Filter

Refine by date

—

Refine by collections

Refine by access

  • Print
  • Save

Search Results

You are looking at 11 - 20 of 138 items for :

  • Refine by access: Content accessible to me x
Clear All
Patricia Joseph-Bravo Departamento de Genética del Desarrollo y Fisiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México (UNAM), A.P. 510-3, Cuernavaca, Morelos 62250, Mexico

Search for other papers by Patricia Joseph-Bravo in
Google Scholar
PubMed Close
,
Lorraine Jaimes-Hoy Departamento de Genética del Desarrollo y Fisiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México (UNAM), A.P. 510-3, Cuernavaca, Morelos 62250, Mexico

Search for other papers by Lorraine Jaimes-Hoy in
Google Scholar
PubMed Close
,
Rosa-María Uribe Departamento de Genética del Desarrollo y Fisiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México (UNAM), A.P. 510-3, Cuernavaca, Morelos 62250, Mexico

Search for other papers by Rosa-María Uribe in
Google Scholar
PubMed Close
, and
Jean-Louis Charli Departamento de Genética del Desarrollo y Fisiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México (UNAM), A.P. 510-3, Cuernavaca, Morelos 62250, Mexico

Search for other papers by Jean-Louis Charli in
Google Scholar
PubMed Close

correct Figure 2 is published in full below: Figure 2 Elements involved in HPT regulation. At the level of the paraventricular hypothalamic nucleus (PVN), Trh mRNA is transcribed, its expression is regulated by multiple effectors, processed TRH is

Article Type:
Correction
DOI:
https://doi.org/10.1530/JOE-15-0124e
Volume/Issue:
Volume 227: Issue 3
Free access
Kristien Vandenborne Laboratory of Comparative Endocrinology, Zoological Institute, K U Leuven, Naamsestraat 61, B-3000 Leuven, Belgium

Search for other papers by Kristien Vandenborne in
Google Scholar
PubMed Close
,
Simon A Roelens Laboratory of Comparative Endocrinology, Zoological Institute, K U Leuven, Naamsestraat 61, B-3000 Leuven, Belgium

Search for other papers by Simon A Roelens in
Google Scholar
PubMed Close
,
Veerle M Darras Laboratory of Comparative Endocrinology, Zoological Institute, K U Leuven, Naamsestraat 61, B-3000 Leuven, Belgium

Search for other papers by Veerle M Darras in
Google Scholar
PubMed Close
,
Eduard R Kühn Laboratory of Comparative Endocrinology, Zoological Institute, K U Leuven, Naamsestraat 61, B-3000 Leuven, Belgium

Search for other papers by Eduard R Kühn in
Google Scholar
PubMed Close
, and
Serge Van der Geyten Laboratory of Comparative Endocrinology, Zoological Institute, K U Leuven, Naamsestraat 61, B-3000 Leuven, Belgium

Search for other papers by Serge Van der Geyten in
Google Scholar
PubMed Close

Introduction Thyrotropin-releasing hormone (TRH) is a neuroactive tripeptide ( l -pyroglutamyl- l -histidyl- l -prolinamide; pGlu-His-ProNH 2 ), that was originally isolated from porcine and ovine hypothalami as a first

Article Type:
Research Article
DOI:
https://doi.org/10.1677/joe.1.06161
Volume/Issue:
Volume 186: Issue 2
Free access
P C Lisboa Laboratory of Endocrine Physiology, Laboratory of Neurophysiology, Carlos Chagas Filho Biophysic Institute, Biology Institute, State University of Rio de Janeiro, Rio de Janeiro 20551‐030, Brazil

Search for other papers by P C Lisboa in
Google Scholar
PubMed Close
,
E de Oliveira Laboratory of Endocrine Physiology, Laboratory of Neurophysiology, Carlos Chagas Filho Biophysic Institute, Biology Institute, State University of Rio de Janeiro, Rio de Janeiro 20551‐030, Brazil

