophysics, The Centre for Clinical and Experimental Transplantation (CCET), Australian Islet Transplant Consortium, School of Medicine, Cooperative Research Centre for Cell Therapy Manufacturing (CRC-CTM), Mawson Institute, Gene Therapy and Autoimmunity Group, Centre for Stem Cell Research, University of Illinois at Chicago, Chicago, Illinois 60612, USA

Search for other papers by P T H Coates in
Google Scholar
PubMed Close

vascular endothelial growth factor (VEGF), an endothelial cell-specific mitogen involved in vasculogenesis and angiogenesis ( Kwon et al . 2004 ). The production of VEGF in this manner is particularly advantageous when considering the reduction in islet

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JOE-13-0557
Volume/Issue:
Volume 221: Issue 2
Free access
Laura E Pascal Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA

Search for other papers by Laura E Pascal in
Google Scholar
PubMed Close
,
Khalid Z Masoodi Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA
Transcriptomics Lab, Division of Plant Biotechnology, Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir, Shalimar, Srinagar, Jammu and Kashmir, India

Search for other papers by Khalid Z Masoodi in
Google Scholar
PubMed Close
,
June Liu Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA

Search for other papers by June Liu in
Google Scholar
PubMed Close
,
Xiaonan Qiu Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA
School of Medicine, Tsinghua University, Beijing, China

Search for other papers by Xiaonan Qiu in
Google Scholar
PubMed Close
,
Qiong Song Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA
Center for Translational Medicine, Guangxi Medical University, Nanning, Guangxi, China

Search for other papers by Qiong Song in
Google Scholar
PubMed Close
,
Yujuan Wang Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA

Search for other papers by Yujuan Wang in
Google Scholar
PubMed Close
,
Yachen Zang Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA
Department of Urology, The Second Affiliated Hospital of Soochow University, Suzhou, China

Search for other papers by Yachen Zang in
Google Scholar
PubMed Close
,
Tiejun Yang Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA
Department of Urology, Henan Cancer Hospital, Affiliated Cancer Hospital of Zhengzhou University, Zhengzhou, China

Search for other papers by Tiejun Yang in
Google Scholar
PubMed Close
,
Yao Wang Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA
Department of Urology, China-Japan Hospital of Jilin University, Changchun, Jilin, China

Search for other papers by Yao Wang in
Google Scholar
PubMed Close
,
Lora H Rigatti Division of Laboratory Animal Resources, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA

Search for other papers by Lora H Rigatti in
Google Scholar
PubMed Close
,
Uma Chandran Department of Biomedical Informatics, University of Pittsburgh, Pittsburgh, Pennsylvania, USA

Search for other papers by Uma Chandran in
Google Scholar
PubMed Close
,
Leandro M Colli Ribeirao Preto Medical School, University of São Paulo, Ribeirão Preto-SP, Brazil

Search for other papers by Leandro M Colli in
Google Scholar
PubMed Close
,
Ricardo Z N Vencio Department of Computing and Mathematics FFCLRP-USP, University of São Paulo, Ribeirão Preto, Brazil

Search for other papers by Ricardo Z N Vencio in
Google Scholar
PubMed Close
,
Yi Lu Key Laboratory of Longevity and Aging-related Diseases, Ministry of Education, China and Center for Translational Medicine Guangxi Medical University, Nanning, Guangxi, China
Department of Biology, Southern University of Science and Technology School of Medicine, Shenzhen, Guangdong, China

Search for other papers by Yi Lu in
Google Scholar
PubMed Close
,
Jian Zhang Key Laboratory of Longevity and Aging-related Diseases, Ministry of Education, China and Center for Translational Medicine Guangxi Medical University, Nanning, Guangxi, China
Department of Biology, Southern University of Science and Technology School of Medicine, Shenzhen, Guangdong, China

Search for other papers by Jian Zhang in
Google Scholar
PubMed Close
, and
Zhou Wang Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA
University of Pittsburgh Cancer Institute, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA
Department of Pharmacology and Chemical Biology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA

Search for other papers by Zhou Wang in
Google Scholar
PubMed Close

transcriptional repressor 3 GGTCCCCAACTACGGGAAAC CTGTAGGGGGTCACTGGGATT Mouse VEGF Vascular endothelial growth factor GCACATAGAGAGAATGAGCTTCC CTCCGCTCTGAACAAGGCT Mouse Cell culture experiments Human C4-2 prostate cancer cells

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-17-0112
Volume/Issue:
Volume 235: Issue 2
Free access