Search Results
Search for other papers by L Strauss in
Google Scholar
PubMed
Search for other papers by A Junnila in
Google Scholar
PubMed
Search for other papers by A Wärri in
Google Scholar
PubMed
Search for other papers by M Manti in
Google Scholar
PubMed
Search for other papers by Y Jiang in
Google Scholar
PubMed
Search for other papers by E Löyttyniemi in
Google Scholar
PubMed
Search for other papers by E Stener-Victorin in
Google Scholar
PubMed
Search for other papers by M K Lagerquist in
Google Scholar
PubMed
Search for other papers by K Kukoricza in
Google Scholar
PubMed
Search for other papers by T Heinosalo in
Google Scholar
PubMed
Search for other papers by S Blom in
Google Scholar
PubMed
Sahlgrenska Osteoporosis Centre, Department of Internal Medicine and Clinical Nutrition, Institute of Medicine, University of Gothenburg, Gothenburg, Sweden
Search for other papers by M Poutanen in
Google Scholar
PubMed
Introduction The estrous cycle in female mice, like a menstrual cycle in women, is induced by reproductive hormones whose levels vary greatly during the cycle ( Nilsson et al. 2015 ). Recording the stage of the estrous cycle is an effective
Search for other papers by Gary B Silberstein in
Google Scholar
PubMed
Search for other papers by Katharine Van Horn in
Google Scholar
PubMed
Search for other papers by Eva Hrabeta-Robinson in
Google Scholar
PubMed
Search for other papers by Jennifer Compton in
Google Scholar
PubMed
Introduction The mammalian estrous cycle is an endocrine clock that communicates time through periodic oscillations in the concentration of the ovarian steroids, estrogen and progesterone. In tissues such as the mammary gland and
Human and Animal Physiology Group, Department of Animal Sciences, Wageningen University, Haarweg 10, 6709 PJ Wageningen, The Netherlands
Search for other papers by Karin A Slot in
Google Scholar
PubMed
Human and Animal Physiology Group, Department of Animal Sciences, Wageningen University, Haarweg 10, 6709 PJ Wageningen, The Netherlands
Search for other papers by Marsha Voorendt in
Google Scholar
PubMed
Human and Animal Physiology Group, Department of Animal Sciences, Wageningen University, Haarweg 10, 6709 PJ Wageningen, The Netherlands
Search for other papers by Mieke de Boer-Brouwer in
Google Scholar
PubMed
Human and Animal Physiology Group, Department of Animal Sciences, Wageningen University, Haarweg 10, 6709 PJ Wageningen, The Netherlands
Search for other papers by Harmke H van Vugt in
Google Scholar
PubMed
Human and Animal Physiology Group, Department of Animal Sciences, Wageningen University, Haarweg 10, 6709 PJ Wageningen, The Netherlands
Search for other papers by Katja J Teerds in
Google Scholar
PubMed
puberty, these follicles do not survive beyond the early antral stage. In postpubertal females, however, some early antral follicles may become selected during each estrous cycle and continue growth under the influence of elevated FSH levels ( McGee
Laboratório de Neuroendocrinologia, Faculdade de Odontologia de Ribeirão Preto–Universidade de São Paulo, Ribeirão Preto, Brazil
Laboratório de Neuroendocrinologia do Comportamento, Departamento de Fisiologia da Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil
Laboratory of Endocrinology, Graduate School of Integrated Science, Yokohama City University, Yokohama, Japan
Search for other papers by Cleyde Vanessa Vega Helena in
Google Scholar
PubMed
Laboratório de Neuroendocrinologia, Faculdade de Odontologia de Ribeirão Preto–Universidade de São Paulo, Ribeirão Preto, Brazil
Laboratório de Neuroendocrinologia do Comportamento, Departamento de Fisiologia da Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil
Laboratory of Endocrinology, Graduate School of Integrated Science, Yokohama City University, Yokohama, Japan
Search for other papers by Maristela de Oliveira Poletini in
Google Scholar
PubMed
Laboratório de Neuroendocrinologia, Faculdade de Odontologia de Ribeirão Preto–Universidade de São Paulo, Ribeirão Preto, Brazil
