The growth hormone secretagogue receptor (GHSR) mediates key properties of the gut hormone ghrelin on metabolism and behavior. Nevertheless, most recent observations also support that the GHSR is a constitutively active G protein-coupled receptor (GPCR) endowed with a sophisticated tuning involving a balance of endogenous ligands. Demonstrating the feasibility of shifting GHSR canonical signaling in vivo, we previously reported that a model with enhanced sensitivity to ghrelin (Ghsr Q343X mutant rats) developed fat accumulation and glucose intolerance. Herein, we investigated the contribution of energy homeostasis to the onset of this phenotype, as well as behavioral responses to feeding or pharmacological challenges, by comparing Ghsr M/M rats to WT littermate rats: (1) as freely behaving animals and (2) in feeding and locomotor paradigms. Herein, Ghsr M/M rats showed enhanced locomotor response to a GHSR agonist while locomotor or anorexigenic responses to amphetamine or cabergoline (dopamine receptor 2 agonist), respectively, were preserved. Ad libitum fedGhsr M/M rats consumed and conditioned for sucrose similarly to littermate control rats . In calorie-restricted conditions, Ghsr M/M rats retained food anticipatory activity and maintained better body weight and glycemia. Importantly, prior to fat accumulation, male Ghsr M/M rats preferentially used carbohydrates as fuel substrate without alterations of energy intake, energy expenditure or physical activity and showed alterations of the GHSR system (i.e. enhanced ratio of GHSR hormones LEAP2: acyl-ghrelin and increased Ghsr expression in the hypothalamus). Overall, the present study provides proof for the concept that shifted GHSR signaling can specifically alter nutrient partitioning resulting in modified balance of carbohydrate/lipid utilization.
Search Results
Candice Marion, Philippe Zizzari, Raphael G P Denis, Rim Hassouna, Yacine Chebani, Thierry Leste-Lasserre, Hélène Doat, Gwenaëlle Le Pen, Daniela Cota, Florence Noble, Serge Luquet, and Jacques Pantel
Geoffrey Raisman
had one more excursion. Interest in the control of water balance led me to look at the paraventricular and supraoptic neurons in the spontaneously occurring homozygous diabetes insipidus (di/di) Brattleboro strain of mutant rat. Brattleboro rats have a
C J H van der Kallen, D C J Spierings, J H H Thijssen, M A Blankenstein, and T W A de Bruin
Abstract
The mutant rat thyroid cell line FRTL-5/TA, isolated from a non-functional tumour which originated spontaneously from wild-type FRTL-5 cells, shows autonomous TSH-independent growth and loss of the thyroid-specific phenotype, lacking thyroid-specific expression of thyroglobulin (Tg) and thyroid peroxidase (TPO) genes. To investigate the role of the transcription factors Pax-8 and thyroid transcription factor-1 (TTF-1) in rat thyroid tumorigenesis, RNA expression of these two thyroid-specific nuclear factors was measured in FRTL-5/TA tumour cells and compared with the expression in wild-type FRTL-5 cells. TTF-1 gene expression was similar to that in wild-type FRTL-5, and showed a similar down-regulation after stimulation with TSH. The finding suggested normal TTF-1 mRNA and protein expression in both cell lines. By contrast, Pax-8 mRNA transcript signal was markedly reduced in FRTL-5/TA cells, reaching levels as low as 8% of the normal, basal level in FRTL-5 cells. These data indicated that the loss of thyroid-specific expression of Tg and TPO genes in FRTL-5/TA cells was not related to changes in TTF-1 gene expression but rather to reduced Pax-8 gene expression. It was concluded that a disruption of the co-ordinated expression of TTF-1 and Pax-8 is implicated in the loss of thyroid phenotype of FRTL-5/TA cells in terms of reduced Tg and TPO expression.
Journal of Endocrinology (1996) 150, 377–382
H. M. Charlton, R. G. Clark, I. C. A. F. Robinson, A. E. Porter Goff, B. S. Cox, C. Bugnon, and B. A. Bloch
ABSTRACT
Mutations in animals have provided insight into many aspects of normal and pathological human physiology. This paper reports the discovery and initial characterization of a new mutant dwarf rat. The mutation, inherited as an autosomal recessive, arose spontaneously in a breeding colony of Lewis rats at the Medical Research Council Cellular Immunology Unit, Sir William Dunn School of Pathology, Oxford, U.K., in 1985 and the strain has now been established both in Oxford and at Mill Hill. Body growth in the mutant is retarded such that at 3 months of age both males and females weigh approximately 40% less than their normal litter-mates, and continue to grow at a slower rate.
The mutants show a selective reduction in pituitary GH synthesis and storage (pituitary GH concentrations were approximately 10% of normal in males and 6% in females). The concentration of their anterior pituitary trophic hormones (LH, TSH, prolactin and ACTH) were within the normal range in dwarf animals. Exogenous GH treatment for 5 days resulted in an increase in growth rate from 1·5 ± 0·3 to 3·9 ± 0·4 g/day in male mutants, and 0·8 ± 0·2 to 3·1 ±0·1 g/day in females. Longitudinal bone growth rates were more than doubled by this treatment from 49 ± 5 to 100 ±10 μm/day in females and from 52 ± 11 to 131 ± 16 μm/day in males.
Dot blot and Northern blot analysis of pituitary mRNA extracts revealed that the GH message in mutants was between 20 and 25% of normal, and that the GH transcript was of normal size.
Immunoreactive GH-releasing factor (GRF) and somatostatin were present in the dwarf hypothalamus, and exogenous GRF released small amounts of GH in vivo but in proportion to the pituitary GH content. This mutant rat, which shows a selective pituitary GH deficit, may provide a useful new model for studying the endocrinology of growth.
J. Endocr. (1988) 119, 51–58
Hong-Wei Wang, Michelle Muguira, Wei-Dong Liu, Tao Zhang, Chiachen Chen, Rebecca Aucoin, Mary B Breslin, and Michael S Lan
, CGGCAAAGTCCAGATGGCAGAGAGGA; PInI-4, TCCTCTCTCTGCCATCTGGACTTTGCCG; PInII-1, GATCGGTACCCCCAACCACTCCAAGTGG; PInII-2, GATCCTCGAGGGTTACTGAATCCCAC; PInII-3, AAACAGCAAAGTCCAGATGTCAGGGG; and PInII-4, CCCCTGACTACTGGACTTTGCTGTTT. The mutant rat insulin I and II promoters were
Simone Odau, Christoph Gabler, Christoph Holder, and Ralf Einspanier
-regulation of cyclooxygenase-1 in renal carcinomas of the Eker (TSC2 gene mutant) rat model. Cancer Science 94 22 –25. Parent J , Villeneuve C & Fortier MA 2003 Evaluation of the contribution of cyclooxygenase 1 and