Search for other papers by E de Oliveira in
Google Scholar
PubMed Close
,
A C Manhães Laboratory of Endocrine Physiology, Laboratory of Neurophysiology, Carlos Chagas Filho Biophysic Institute, Biology Institute, State University of Rio de Janeiro, Rio de Janeiro 20551‐030, Brazil

Search for other papers by A C Manhães in
Google Scholar
PubMed Close
,
A P Santos-Silva Laboratory of Endocrine Physiology, Laboratory of Neurophysiology, Carlos Chagas Filho Biophysic Institute, Biology Institute, State University of Rio de Janeiro, Rio de Janeiro 20551‐030, Brazil

Search for other papers by A P Santos-Silva in
Google Scholar
PubMed Close
,
C R Pinheiro Laboratory of Endocrine Physiology, Laboratory of Neurophysiology, Carlos Chagas Filho Biophysic Institute, Biology Institute, State University of Rio de Janeiro, Rio de Janeiro 20551‐030, Brazil

Search for other papers by C R Pinheiro in
Google Scholar
PubMed Close
,
V Younes-Rapozo Laboratory of Endocrine Physiology, Laboratory of Neurophysiology, Carlos Chagas Filho Biophysic Institute, Biology Institute, State University of Rio de Janeiro, Rio de Janeiro 20551‐030, Brazil
Laboratory of Endocrine Physiology, Laboratory of Neurophysiology, Carlos Chagas Filho Biophysic Institute, Biology Institute, State University of Rio de Janeiro, Rio de Janeiro 20551‐030, Brazil

Search for other papers by V Younes-Rapozo in
Google Scholar
PubMed Close
,
L C Faustino Laboratory of Endocrine Physiology, Laboratory of Neurophysiology, Carlos Chagas Filho Biophysic Institute, Biology Institute, State University of Rio de Janeiro, Rio de Janeiro 20551‐030, Brazil

Search for other papers by L C Faustino in
Google Scholar
PubMed Close
,
T M Ortiga-Carvalho Laboratory of Endocrine Physiology, Laboratory of Neurophysiology, Carlos Chagas Filho Biophysic Institute, Biology Institute, State University of Rio de Janeiro, Rio de Janeiro 20551‐030, Brazil

Search for other papers by T M Ortiga-Carvalho in
Google Scholar
PubMed Close
, and
E G Moura Laboratory of Endocrine Physiology, Laboratory of Neurophysiology, Carlos Chagas Filho Biophysic Institute, Biology Institute, State University of Rio de Janeiro, Rio de Janeiro 20551‐030, Brazil

Search for other papers by E G Moura in
Google Scholar
PubMed Close

(TRH) and TSH immunostaining, the in vivo TSH content of the pituitary gland, and in vitro TSH secretion after TRH stimulation in adult rats that had been nicotine-exposed in postnatal life. To our knowledge, no study has been specifically designed

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-14-0473
Volume/Issue:
Volume 224: Issue 3
Free access
Bert De Groef Laboratory of Comparative Endocrinology, K.U. Leuven, Naamsestraat 61, B3000 Leuven, Belgium

Search for other papers by Bert De Groef in
Google Scholar
PubMed Close
,
Sylvia V H Grommen Laboratory of Comparative Endocrinology, K.U. Leuven, Naamsestraat 61, B3000 Leuven, Belgium

Search for other papers by Sylvia V H Grommen in
Google Scholar
PubMed Close
, and
Veerle M Darras Laboratory of Comparative Endocrinology, K.U. Leuven, Naamsestraat 61, B3000 Leuven, Belgium

Search for other papers by Veerle M Darras in
Google Scholar
PubMed Close

) and thyrotrophin-releasing hormone (TRH) respectively, coupled with increased thyroid size, is responsible for the changes in T 4 secretion ( Scanes et al. 1987 ). However, TRH is not the only factor controlling TSH secretion in birds