Laboratório de Neuroendocrinologia do Comportamento, Departamento de Fisiologia da Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil
Laboratory of Endocrinology, Graduate School of Integrated Science, Yokohama City University, Yokohama, Japan
Search for other papers by Gilberto Luiz Sanvitto in
Google Scholar
PubMed
Laboratório de Neuroendocrinologia, Faculdade de Odontologia de Ribeirão Preto–Universidade de São Paulo, Ribeirão Preto, Brazil
Laboratório de Neuroendocrinologia do Comportamento, Departamento de Fisiologia da Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil
Laboratory of Endocrinology, Graduate School of Integrated Science, Yokohama City University, Yokohama, Japan
Search for other papers by Shinji Hayashi in
Google Scholar
PubMed
Laboratório de Neuroendocrinologia, Faculdade de Odontologia de Ribeirão Preto–Universidade de São Paulo, Ribeirão Preto, Brazil
Laboratório de Neuroendocrinologia do Comportamento, Departamento de Fisiologia da Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil
Laboratory of Endocrinology, Graduate School of Integrated Science, Yokohama City University, Yokohama, Japan
Search for other papers by Celso Rodrigues Franci in
Google Scholar
PubMed
Laboratório de Neuroendocrinologia, Faculdade de Odontologia de Ribeirão Preto–Universidade de São Paulo, Ribeirão Preto, Brazil
Laboratório de Neuroendocrinologia do Comportamento, Departamento de Fisiologia da Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil
Laboratory of Endocrinology, Graduate School of Integrated Science, Yokohama City University, Yokohama, Japan
Search for other papers by Janete Aparecida Anselmo-Franci in
Google Scholar
PubMed
express αER and PR and whether changes in these expressions occur during the estrous cycle as well as at comparing such pattern to that observed in the POA. Materials and Methods Animals Adult female Wistar rats
Faculty of Medicine, Center for Health Technology and Services Research (CINTESIS), University of Porto, Porto, Portugal
Search for other papers by Susana I Sá in
Google Scholar
PubMed
Search for other papers by Bruno M Fonseca in
Google Scholar
PubMed
demonstrated that ERa expression in the VMNvl is increased on ovariectomy and at proestrus, the stage of the estrous cycle when estradiol and progesterone levels are the highest ( McGinnis et al . 1981 , Lauber et al . 1990 , Shughrue et al . 1992
Departments of Obstetrics and Gynecology, Physiology, Nippon Medical School, 1-1-5 Sendagi, Bunkyo-ku, Tokyo 113-8602, Japan
Search for other papers by Kenichiro Watanabe in
Google Scholar
PubMed
Search for other papers by Takahiro Nemoto in
Google Scholar
PubMed
Search for other papers by Shigeo Akira in
Google Scholar
PubMed
Search for other papers by Toshiyuki Takeshita in
Google Scholar
PubMed
Search for other papers by Tamotsu Shibasaki in
Google Scholar
PubMed
and methods Animals Female Wistar rats were maintained at 23±2 °C on a 12 h light:12 h darkness cycle (lights on at 0800 h, off at 2000 h). They were allowed ad libitum access to laboratory chow and distilled water. Estrous cycle of rats was
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Search for other papers by C Sallon in
Google Scholar
PubMed
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Search for other papers by M O Faure in
Google Scholar
PubMed
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Search for other papers by J Fontaine in
Google Scholar
PubMed
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Centre INRA de Tours, CNRS, Université de Tours, Haras Nationaux, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France
Search for other papers by C Taragnat in
Google Scholar
PubMed
activin receptors since the mRNA for ActR1A (ALK2), ActR1B (ALK4), and ActR2B fluctuates across the estrous cycle ( Fafioffe et al . 2004 ). Whether activin ligands are changing in the pituitary is not known. In order to gain an insight into potential
