Search Results

You are looking at 111 - 120 of 334 items for :

Clear All
Free access

Emmely M de Vries, Eric Fliers and Anita Boelen

. 2007 ). It was postulated that the increase in D3 in peripheral organs might be regulated by hypoxia due to decreased tissue perfusion during illness ( Peeters et al . 2003 ), and this assumption is supported by the observation that both D3 and hypoxia

Free access

Alice S Green, Paul J Rozance and Sean W Limesand

insulin release ( Cheung 1990 , Milley 1997 , Jackson et al . 2000 ). In human fetuses, norepinephrine concentrations are also increased during hypoxia and are higher in IUGR fetuses ( Paulick et al . 1985 , Greenough et al . 1990 ). We have shown

Free access

Natasha N Chattergoon

evidence that fetal stressors, including poor nutrition and hypoxia, lead to detrimental changes in the heart and its blood vessels and elevated disease risk for life. The capacity of cardiomyocytes to proliferate over the life course has been

Free access

Siobhan M Donnelly, Bao Tran Nguyen, Scott Rhyne, Jordan Estes, Subrina Jesmin and Chishimba Nathan Mowa

signal transduction ( Ito et al . 1995 ). Other conditions that may induce expression of VEGF in the brain, which in turn induces cerebrovascular permeability, include hypoxia and ischemic brain injuries ( Van Bruggen et al . 1999 ). The exact role of

Free access

Laura E Pascal, Khalid Z Masoodi, June Liu, Xiaonan Qiu, Qiong Song, Yujuan Wang, Yachen Zang, Tiejun Yang, Yao Wang, Lora H Rigatti, Uma Chandran, Leandro M Colli, Ricardo Z N Vencio, Yi Lu, Jian Zhang and Zhou Wang

CTGCACTATGTGACGGAGCTA GAGTCCACACAAAGGTTGGAAA Mouse HIF1A Hypoxia inducible factor 1 alpha subunit ACCTTCATCGGAAACTCCAAAG CTGTTAGGCTGGGAAAAGTTAGG Mouse MUC4 Mucin 4, cell surface associated GGAACTTGGAGTATCCTGTTG CCTCCTCTTGCTACCTGATGC Mouse

Free access

Alpana Mathur, Vivek Kumar Pandey and Poonam Kakkar

nephropathy. Hypoxia (during carcinoma) is associated with decreased PHLPP expression ( Wen et al . 2013 ). It mediates HIF1α-dependent tumorigenesis in colon cancer cells. Studies are required to assess this mechanism during diabetic hypoxic conditions

Free access

Sonnet S Jonker, Daniel Kamna, Dan LoTurco, Jenai Kailey and Laura D Brown

expression of hypoxia-responsive genes . Journal of the American Heart Association 3 e000531 . ( https://doi.org/10.1161/JAHA.113.000531 ) 25085511 Botting KJ Loke XY Zhang S Andersen JB Nyengaard JR Morrison JL 2018 IUGR decreases cardiomyocyte

Free access

M A J Hervé, G Meduri, F G Petit, T S Domet, G Lazennec, S Mourah and M Perrot-Applanat

related to the vascular bed type ( Ferrara et al. 2003 ). Factors regulating Flk-1/KDR expression in vivo in endothelial cells are not clearly defined. In tumors, Flk-1/KDR appears to be regulated by hypoxia, an effect probably mediated by VEGF

Free access

J-W Jeong, K Y Lee, J P Lydon and F J DeMayo

), calbindin-D9K ( Nie et al. 2000 ), Indian hedgehog ( Ihh ) ( Takamoto et al. 2002 ), hypoxia-inducible factor 1 ( Hif1a ; Daikoku et al. 2003 ) and immune-responsive gene 1 ( Irg1 ) ( Cheon et al. 2003 ). These target genes have been identified by

Free access

Zhenhua Li, Tao Zhang, Hongyan Dai, Guanghui Liu, Haibin Wang, Yingying Sun, Yun Zhang and Zhiming Ge

+ depletion, ischemia, hypoxia, exposure to free radicals, elevated protein synthesis, hyperhomocysteine, and gene mutation. Several signaling pathways are initiated to cope with ERS, which are designated as the unfolded protein response (UPR; Bernales et al