Search Results

You are looking at 111 - 120 of 334 items for :

Clear All
Open access

Colin P Sibley

). In pre-eclampsia, it is proposed that hypoxia and/or ischaemia-reperfusion lead to the release of free radicals and inflammatory mediators causing cellular stress in the syncytiotrophoblast (the placental epithelium) ( Powe et al . 2011 , Burton et

Free access

Natasha N Chattergoon

evidence that fetal stressors, including poor nutrition and hypoxia, lead to detrimental changes in the heart and its blood vessels and elevated disease risk for life. The capacity of cardiomyocytes to proliferate over the life course has been

Free access

Charlotte Lawson, Jose M Vicencio, Derek M Yellon and Sean M Davidson

contribute to hypoxia-induced pulmonary hypertension. Here, the beneficial effect of mesenchymal stromal cells was shown to be mediated by the release of exosomes which suppressed hyperproliferative pathways including those mediated by STAT3 and the miR-17

Free access

Siobhan M Donnelly, Bao Tran Nguyen, Scott Rhyne, Jordan Estes, Subrina Jesmin and Chishimba Nathan Mowa

signal transduction ( Ito et al . 1995 ). Other conditions that may induce expression of VEGF in the brain, which in turn induces cerebrovascular permeability, include hypoxia and ischemic brain injuries ( Van Bruggen et al . 1999 ). The exact role of

Free access

Sonnet S Jonker, Daniel Kamna, Dan LoTurco, Jenai Kailey and Laura D Brown

expression of hypoxia-responsive genes . Journal of the American Heart Association 3 e000531 . ( https://doi.org/10.1161/JAHA.113.000531 ) 25085511 Botting KJ Loke XY Zhang S Andersen JB Nyengaard JR Morrison JL 2018 IUGR decreases cardiomyocyte

Free access

Alpana Mathur, Vivek Kumar Pandey and Poonam Kakkar

nephropathy. Hypoxia (during carcinoma) is associated with decreased PHLPP expression ( Wen et al . 2013 ). It mediates HIF1α-dependent tumorigenesis in colon cancer cells. Studies are required to assess this mechanism during diabetic hypoxic conditions

Free access

Laura E Pascal, Khalid Z Masoodi, June Liu, Xiaonan Qiu, Qiong Song, Yujuan Wang, Yachen Zang, Tiejun Yang, Yao Wang, Lora H Rigatti, Uma Chandran, Leandro M Colli, Ricardo Z N Vencio, Yi Lu, Jian Zhang and Zhou Wang

CTGCACTATGTGACGGAGCTA GAGTCCACACAAAGGTTGGAAA Mouse HIF1A Hypoxia inducible factor 1 alpha subunit ACCTTCATCGGAAACTCCAAAG CTGTTAGGCTGGGAAAAGTTAGG Mouse MUC4 Mucin 4, cell surface associated GGAACTTGGAGTATCCTGTTG CCTCCTCTTGCTACCTGATGC Mouse

Free access

J-W Jeong, K Y Lee, J P Lydon and F J DeMayo

), calbindin-D9K ( Nie et al. 2000 ), Indian hedgehog ( Ihh ) ( Takamoto et al. 2002 ), hypoxia-inducible factor 1 ( Hif1a ; Daikoku et al. 2003 ) and immune-responsive gene 1 ( Irg1 ) ( Cheon et al. 2003 ). These target genes have been identified by

Free access

Hitesh Soni and Adebowale Adebiyi

improving regional hypoxia . Experimental Nephrology 3 331 – 337 . Hook JB Bailie MD 1979 Perinatal renal pharmacology . Annual Review of Pharmacology and Toxicology 19 491 – 509 . ( doi:10.1146/annurev.pa.19.040179.002423 ) Igbe I

Free access

Masahiro Ogawa, Tomoya Kitakaze, Naoki Harada and Ryoichi Yamaji

Inui H Nakano Y 2011 Kelch-like 20 up-regulates the expression of hypoxia-inducible factor-2α through hypoxia- and von Hippel-Lindau tumor suppressor protein-independent regulatory mechanisms . Biochemical and Biophysical Research