Search Results

You are looking at 91 - 100 of 260 items for :

  • "leptin receptor" x
Clear All
Free access

M G Bilbao, M P Di Yorio and A G Faletti

increase in MMP activity but inhibits progesterone and other mediators, as described previously ( Ricci et al . 2006 ). However, both effects are simultaneous with an increase in the expression of the ovarian leptin receptors ( Di Yorio et al . 2008

Free access

Piya Sen Gupta, Natalia V Prodromou and J Paul Chapple

lost from the POMC expressing neurons in the knockout mice, leading the authors to conclude neuronal cilia function in a pathway regulating the satiety response ( Davenport et al . 2007 ). Leptin receptor signaling is impaired in BBS Rahmouni et al

Free access

Candida N Perera, Hwei G Chin, Nadire Duru and Ignacio G Camarillo

concentrations of leptin are elevated during late pregnancy, a time of intense increase in mammary epithelial growth and proliferation ( Henson & Castracane 2000 ). It has been reported that in normal mammary tissues, epithelial leptin receptor expression

Free access

Russell T Turner, Kenneth A Philbrick, Carmen P Wong, Dawn A Olson, Adam J Branscum and Urszula T Iwaniec

inability to generate leptin ( ob/ob mice) or the signaling form of the leptin receptor ( db/db mice and fa/fa rats), become morbidly obese ( Clement 2000 ). Their excess weight is the result of a combination of hyperphagia and reduced thermogenesis

Free access

Simon J Dunmore and James E P Brown

some of the conflicting reports. This type of response is also consistent with the cytokine receptor-like nature of the leptin receptor and signalling cascade. We also demonstrated that leptin decreased uncoupling protein 2 ( UCP2 ) expression in these

Free access

Xiaonan Yan, Chun Yuan, Nannan Zhao, Yugui Cui and Jiayin Liu

neurons in the hypothalamic ARC of pubertal female rats coexpress the leptin receptor. The 6-week-old PNA ( n =6) and control rats ( n =6) were anesthetized and perfused with ice-cold normal saline, followed by 4% paraformaldehyde for brain collection

Full access

Erin Faught and Mathilakath M Vijayan

product Forward (5′–3′) Reverse (5′–3′) Source lepr Leptin receptor GGTCTCACTGCCTGTCCATT AGATGGTGCTGCTCCACT Liu et al. 2010 lepa Leptin TCGTCAGAATCAGGGAACAC CCCAATGATGAGCGTTGGA Liu et al. 2012 mstnb

Free access

Charlotte Benoit, Hassina Ould-Hamouda, Delphine Crepin, Arieh Gertler, Laurence Amar and Mohammed Taouis

prepared from RLA ( Salomon et al . 2006 ) by monopegylation according to the protocol described by Elinav et al . (2009) for leptin antagonists. It is specific for leptin receptor only and binds to leptin receptors from all mammalian species. Though

Free access

A Boelen, J Kwakkel, X G Vos, W M Wiersinga and E Fliers

metabolism during fasting. The anterior pituitary expresses both leptin and leptin receptors in TSH-producing cells ( Jin et al. 2000 ). Furthermore, incubation of rat pituitary cells with leptin results in an increase of TSHβ mRNA expression ( Chowdhury

Free access

Tracy Josephs, Hayley Waugh, Ilona Kokay, David Grattan and Mary Thompson

& Bell GI 1997 Increase in serum leptin and uterine leptin receptor messenger RNA levels during pregnancy in rats. Biochemical and Biophysical Research Communications 237 476 –480. Chen MP , Chung FM, Chang