Search Results

You are looking at 1 - 6 of 6 items for :

  • "sphingosine-1-phosphate receptor" x
Clear All
Free access

O Sukocheva and C Wadham

-4159.2001.00164.x ) El-Shewy HM Johnson KR Lee MH Jaffa AA Obeid LM Luttrell LM 2006 Insulin-like growth factors mediate heterotrimeric G protein-dependent ERK1/2 activation by transactivating sphingosine-1-phosphate receptors . Journal of Biological Chemistry

Free access

Stephan Werth, Helge Müller-Fielitz and Walter Raasch

.00265.2004) Brinkmann V 2007 Sphingosine 1-phosphate receptors in health and disease: mechanistic insights from gene deletion studies and reverse pharmacology . Pharmacology and Therapeutics 115 84 – 105 . ( doi:10.1016/j.pharmthera.2007

Free access

Libor Vítek and Martin Haluzík

in energy homeostasis. CAR, constitutive androstane receptor; EGFR, epidermal growth factor receptor; FXR, farnesoid X receptor; M3R, muscarinic M3 receptor, PXR, pregnane X receptor; S1PR2, sphingosine 1-phosphate receptor 2; TGR5, G protein

Free access

Laura E Pascal, Khalid Z Masoodi, June Liu, Xiaonan Qiu, Qiong Song, Yujuan Wang, Yachen Zang, Tiejun Yang, Yao Wang, Lora H Rigatti, Uma Chandran, Leandro M Colli, Ricardo Z N Vencio, Yi Lu, Jian Zhang and Zhou Wang

BTB domain containing GGGGCTTATCCGCACTTACC TGGCCTGATACTCGGTGAACA Human RTN4 Reticulon 4 TGCCTTCATTGTTTGTCGGG TTCCTAGCTGCTGATAGGCGA Mouse S1PR1 Sphingosine-1-phosphate receptor 1 ATGGTGTCCACTAGCATCCC

Free access

Damian G Romero, Ming Yi Zhou, Licy L Yanes, Maria W Plonczynski, Tanganika R Washington, Celso E Gomez-Sanchez and Elise P Gomez-Sanchez

atrial natriuretic factor and myosin light chain-2 genes ( Tamirisa et al. 1999 ) and attenuates sphingosine 1-phosphate receptor signaling ( Cho et al. 2003 ). In vivo, RGS4 overexpression in ventricular tissue impairs the ability of the heart

Free access

Motoyasu Satou, Yoshihiro Nishi, Akira Hishinuma, Hiroshi Hosoda, Kenji Kangawa and Hiroyuki Sugimoto

sphingosine 1-phosphate receptor transactivation . Journal of Biological Chemistry 280 17286 – 17293 . ( doi:10.1074/jbc.M412427200 ) Frohman LA Downs TR Heimer EP Felix AM 1989 Dipeptidylpeptidase IV and trypsin-like enzymatic degradation of