Search Results

You are looking at 101 - 110 of 198 items for :

Clear All
Free access

Kely de Picoli Souza, Francemilson Goulart da Silva and Maria Tereza Nunes

thyroid-releasing hormone (TRH) and thyroid-stimulating hormone (TSH) secretion control is being established ( Pracyk et al. 1992 ), the expression of different thyroid hormone receptor (TR) isoforms and the activity of different types of deiodinases in

Free access

Arturo Hernandez and M Elena Martinez

the type 1 and type 2 deiodinases (DIO1 and DIO2, respectively), and their action may modify local T3 availability as well as contribute to circulating levels of TH ( St Germain et al . 2009 ). Finally, the type 3 deiodinase (DIO3) converts both T3

Free access

Bert De Groef, Sylvia V H Grommen and Veerle M Darras

iodothyronine deiodinases, TH transporters, TH receptors and cofactors. To summarize, using a real-time PCR approach, combined with in situ hybridization, we have shown that the expression of receptors for hypothalamic factors by the thyrotropes

Free access

K L Franko, D A Giussani, A J Forhead and A L Fowden

that there are differences in the sensitivity of the hypothalamic-pituitary–thyroid axis and/or the peripheral deiodinases to glucocorticoids between fetal and adult animals and with changes in sex steroid concentrations in the adult ( Ahlquist et al

Free access

Victoria Diedrich, Elena Haugg, Carola Dreier and Annika Herwig

determined by the activity of three enzymes catalyzing outer ring deiodination (deiodinase type 1 and 2) or inner ring deiodination (deiodinase type 1 and 3) and thereby activate or deactivate thyroid hormone, respectively. The active T3 is well known as a

Free access

J C Sousa, G Morreale de Escobar, P Oliveira, M J Saraiva and J A Palha

deiodination of T 4 by deiodinases, interacts with nuclear receptors that bind to response elements in target genes ( Ribeiro et al. 1995 ). Deiodinase enzymes are, therefore, important modulators of thyroid hormone action, and respond (both at the mRNA and

Free access

A Santillo, L Burrone, S Falvo, R Senese, A Lanni and G Chieffi Baccari

protein with a function that is related to lipid metabolism ( Cioffi et al . 2009 ). The presence of type II thyroxine 5′-deiodinase (5′D), an enzyme that converts thyroxine to T 3 , in both rat and hamster HGs provided further evidence that this gland is

Free access

Ken K Y Ho

regulators of deiodinase, aromatase, 11ß-hydroxysteroid dehydrogenase (HSD) and 5α-reductase activities will emerge. Cardiac function in the severe hypothyroid patient with coronary artery disease will be protected by cardiac-specific 3′-deiodinase inhibitors

Free access

Leena Rastogi, Sushil Gupta and Madan M Godbole

circulating biogenic amines, including glutamic acid in thyrotoxic patients ( Upadhyaya et al . 1992 ). The increased availability of 3,5,3′-triiodothyronines (T 3 ) is central to the plausible release of biogenic amines. Type 2,5′-deiodinase (5′-D2), which

Free access

Z Zhang, P H Bisschop, E Foppen, H C van Beeren, A Kalsbeek, A Boelen and E Fliers

GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCAA 84 Thyrotropin releasing hormone, prepropeptide Trh TCTGCAGAGTCTCCACTTCG AGAGCCAGCAGCAACCAA 59 Deiodinase type 3 Dio3 AGCGCAGCAAGAGTACTTCAG CCATCGTGTCCAGAACCAG 61 Hairless Hr