Article Type:
Research Article
DOI:
https://doi.org/10.1677/joe.1.06492
Volume/Issue:
Volume 189: Issue 2
Free access
C García-Luna Department of Neurosciences Research, Molecular Neurophysiology Laboratory, National Institute of Psychiatry Ramón de la Fuente Muñiz, Mexico City, Mexico

Search for other papers by C García-Luna in
Google Scholar
PubMed Close
,
P Soberanes-Chávez Department of Neurosciences Research, Molecular Neurophysiology Laboratory, National Institute of Psychiatry Ramón de la Fuente Muñiz, Mexico City, Mexico

Search for other papers by P Soberanes-Chávez in
Google Scholar
PubMed Close
, and
P de Gortari Department of Neurosciences Research, Molecular Neurophysiology Laboratory, National Institute of Psychiatry Ramón de la Fuente Muñiz, Mexico City, Mexico

Search for other papers by P de Gortari in
Google Scholar
PubMed Close

/agouti-related peptide (AgRP)) ones ( Cheung et al. 1997 , Ahima et al. 1999 , Elias et al. 1999 ). Orexigenic and anorexigenic neuron populations from the ARC project to thyrotropin-releasing hormone (TRH)- and corticotrophin-releasing factor (CRF

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-16-0402
Volume/Issue:
Volume 232: Issue 1
Free access
Roger Guillemin Salk Institute for Biological Studies, 10010 N. Torrey Pines Road, La Jolla, California 92037, USA

Search for other papers by Roger Guillemin in
Google Scholar
PubMed Close

, TRH A very comprehensive review on TRH, its overall biology, including its non-hypophysiotropic activities, biosynthesis, and biology of non-TRH fragments from the precursor, was published in 1999 ( Nillni & Sevarino 1999 ). The small

Article Type:
Other
DOI:
https://doi.org/10.1677/joe.1.05883
Volume/Issue:
Volume 184: Issue 1
Free access
Isabela Teixeira Bonomo Departamento de Ciências Fisiológicas - 5o andar, Departamento de Nutrição Aplicada, Departamento de Fisiologia e Biofísica, Instituto de Biologia Roberto Alcântara Gomes

Search for other papers by Isabela Teixeira Bonomo in
Google Scholar
PubMed Close
,
Patrícia Cristina Lisboa Departamento de Ciências Fisiológicas - 5o andar, Departamento de Nutrição Aplicada, Departamento de Fisiologia e Biofísica, Instituto de Biologia Roberto Alcântara Gomes

Search for other papers by Patrícia Cristina Lisboa in
Google Scholar
PubMed Close
,
Magna Cottini Fonseca Passos Departamento de Ciências Fisiológicas - 5o andar, Departamento de Nutrição Aplicada, Departamento de Fisiologia e Biofísica, Instituto de Biologia Roberto Alcântara Gomes

Search for other papers by Magna Cottini Fonseca Passos in
Google Scholar
PubMed Close
,
Simone Bezerra Alves Departamento de Ciências Fisiológicas - 5o andar, Departamento de Nutrição Aplicada, Departamento de Fisiologia e Biofísica, Instituto de Biologia Roberto Alcântara Gomes

Search for other papers by Simone Bezerra Alves in
Google Scholar
PubMed Close
,
Adelina Martha Reis Departamento de Ciências Fisiológicas - 5o andar, Departamento de Nutrição Aplicada, Departamento de Fisiologia e Biofísica, Instituto de Biologia Roberto Alcântara Gomes

Search for other papers by Adelina Martha Reis in
Google Scholar
PubMed Close
, and
Egberto Gaspar de Moura Departamento de Ciências Fisiológicas - 5o andar, Departamento de Nutrição Aplicada, Departamento de Fisiologia e Biofísica, Instituto de Biologia Roberto Alcântara Gomes

Search for other papers by Egberto Gaspar de Moura in
Google Scholar
PubMed Close

