Search Results

You are looking at 1 - 10 of 631 items for :

Clear All
Free access

Can Liu, Mian Zhang, Meng-yue Hu, Hai-fang Guo, Jia Li, Yun-li Yu, Shi Jin, Xin-ting Wang, Li Liu and Xiao-dong Liu

, are thought to be the main components responsible for the antidiabetic actions ( Attele et al . 1999 , 2002 ). Ginsenoside Rb1 (Rb1) was also reported to be the most abundant constituent among more than 30 ginsenosides in ginseng root despite

Free access

Wenbin Shang, Ying Yang, Libin Zhou, Boren Jiang, Hua Jin and Mingdao Chen

of hydroxyl groups ( Gillis 1997 , Attele et al . 1999 ). Ginsenoside Rb 1 is the most abundant one among more than 20 ginsenosides in ginseng root despite different sources and species ( Attele et al . 2002 , Washida & Kitanaka 2003 , Lim et

Free access

S C P Dutra, E G Moura, A L Rodrigues, P C Lisboa, I Bonomo, F P Toste and M C F Passos

for 1 h by 5% nonfat milk in TBS-T buffer (20 mM Tris, pH 7.5, 0.5 M NaCl, 0.1% Tween 20) followed by overnight incubation with primary antibody OB-Rb (m-18, goat polyclonal, Sc-1834, antihuman leptin receptor; Santa Cruz Biotechnology, Santa Cruz, CA

Free access

Xuemei Tang, Jingwen Li, Wei Xiang, Ye Cui, Bin Xie, Xiaodong Wang, Zihui Xu and Lixia Gan

: CAACACTGAAGGGAAGACACT 79 Reverse: CACTCTGTCCCAGTTTACA Mice-OB-Ra U49106.1 Forward: AATGACGCAGGGCTGTATGT 194 Reverse: ATGGACTGTTGGGAAGTTGG Mice-OB-Rb U49107.1 Forward: TGCTTTTGACTGGTGAGGCA 138 Reverse

Free access

Haifan Zhang, Tim McElrath, Wei Tong and Jeffrey W Pollard

certain transcription factors, such as the E2Fs, required for cell cycle progression ( Ewen et al. 1993 , Sherr 1996 , Sherr & Roberts 1999 ). Different cyclins act sequentially through G1, with members of the cyclin D family activating CDK4 and CDK6

Free access

CN Robson, V Gnanapragasam, RL Byrne, AT Collins and DE Neal

Transforming growth factor-beta1 (TGFbeta1) is inhibitory to most epithelia, but its role in the control of proliferation of prostatic epithelium is unclear. In some cells, TGFbeta1 inhibition is achieved by up-regulation of cyclin-dependent kinase (cdk) inhibitors including p15, p21 and p27. Our aims were to determine whether the effects of TGFbeta1 on human prostatic epithelial cell cycle kinetics were mediated by alterations in the levels of the cdk inhibitors p15, p16, p21 and p27 and hypo-phosphorylated retinoblastoma protein (Rb). Human prostatic epithelial cells in primary culture were grown in the presence of TGFbeta1 (0-10 ng/ml) for up to 4 days and proliferation assessed using a [3H]thymidine uptake assay. Levels of p15, p16, p21 and p27 were measured at both mRNA and protein level by means of a reverse transcriptase PCR-based assay and Western analysis. Rb and cdk2 levels were measured. Exogenous TGFbeta1 (0-5 ng/ml) inhibited proliferation. This was associated with blocking of the cell cycle at G1, and up to 4-fold increases in p15, p21 and p27 mRNA levels, but no change was observed in p16 mRNA levels; these changes were not blocked by cycloheximide. Increased levels of p15, p21 and p27 protein were also accompanied by increased levels of hypo-phosphorylated Rb and decreased cdk2 kinase activity. TGFbeta1 has mainly inhibitory effects on benign human prostatic epithelium, which are caused by up-regulation of cdk inhibitors, hypo-phosphorylation of Rb and delaying of the cell cycle in G1.

Restricted access

J. KAPITOLA, O. SCHREIBEROVÁ and M. SCHÜLLEROVÁ

Thyroid-stimulating hormone (TSH) has been shown to increase the radioactive iodine uptake and the blood flow in the thyroid gland (Söderberg, 1958; Solomon, Prujan & Triplett, 1963; Clayton & Szego, 1967) but there are also negative reports of its effects on the thyroid circulation (Isaacs & Rosenberg, 1967). An attempt has been made to contribute to this problem by examining some effects of TSH on thyroid 86Rb and 131I uptake in rats.

Young female rats weighing 60–100 g. (the difference of weights not exceeding 20 g. in individual experiments), fed standard laboratory diet (Larsen) and water ad libitum, were used. Endogenous TSH secretion was inhibited by adding 0·1% desiccated thyroid (Thyreoidin Spofa) to the food for 7 days. TSH (Thyreotropin Spofa, batch A021066) was injected into the tail vein in doses from 0·1 to 1000·0 m-u. in 0·2 ml. saline. Thyroid 86Rb uptake was measured 40 sec.

Restricted access

J. G. Schofield, A. I. Khan and A. Wood

ABSTRACT

Acetylcholine is known to stimulate the secretion of growth hormone and prolactin and the efflux of 86Rb from bovine anterior pituitary cells: dopamine prevents the stimulation of 86Rb efflux and of prolactin but not growth hormone secretion. The sensitivity of these responses to pertussis toxin has been determined.

