Search Results

You are looking at 41 - 50 of 199 items for :

Clear All
Free access

S Van der Geyten and V M Darras

activity. This conversion occurs in a wide array of tissues and is catalyzed by a group of selenocysteine-containing oxidoreductases called iodothyronine deiodinases. So far, three types of deiodinases have been identified. The type I deiodinase (D1), which

Free access

Local impact of thyroid hormone inactivation

Deiodinases: the balance of thyroid hormone

Monica Dentice and Domenico Salvatore

Introduction Thyroid hormone action and deiodinases Thyroid hormones (THs) are iodinated compounds known to influence gene expression in virtually every vertebrate cell; they exert this function through ligand-dependent transcription factors, namely

Free access

Flavia F Bloise, Aline Cordeiro and Tania Maria Ortiga-Carvalho

changes in homeostasis ( Ortiga-Carvalho et al . 2016 ). In addition to serum levels, specific tissue concentrations of TH in SM depend on local levels of TH transporters, TH receptors and deiodinase activity ( Boelen et al . 2017 ). Therefore, in this

Free access

Patricia Joseph-Bravo, Lorraine Jaimes-Hoy, Rosa-María Uribe and Jean-Louis Charli

deiodinases ( Escobar del Rey et al . 1961 , Visser et al . 1983 ). The inhibition of T 3 -induced BMR activation in hypothyroid rats by cycloheximide helped to elucidate that the actions of T 3 require protein synthesis ( Tata et al . 1962 ). The

Free access

Geoffrey J Beckett and John R Arthur

. Of the up to 30 selenoproteins that have been characterized or identified bioinformatically (Table 1 ), six are GPXs, three are iodothyronine deiodinases (Ds) and three are thioredoxin reductases (TRs; Kryukov et al. 2003 ). Selenoprotein P is

Free access

Rodrigo Soares Fortunato, Daniele Leão Ignácio, Álvaro Souto Padron, Ramon Peçanha, Michelle Porto Marassi, Doris Rosenthal, João Pedro Saar Werneck-de-Castro and Denise P Carvalho

deiodinated to generate tri-iodothyronine (T 3 ), the most active thyroid hormone ( Maia et al . 1995 , Yen 2001 ). Types I, II, and III iodothyronine deiodinases (D1, D2, and D3 respectively) regulate T 3 production and clearance via removal of specific

Free access

Joëlle Dupont, Sophie Tesseraud, Michel Derouet, Anne Collin, Nicole Rideau, Sabine Crochet, Estelle Godet, Estelle Cailleau-Audouin, Sonia Métayer-Coustard, Michel J Duclos, Christian Gespach, Tom E Porter, Larry A Cogburn and Jean Simon

 THRSPα (spot14) TTCTCGGCCACGCAGAAG AAGACCCCTCGCAGCAGG  PGC1α GGGACCGGTTTGAAGTTTTTG GGCTCGTTTGACCTGCGTAA Endocrine and signaling system  D1-Deiodinase TTTCAGCTTCCAGTATTTGCTCTTT GTCCCTCGTGGGCTTCGT  D2-Deiodinase AGAAGCTCCGAACTCCAGTGTAA CCCCGGCTCCTTCAAAA  D3

Open access

Shona Wood and Andrew Loudon

mammals, GPR50 expression in the brain is concentrated in circum-ventricular hypothalamic areas, adjacent to or overlapping with photoperiodic deiodinase enzyme regulation, and here, it is under strong photoperiodic regulation ( Barrett et al . 2006

Free access

J Patel, K Landers, H Li, R H Mortimer and K Richard

endocrine feedback (the hypothalamic–pituitary–thyroid (HPT) axis and thyroid hormone metabolism by liver and brain deiodinase enzymes (deiodinase type 2 (D2) and deiodinase type 3 (D3)) to ensure basal levels are sustained ( Zoeller et al . 2007

Free access

Maria H Warner and Geoffrey J Beckett

circulating binding proteins, modified entry of thyroid hormone into tissue, changes in thyroid hormone metabolism due to modified expression of the intracellular iodothyronine deiodinases and changes in thyroid hormone receptor (THR) expression or function