Filter

Refine by date

—

Refine by collections

Refine by access

  • Print
  • Save

Search Results

You are looking at 1 - 10 of 14 items for :

  • Refine by access: Open Access content only x
Clear All
M A Hyatt Early Life Nutrition Research Unit, Respiratory Biomedical Research Unit, Department of Animal Sciences, Division of Human Development, Academic Child Health

Search for other papers by M A Hyatt in
Google Scholar
PubMed Close
,
D H Keisler Early Life Nutrition Research Unit, Respiratory Biomedical Research Unit, Department of Animal Sciences, Division of Human Development, Academic Child Health

Search for other papers by D H Keisler in
Google Scholar
PubMed Close
,
H Budge Early Life Nutrition Research Unit, Respiratory Biomedical Research Unit, Department of Animal Sciences, Division of Human Development, Academic Child Health
Early Life Nutrition Research Unit, Respiratory Biomedical Research Unit, Department of Animal Sciences, Division of Human Development, Academic Child Health

Search for other papers by H Budge in
Google Scholar
PubMed Close
, and
M E Symonds Early Life Nutrition Research Unit, Respiratory Biomedical Research Unit, Department of Animal Sciences, Division of Human Development, Academic Child Health
Early Life Nutrition Research Unit, Respiratory Biomedical Research Unit, Department of Animal Sciences, Division of Human Development, Academic Child Health

Search for other papers by M E Symonds in
Google Scholar
PubMed Close

HUGO Database) and the enzymes 11β-hydroxysteroid dehydrogenase (HSD11B) types 1 and 2 as well as uncoupling protein 2 (UCP2) and peroxisome proliferator-activated receptor γ (PPARG; Whorwood et al . 2001 , Bispham et al . 2005 , Gnanalingham et

Article Type:
Research Article
DOI:
https://doi.org/10.1677/JOE-09-0358
Volume/Issue:
Volume 204: Issue 2
Open access
View license
Yanli Miao Department of Cardiology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

Search for other papers by Yanli Miao in
Google Scholar
PubMed Close
,
Haojie Qin Department of Cardiology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

Search for other papers by Haojie Qin in
Google Scholar
PubMed Close
,
Yi Zhong Department of Cardiology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

Search for other papers by Yi Zhong in
Google Scholar
PubMed Close
,
Kai Huang Department of Cardiology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

Search for other papers by Kai Huang in
Google Scholar
PubMed Close
, and
Caijun Rao Department of Geriatrics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

Search for other papers by Caijun Rao in
Google Scholar
PubMed Close

browning ( Wang & Seale 2016 ). The browned white adipocytes begin to express uncoupling protein-1 (UCP1), a specific marker of brown adipose tissue, making white adipose tissue more likely to generate heat and increase the body’s energy consumption. In

Article Type:
Research Article
Collections:
Top-cited articles of 2023
DOI:
https://doi.org/10.1530/JOE-20-0503
Volume/Issue:
Volume 249: Issue 2
Open access
Noelia Martínez-Sánchez Department of Physiology, CIMUS, University of Santiago de Compostela-Instituto de Investigación Sanitaria, Santiago de Compostela, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Santiago de Compostela, Spain

Search for other papers by Noelia Martínez-Sánchez in
Google Scholar
PubMed Close
,
José M Moreno-Navarrete CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Santiago de Compostela, Spain
Department of Diabetes, Endocrinology and Nutrition, Hospital de Girona ‘Dr Josep Trueta’, Institut D’investigació Biomèdica de Girona (IdIBGi) and University of Girona, Girona, Spain

Search for other papers by José M Moreno-Navarrete in
Google Scholar
PubMed Close
,
Cristina Contreras Department of Physiology, CIMUS, University of Santiago de Compostela-Instituto de Investigación Sanitaria, Santiago de Compostela, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Santiago de Compostela, Spain

Search for other papers by Cristina Contreras in
Google Scholar
PubMed Close
,
Eva Rial-Pensado Department of Physiology, CIMUS, University of Santiago de Compostela-Instituto de Investigación Sanitaria, Santiago de Compostela, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Santiago de Compostela, Spain