-iodinated/h mg of protein. Protein was measured by the method described by Bradford (1976) . In vitro TRH-stimulated TSH release Pituitaries of C and BRO groups were quickly dissected out. The anterior pituitary was separated from the posterior pituitary and

Article Type:
Research Article
DOI:
https://doi.org/10.1677/JOE-07-0505
Volume/Issue:
Volume 198: Issue 2
Free access
Patricia C Lisboa Laboratory of Endocrine Physiology, Department of Physiological Sciences, Roberto Alcantara Gomes Biology Institute, State University of Rio de Janeiro, Avenida 28 de setembro, 87, Rio de Janeiro, RJ 20551‐031, Brazil

Search for other papers by Patricia C Lisboa in
Google Scholar
PubMed Close
,
Ellen P S Conceição Laboratory of Endocrine Physiology, Department of Physiological Sciences, Roberto Alcantara Gomes Biology Institute, State University of Rio de Janeiro, Avenida 28 de setembro, 87, Rio de Janeiro, RJ 20551‐031, Brazil

Search for other papers by Ellen P S Conceição in
Google Scholar
PubMed Close
,
Elaine de Oliveira Laboratory of Endocrine Physiology, Department of Physiological Sciences, Roberto Alcantara Gomes Biology Institute, State University of Rio de Janeiro, Avenida 28 de setembro, 87, Rio de Janeiro, RJ 20551‐031, Brazil

Search for other papers by Elaine de Oliveira in
Google Scholar
PubMed Close
, and
Egberto G Moura Laboratory of Endocrine Physiology, Department of Physiological Sciences, Roberto Alcantara Gomes Biology Institute, State University of Rio de Janeiro, Avenida 28 de setembro, 87, Rio de Janeiro, RJ 20551‐031, Brazil

Search for other papers by Egberto G Moura in
Google Scholar
PubMed Close

understanding regarding the degree of hypothyroidism previously reported in EO animal models. Because circulating thyrotropin (TSH) was unaltered in adult small litter (SL) rats, we evaluated the thyrotropin release hormone (TRH) in the hypothalamus, the TSH in

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-15-0237
Volume/Issue:
Volume 226: Issue 3
Free access
Z Zhang Department of Endocrinology and Metabolism, Academic Medical Center (AMC), University of Amsterdam, Amsterdam, the Netherlands

Search for other papers by Z Zhang in
Google Scholar
PubMed Close
,
P H Bisschop Department of Endocrinology and Metabolism, Academic Medical Center (AMC), University of Amsterdam, Amsterdam, the Netherlands

Search for other papers by P H Bisschop in
Google Scholar
PubMed Close
,
E Foppen Department of Endocrinology and Metabolism, Academic Medical Center (AMC), University of Amsterdam, Amsterdam, the Netherlands

Search for other papers by E Foppen in
Google Scholar
PubMed Close
,
H C van Beeren Department of Endocrinology and Metabolism, Academic Medical Center (AMC), University of Amsterdam, Amsterdam, the Netherlands

Search for other papers by H C van Beeren in
Google Scholar
PubMed Close
,
A Kalsbeek Department of Endocrinology and Metabolism, Academic Medical Center (AMC), University of Amsterdam, Amsterdam, the Netherlands
Hypothalamic Integration Mechanisms, Netherlands Institute for Neuroscience (NIN), Amsterdam, Amsterdam, the Netherlands

Search for other papers by A Kalsbeek in
Google Scholar
PubMed Close
,
A Boelen Department of Endocrinology and Metabolism, Academic Medical Center (AMC), University of Amsterdam, Amsterdam, the Netherlands

Search for other papers by A Boelen in
Google Scholar
PubMed Close
, and
E Fliers Department of Endocrinology and Metabolism, Academic Medical Center (AMC), University of Amsterdam, Amsterdam, the Netherlands