National Institutes of Health, National Cancer Institute, Laboratory of Metabolism, Bethesda, Maryland, USA
Search for other papers by Maria Konstandi in
Google Scholar
PubMed
Search for other papers by Christina E Andriopoulou in
Google Scholar
PubMed
Search for other papers by Jie Cheng in
Google Scholar
PubMed
Search for other papers by Frank J Gonzalez in
Google Scholar
PubMed
the ovaries and play determinant roles in the division of the murine estrous cycle into four stages, namely proestrous, estrous, methestrous and diestrous. The murine estrous cycle normally lasts 4 to 5 days and E2 levels peak prior to ovulation, as
Search for other papers by Tabata M Bohlen in
Google Scholar
PubMed
Search for other papers by Thais T Zampieri in
Google Scholar
PubMed
Search for other papers by Isadora C Furigo in
Google Scholar
PubMed
Search for other papers by Pryscila D S Teixeira in
Google Scholar
PubMed
Search for other papers by Edward O List in
Google Scholar
PubMed
Search for other papers by John J Kopchick in
Google Scholar
PubMed
Search for other papers by Jose Donato Jr in
Google Scholar
PubMed
Search for other papers by Renata Frazao in
Google Scholar
PubMed
: tgcatgtcacgtttctgtgg; reverse: ccgctccatctctctggaag). Sexual maturation and estrous cycle evaluation Sexual maturation was assessed by recording the age of vaginal opening and the first vaginal cornification in the vaginal lavage (first estrus) occurrence
Search for other papers by A M Reis in
Google Scholar
PubMed
Search for other papers by M Jankowski in
Google Scholar
PubMed
Search for other papers by S Mukaddam-Daher in
Google Scholar
PubMed
Search for other papers by J Tremblay in
Google Scholar
PubMed
Search for other papers by T-V Dam in
Google Scholar
PubMed
Search for other papers by J Gutkowska in
Google Scholar
PubMed
Abstract
Uterine natriuretic peptides may be involved in the alterations that occur in the uterus during the estrous cycle through its role in hydromineral balance. The following studies were performed to determine whether uterine natriuretic peptides and receptors follow a cyclic pattern during the estrous cycle. The results obtained show that atrial natriuretic peptide (ANP) content in rat uterine tissue was low in proestrus (8·5 ± 2·6 pg/g) and significantly increased (P<0·001) in estrus (71·5 ± 16·6 pg/g), metestrus (82·6 ± 19·7 pg/g) and diestrus (91·0 ± 19·4 pg/g), whereas plasma ANP was not altered during the cycle. Similarly, measurement of uterine ANP mRNA by reverse transcribed polymerase chain reaction (RT-PCR) indicated lowest levels of ANP mRNA at proestrus. Measurement of C-type natriuretic peptide (CNP) by a specific and sensitive radioimmunoassay revealed that uterine CNP also varies with the estrous cycle. Uterine CNP was low in diestrus (143·2 ± 22·4 pg/mg protein) as compared with proestrus, estrus and metestrus (305·3 ± 51·5, 267·5 ± 44·9, 291 ± 41·2 pg/mg protein respectively, P<0·05). Autoradiography performed on uterine tissue slices localized natriuretic peptide receptors to myometrial smooth muscle layers and to endometrial uterine glands. High binding of 125I-ANP was observed in proestrus and estrus with 60–75% decreases during metestrus and diestrus. Binding of 125I-tyr0CNP to uterine slices was also high during proestrus, but declined by 35% at estrus, metestrus and diestrus. The alterations in the receptors were also observed at the level of synthesis. RT-PCR detection of guanylyl cyclase A (GC-A) receptor mRNA and guanylyl cyclase B (GC-B) mRNA showed high signals at proestrus but 4- and 2-fold reductions respectively at metestrus and diestrus. In conclusion, variations in uterine ANP and CNP and their receptors during the rat estrous cycle imply the involvement of the natriuretic peptides in uterine hydromineral balance and myometrial motor activity.
Journal of Endocrinology (1997) 153, 345–355