Search for other papers by Eva Rial-Pensado in
Google Scholar
PubMed Close
,
Johan Fernø Department of Physiology, CIMUS, University of Santiago de Compostela-Instituto de Investigación Sanitaria, Santiago de Compostela, Spain
Department of Clinical Science, KG Jebsen Center for Diabetes Research, University of Bergen, Bergen, Norway

Search for other papers by Johan Fernø in
Google Scholar
PubMed Close
,
Rubén Nogueiras Department of Physiology, CIMUS, University of Santiago de Compostela-Instituto de Investigación Sanitaria, Santiago de Compostela, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Santiago de Compostela, Spain

Search for other papers by Rubén Nogueiras in
Google Scholar
PubMed Close
,
Carlos Diéguez Department of Physiology, CIMUS, University of Santiago de Compostela-Instituto de Investigación Sanitaria, Santiago de Compostela, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Santiago de Compostela, Spain

Search for other papers by Carlos Diéguez in
Google Scholar
PubMed Close
,
José-Manuel Fernández-Real CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Santiago de Compostela, Spain
Department of Diabetes, Endocrinology and Nutrition, Hospital de Girona ‘Dr Josep Trueta’, Institut D’investigació Biomèdica de Girona (IdIBGi) and University of Girona, Girona, Spain

Search for other papers by José-Manuel Fernández-Real in
Google Scholar
PubMed Close
, and
Miguel López Department of Physiology, CIMUS, University of Santiago de Compostela-Instituto de Investigación Sanitaria, Santiago de Compostela, Spain
CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), Santiago de Compostela, Spain

Search for other papers by Miguel López in
Google Scholar
PubMed Close

cAMP-mediated acute rise in ucp1 gene expression ( Bianco et al . 1988 , Silva 2006 , Ribeiro et al . 2010 ). The existence of central effects of THs in the regulation of BAT thermogenesis was proposed long time ago ( Nedergaard et al . 1997

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-16-0425
Volume/Issue:
Volume 232: Issue 2
Open access
Koichiro Taguchi Department of General Internal Medicine, Gifu University Graduate School of Medicine, Gifu, Japan

Search for other papers by Koichiro Taguchi in
Google Scholar
PubMed Close
,
Kazuo Kajita Department of General Internal Medicine, Gifu University Graduate School of Medicine, Gifu, Japan

Search for other papers by Kazuo Kajita in
Google Scholar
PubMed Close
,
Yoshihiko Kitada Department of General Internal Medicine, Gifu University Graduate School of Medicine, Gifu, Japan

Search for other papers by Yoshihiko Kitada in
Google Scholar
PubMed Close
,
Masayuki Fuwa Department of General Internal Medicine, Gifu University Graduate School of Medicine, Gifu, Japan

Search for other papers by Masayuki Fuwa in
Google Scholar
PubMed Close
,
Motochika Asano Department of General Internal Medicine, Gifu University Graduate School of Medicine, Gifu, Japan

Search for other papers by Motochika Asano in
Google Scholar
PubMed Close
,
Takahide Ikeda Department of General Internal Medicine, Gifu University Graduate School of Medicine, Gifu, Japan

Search for other papers by Takahide Ikeda in
Google Scholar
PubMed Close
,
Toshiko Kajita Department of General Internal Medicine, Gifu University Graduate School of Medicine, Gifu, Japan

Search for other papers by Toshiko Kajita in
Google Scholar
PubMed Close
,
Tatsuo Ishizuka Department of General Internal Medicine and Rheumatology, Gifu Municipal Hospital, Gifu, Japan

Search for other papers by Tatsuo Ishizuka in
Google Scholar
PubMed Close
,
Itaru Kojima Laboratory of Cell Physiology, Institute for Molecular and Cellular Regulation, Gunma University, Gunma, Japan

Search for other papers by Itaru Kojima in
Google Scholar
PubMed Close
, and
Hiroyuki Morita Department of General Internal Medicine, Gifu University Graduate School of Medicine, Gifu, Japan