Search for other papers by E Fliers in
Google Scholar
PubMed Close

GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCAA 84 Thyrotropin releasing hormone, prepropeptide Trh TCTGCAGAGTCTCCACTTCG AGAGCCAGCAGCAACCAA 59 Deiodinase type 3 Dio3 AGCGCAGCAAGAGTACTTCAG CCATCGTGTCCAGAACCAG 61 Hairless Hr

Article Type:
Research Article
DOI:
https://doi.org/10.1530/JOE-15-0501
Volume/Issue:
Volume 229: Issue 1
Free access
Alicia J Klecha Centro de Estudios Farmacológicos y Botánicos (CEFYBO), CONICET, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, piso 15, Primera Cátedra de Farmacología, 1121 Buenos Aires, Argentina
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina

Search for other papers by Alicia J Klecha in
Google Scholar
PubMed Close
,
Ana M Genaro Centro de Estudios Farmacológicos y Botánicos (CEFYBO), CONICET, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, piso 15, Primera Cátedra de Farmacología, 1121 Buenos Aires, Argentina
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina

Search for other papers by Ana M Genaro in
Google Scholar
PubMed Close
,
Gabriela Gorelik Centro de Estudios Farmacológicos y Botánicos (CEFYBO), CONICET, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, piso 15, Primera Cátedra de Farmacología, 1121 Buenos Aires, Argentina
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina

Search for other papers by Gabriela Gorelik in
Google Scholar
PubMed Close
,
María Laura Barreiro Arcos Centro de Estudios Farmacológicos y Botánicos (CEFYBO), CONICET, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, piso 15, Primera Cátedra de Farmacología, 1121 Buenos Aires, Argentina
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina

Search for other papers by María Laura Barreiro Arcos in
Google Scholar
PubMed Close
,
Dafne Magalí Silberman Centro de Estudios Farmacológicos y Botánicos (CEFYBO), CONICET, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, piso 15, Primera Cátedra de Farmacología, 1121 Buenos Aires, Argentina
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina

Search for other papers by Dafne Magalí Silberman in
Google Scholar
PubMed Close
,
Mariano Schuman Centro de Estudios Farmacológicos y Botánicos (CEFYBO), CONICET, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, piso 15, Primera Cátedra de Farmacología, 1121 Buenos Aires, Argentina
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina

Search for other papers by Mariano Schuman in
Google Scholar
PubMed Close
,
Silvia I Garcia Centro de Estudios Farmacológicos y Botánicos (CEFYBO), CONICET, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, piso 15, Primera Cátedra de Farmacología, 1121 Buenos Aires, Argentina
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina

Search for other papers by Silvia I Garcia in
Google Scholar
PubMed Close
,
Carlos Pirola Centro de Estudios Farmacológicos y Botánicos (CEFYBO), CONICET, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, piso 15, Primera Cátedra de Farmacología, 1121 Buenos Aires, Argentina
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina

Search for other papers by Carlos Pirola in
Google Scholar
PubMed Close
, and
Graciela A Cremaschi Centro de Estudios Farmacológicos y Botánicos (CEFYBO), CONICET, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, piso 15, Primera Cátedra de Farmacología, 1121 Buenos Aires, Argentina
Laboratorio de Radioisótopos, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Junin 956, 1113 Buenos Aires, Argentina
Instituto de Investigaciones Médicas Alfredo Lanari, Facultad de Medicina, Universidad de Buenos Aires, AV. Combatients de Malvinas 3105, 1427 Buenos Aires, Argentina

Search for other papers by Graciela A Cremaschi in
Google Scholar
PubMed Close

standards (reagents kindly provided by Dr A F Parlow from the National Hormone and Peptide Program, Bethesda, MD, USA). Hypothalamic TSH-releasing hormone (TRH) was determined by RIA as described elsewhere ( García et al. 1992 ). Briefly, animals were

Article Type:
Research Article
DOI:
https://doi.org/10.1677/joe.1.06137
Volume/Issue:
Volume 189: Issue 1
Free access