Treatment of bovine anterior pituitary cells in primary culture with pertussis toxin (18 h, 100 ng/ml) did not modify the stimulation of prolactin secretion by acetylcholine, but prevented its inhibition by dopamine. In lactotrophs, dopamine but not acetylcholine receptors are therefore coupled to secretion through a pertussis toxin substrate. The stimulation of 86Rb efflux by acetylcholine was also unaffected by pertussis toxin and, again, its inhibition by dopamine was prevented.

Treatment of the cells with pertussis toxin enhanced the secretion of growth hormone in response to acetylcholine. Nitrendepine (1 μmol/l) prevented the cholinergic stimulation of growth hormone but not prolactin secretion from these cells. Acetylcholine increased the cytoplasmic calcium concentration and this rise was enhanced by treatment of the cells with pertussis toxin. Nitrendepine partially inhibited the rise in calcium caused by acetylcholine, and prevented the enhancement of the rise following pertussis toxin treatment.

Cholinergic stimulation of growth hormone therefore depends on calcium entry through nitrendepine-sensitive channels, whereas stimulation of prolactin secretion does not, and in somatotrophs a pertussis toxin substrate may limit calcium entry through these channels. These different sensitivities of somatotrophs and lactotrophs to pertussis toxin and nitrendepine may reflect differences in the properties of the predominant calcium currents in the two cell types.

J. Endocr. (1988) 116, 393–401

Free access

ZQ Cheng, S Adi, NY Wu, D Hsiao, EJ Woo, EH Filvaroff, TA Gustafson and SM Rosenthal

Skeletal myoblasts are inherently programmed to leave the cell cycle and begin the differentiation process following removal of exogenous growth factors. Serum withdrawal results in a marked induction of IGF production which is essential for skeletal muscle differentiation in vitro. However, the potential role of the tyrosine kinase IGF-I receptor (thought to be the principal mediator of both IGF-I and II signaling in skeletal muscle) in the decision of myoblasts to begin differentiation following serum withdrawal is unknown. To explore the role of the IGF-I receptor in this decision by skeletal myoblasts, we functionally inactivated endogenous IGF-I receptors in mouse C2C12 cells using a dominant negative, kinase-inactive IGF-I receptor in which the ATP-binding site lysine (K) at residue 1003 has been mutated to alanine (A). Cell lines with the greatest degree of mutant IGF-I receptor expression (A/K cells) demonstrated functional inactivation of endogenous IGF-I receptors as determined by their impaired ability to phosphorylate the principal substrate of the IGF-I receptor, IRS-1, in response to treatment with IGF-I. In addition, the proliferative response of myoblasts to IGF-I was completely abolished in A/K cells. Following withdrawal of exogenous growth factors, A/K cells demonstrated a marked delay in the induction of the gene expression of myogenin, a skeletal muscle-specific transcription factor essential for differentiation, and a subsequent delay in the induction of muscle creatine kinase activity. Delayed differentiation in A/K cells was associated with prolonged phosphorylation of the cell cycle regulatory retinoblastoma (Rb) protein; it is the un- (or hypo-) phosphorylated form of Rb which is known to promote differentiation in skeletal myoblasts. Thus, the IGF-I receptor regulates the timing of myoblast differentiation induced by serum withdrawal. The delayed differentiation of skeletal myoblasts with functionally inactive IGF-I receptors may result, at least in part, from delayed induction of myogenin gene expression and prolonged phosphorylation of the Rb protein.

Free access

ZA Archer, PA Findlay, SR McMillen, SM Rhind and CL Adam

Sheep exhibit photoperiod-driven seasonal changes in appetite and body weight so that nutritional status increases in long days (LD) and decreases in short days (SD); additionally, they are reproductively active in SD and inactive in LD. We addressed the hypothesis that appetite-regulatory genes in the hypothalamus respond differently to changes in nutritional feedback induced by photoperiod as opposed to food restriction, and that responses would be influenced by gonadal steroid status. Castrated oestradiol-implanted male sheep were kept in SD (8 h light/day) or LD (16 h light/day) for 11 weeks, with ad libitum or restricted food (experiment 1; n=8/group). Rams were kept in SD or LD for 12 weeks with ad libitum or restricted food (experiment 2; n=6/group). Gene expression (by in situ hybridisation) in the hypothalamic arcuate nucleus for leptin receptor (OB-Rb), neuropeptide Y (NPY), pro-opiomelanocortin (POMC) and agouti-related peptide (AGRP) was unaffected by photoperiod treatment, but food restriction increased NPY and AGRP mRNAs, in experiment 1. In experiment 2, mRNAs for POMC and cocaine- and amphetamine-regulated transcript (CART) were up-regulated and AGRP down-regulated in SD, while food restriction increased OB-Rb mRNA, increased NPY and AGRP mRNAs only in LD and decreased POMC mRNA only in SD. Thus, gene expression responded differently to photoperiod and food restriction, and the melanocortin pathway was up-regulated in SD in reproductively activated rams but not in oestradiol-implanted castrates. These data support the hypothesis that hypothalamic appetite-regulatory pathways respond differently to changes in nutritional feedback induced by photoperiod as opposed to food restriction, with gonadal steroid feedback additionally influencing the responses.