Search for other papers by Hiroyuki Morita in
Google Scholar
PubMed Close

beige cells, in white adipose tissue ( Vitali et al . 2012 , Chen et al. 2013 ). Uncoupling protein 1 (UCP1) is a major marker of beige cells, as well as brown adipose tissue (BAT). Despite numerous similarities, however, BAT and beige cells differ

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-19-0503
Volume/Issue:
Volume 245: Issue 1
Open access
K L Davies Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK

Search for other papers by K L Davies in
Google Scholar
PubMed Close
,
E J Camm Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK
The Ritchie Centre, Hudson Institute of Medical Research, Clayton, Australia

Search for other papers by E J Camm in
Google Scholar
PubMed Close
,
D J Smith Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK

Search for other papers by D J Smith in
Google Scholar
PubMed Close
,
O R Vaughan Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK
Institute for Women’s Health, University College London, London, UK

Search for other papers by O R Vaughan in
Google Scholar
PubMed Close
,
A J Forhead Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK
Department of Biological and Medical Sciences, Oxford Brookes University, Oxford, UK

Search for other papers by A J Forhead in
Google Scholar
PubMed Close
,
A J Murray Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK

Search for other papers by A J Murray in
Google Scholar
PubMed Close
, and
A L Fowden Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK

Search for other papers by A L Fowden in
Google Scholar
PubMed Close

figure is available at https://doi.org/10.1530/JOE-21-0171 . Figure 5 Mean (± s.e.m. ) relative gene expression of UCP2 (panels A and B), UCP3 (panels C and D), and ANT1 (panels E and F) and of ANT1 protein abundance (panels G and H

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-21-0171
Volume/Issue:
Volume 251: Issue 1
Open access
M E Cleasby Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK
Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK

Search for other papers by M E Cleasby in
Google Scholar
PubMed Close
,
Q Lau Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK

Search for other papers by Q Lau in
Google Scholar
PubMed Close
,
E Polkinghorne Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK

Search for other papers by E Polkinghorne in
Google Scholar
PubMed Close
,
S A Patel Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK

Search for other papers by S A Patel in
Google Scholar
PubMed Close
,
S J Leslie Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK

Search for other papers by S J Leslie in
Google Scholar
PubMed Close
,
N Turner Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK
Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK

Search for other papers by N Turner in
Google Scholar
PubMed Close
,
G J Cooney Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK
Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK

Search for other papers by G J Cooney in
Google Scholar
PubMed Close
,
A Xu Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK

Search for other papers by A Xu in
Google Scholar
PubMed Close
, and
E W Kraegen Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK
Department of Veterinary Basic Sciences, Diabetes and Obesity Research Program, Faculty of Medicine, Department of Medicine, Faculty of Medicine, Royal Veterinary College, University of London, Royal College Street, London NW1 0TU, UK

Search for other papers by E W Kraegen in
Google Scholar
PubMed Close

). The APPL2 antibody was from Abnova (Heidelberg, Germany), pY608-IRS1 antibody was from Biosource International (Camarillo, CA, USA), uncoupling protein (UCP) 3 antibody from Thermo Scientific (Rockford, IL, USA), total IRS1 and anti

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-11-0039
Volume/Issue:
Volume 210: Issue 1
Open access
View license
T V Novoselova Centre for Endocrinology, Queen Mary University of London, William Harvey Research Institute, Barts and the London School of Medicine and Dentistry, Charterhouse Square, London, UK

Search for other papers by T V Novoselova in
Google Scholar
PubMed Close
,
R Larder University of Cambridge Metabolic Research Laboratories, MRC Metabolic Disease Unit, Wellcome Trust-MRC Institute of Metabolic Science and NIHR Cambridge Biomedical Research Centre, Addenbrooke’s Hospital, Cambridge, UK

Search for other papers by R Larder in
Google Scholar
PubMed Close
,
D Rimmington University of Cambridge Metabolic Research Laboratories, MRC Metabolic Disease Unit, Wellcome Trust-MRC Institute of Metabolic Science and NIHR Cambridge Biomedical Research Centre, Addenbrooke’s Hospital, Cambridge, UK

Search for other papers by D Rimmington in
Google Scholar
PubMed Close
,
C Lelliott Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK

Search for other papers by C Lelliott in
Google Scholar
PubMed Close
,
E H Wynn Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK

Search for other papers by E H Wynn in
Google Scholar
PubMed Close
,
R J Gorrigan Centre for Endocrinology, Queen Mary University of London, William Harvey Research Institute, Barts and the London School of Medicine and Dentistry, Charterhouse Square, London, UK

Search for other papers by R J Gorrigan in
Google Scholar
PubMed Close
,
P H Tate Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK

Search for other papers by P H Tate in
Google Scholar
PubMed Close
,
L Guasti Centre for Endocrinology, Queen Mary University of London, William Harvey Research Institute, Barts and the London School of Medicine and Dentistry, Charterhouse Square, London, UK

Search for other papers by L Guasti in
Google Scholar
PubMed Close
,
The Sanger Mouse Genetics Project Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK

Search for other papers by The Sanger Mouse Genetics Project in
Google Scholar
PubMed Close
,
S O’Rahilly University of Cambridge Metabolic Research Laboratories, MRC Metabolic Disease Unit, Wellcome Trust-MRC Institute of Metabolic Science and NIHR Cambridge Biomedical Research Centre, Addenbrooke’s Hospital, Cambridge, UK

Search for other papers by S O’Rahilly in
Google Scholar
PubMed Close
,
A J L Clark Centre for Endocrinology, Queen Mary University of London, William Harvey Research Institute, Barts and the London School of Medicine and Dentistry, Charterhouse Square, London, UK

Search for other papers by A J L Clark in
Google Scholar
PubMed Close
,
D W Logan Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK

Search for other papers by D W Logan in
Google Scholar
PubMed Close
,
A P Coll University of Cambridge Metabolic Research Laboratories, MRC Metabolic Disease Unit, Wellcome Trust-MRC Institute of Metabolic Science and NIHR Cambridge Biomedical Research Centre, Addenbrooke’s Hospital, Cambridge, UK

Search for other papers by A P Coll in
Google Scholar
PubMed Close
, and
L F Chan Centre for Endocrinology, Queen Mary University of London, William Harvey Research Institute, Barts and the London School of Medicine and Dentistry, Charterhouse Square, London, UK

Search for other papers by L F Chan in
Google Scholar
PubMed Close

according to standard protocols. Ucp1 immunohistochemistry was carried out using brown fat paraffin sections anti- Ucp1 antibody (1/500) according to the manufacturer’s instructions (ab10983, Abcam) followed by detection using anti-rabbit HRP antibody

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-16-0057
Volume/Issue:
Volume 230: Issue 1
Open access
David M Golding School of Biosciences, Cardiff University, Cardiff, UK

Search for other papers by David M Golding in
Google Scholar
PubMed Close
,
Daniel J Rees Institute of Life Sciences, College of Medicine, Swansea University, Swansea, UK

Search for other papers by Daniel J Rees in
Google Scholar
PubMed Close
,
Jennifer R Davies Behavioural Genetics Group, MRC Centre for Neuropsychiatric Genetics and Genomics, Neuroscience and Mental Health Research Institute, Schools of Medicine & Psychology, Cardiff University, Cardiff, UK

Search for other papers by Jennifer R Davies in
Google Scholar
PubMed Close
,
Dinko Relkovic Behavioural Genetics Group, MRC Centre for Neuropsychiatric Genetics and Genomics, Neuroscience and Mental Health Research Institute, Schools of Medicine & Psychology, Cardiff University, Cardiff, UK

Search for other papers by Dinko Relkovic in
Google Scholar
PubMed Close
,
Hannah V Furby Behavioural Genetics Group, MRC Centre for Neuropsychiatric Genetics and Genomics, Neuroscience and Mental Health Research Institute, Schools of Medicine & Psychology, Cardiff University, Cardiff, UK

Search for other papers by Hannah V Furby in
Google Scholar
PubMed Close
,
Irina A Guschina School of Biosciences, Cardiff University, Cardiff, UK

Search for other papers by Irina A Guschina in
Google Scholar
PubMed Close
,
Anna L Hopkins School of Biosciences, Cardiff University, Cardiff, UK

Search for other papers by Anna L Hopkins in
Google Scholar
PubMed Close
,
Jeffrey S Davies Institute of Life Sciences, College of Medicine, Swansea University, Swansea, UK

Search for other papers by Jeffrey S Davies in
Google Scholar
PubMed Close
,
James L Resnick Center for Mammalian Genetics, University of Florida, College of Medicine, Gainesville, Florida, USA

Search for other papers by James L Resnick in
Google Scholar
PubMed Close
,
Anthony R Isles Behavioural Genetics Group, MRC Centre for Neuropsychiatric Genetics and Genomics, Neuroscience and Mental Health Research Institute, Schools of Medicine & Psychology, Cardiff University, Cardiff, UK

Search for other papers by Anthony R Isles in
Google Scholar
PubMed Close
, and
Timothy Wells School of Biosciences, Cardiff University, Cardiff, UK

Search for other papers by Timothy Wells in
Google Scholar
PubMed Close

data being expressed as %-‘beiging’ of total field. Uncoupling protein-1 (Ucp-1) mRNA expression in isBAT and inguinal WAT was quantified as previously described ( Wells et al . 2012 ). In brief, total RNA from lysed tissue was purified using the

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-16-0367
Volume/Issue:
Volume 232: Issue 1
Open access
T’ng Choong Kwok University/BHF Centre for Cardiovascular Science, University of Edinburgh, Queen’s Medical Research Institute, Edinburgh, United Kingdom

Search for other papers by T’ng Choong Kwok in
Google Scholar
PubMed Close
and
Roland H Stimson University/BHF Centre for Cardiovascular Science, University of Edinburgh, Queen’s Medical Research Institute, Edinburgh, United Kingdom

Search for other papers by Roland H Stimson in
Google Scholar
PubMed Close

fatty acids, which subsequently activate a specialised thermogenic protein known as uncoupling protein 1 (UCP1) ( Cannon & Nedergaard 2004 ). UCP1 is located on the inner mitochondrial membrane and generates heat by uncoupling oxidative phosphorylation

Article Type:
Review Article
DOI:
https://doi.org/10.1530/JOE-23-0017
Volume/Issue:
Volume 259: Issue 1
Open access
Kevin J P Ryan Division of Nutritional Sciences, School of Biosciences, University of Nottingham, Loughborough, Leics LE12 5RD, UK

Search for other papers by Kevin J P Ryan in
Google Scholar
PubMed Close
,
Zoe C T R Daniel Division of Nutritional Sciences, School of Biosciences, University of Nottingham, Loughborough, Leics LE12 5RD, UK

Search for other papers by Zoe C T R Daniel in
Google Scholar
PubMed Close
,
Lucinda J L Craggs Division of Nutritional Sciences, School of Biosciences, University of Nottingham, Loughborough, Leics LE12 5RD, UK

Search for other papers by Lucinda J L Craggs in
Google Scholar
PubMed Close
,
Tim Parr Division of Nutritional Sciences, School of Biosciences, University of Nottingham, Loughborough, Leics LE12 5RD, UK

Search for other papers by Tim Parr in
Google Scholar
PubMed Close
, and
John M Brameld Division of Nutritional Sciences, School of Biosciences, University of Nottingham, Loughborough, Leics LE12 5RD, UK

Search for other papers by John M Brameld in
Google Scholar
PubMed Close

quantitative real-time PCR analysis. Primer sequences for PPARγ1, PPARγ2 and UCP1 were obtained from Kajimura et al . (2009) Gene Primer sequence (5′–3′) MyoD Forward: CGTGGCAGCGAGCACTAC Reverse: TGTAATCCATCATGCCATCAGA Creatine kinase Forward

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-12-0234
Volume/Issue:
Volume 217: Issue 1
Open access
View license