Search Results

You are looking at 1 - 10 of 30 items for :

  • sphingosine-1-phosphate receptor x
Clear All
Free access

Stephan Werth, Helge Müller-Fielitz and Walter Raasch

.00265.2004) Brinkmann V 2007 Sphingosine 1-phosphate receptors in health and disease: mechanistic insights from gene deletion studies and reverse pharmacology . Pharmacology and Therapeutics 115 84 – 105 . ( doi:10.1016/j.pharmthera.2007

Free access

O Sukocheva and C Wadham

, G-protein-coupled receptor 30; MMPs, matrix metalloproteases; cdc42, cell division control protein 42; Src, non-receptor tyrosine kinase; SphK1, human sphingosine kinase 1; S1P, sphingosine-1-phosphate. Oestrogen stimulates SphK1 activity in a

Free access

Wendy B Bollag

stable acetylcholine receptor agonist), endothelin-1, sphingosine 1-phosphate, and vasopressin have all been reported to activate phosphoinositide hydrolysis to stimulate adrenocortical cell steroid hormone production ( Kojima et al . 1986 , Woodcock

Free access

Libor Vítek and Martin Haluzík

in energy homeostasis. CAR, constitutive androstane receptor; EGFR, epidermal growth factor receptor; FXR, farnesoid X receptor; M3R, muscarinic M3 receptor, PXR, pregnane X receptor; S1PR2, sphingosine 1-phosphate receptor 2; TGR5, G protein

Free access

Melyssa R Bratton, James W Antoon, Bich N Duong, Daniel E Frigo, Syreeta Tilghman, Bridgette M Collins-Burow, Steven Elliott, Yan Tang, Lilia I Melnik, Ling Lai, Jawed Alam, Barbara S Beckman, Steven M Hill, Brian G Rowan, John A McLachlan and Matthew E Burow

events, including the MAPK and PI3K–AKT pathways ( Nava et al . 2002 , Marinissen et al . 2003 , Radeff-Huang et al . 2004 ). For example, sphingosine kinase type 1 (SPHK1), the enzyme that phosphorylates sphingosine to form sphingosine 1 phosphate

Free access

Karen Forbes and Melissa Westwood

receptor exerts these effects is unclear, although work in other systems has suggested that activation of IGF2R leads to the generation of sphingosine-1-phosphate and consequent signaling through receptors coupled to Gi2 protein ( Murayama et al . 1990

Free access

Toni Welsh, Matrika Johnson, Lijuan Yi, Huiqing Tan, Roksana Rahman, Amy Merlino, Tamas Zakar and Sam Mesiano

Z Leiber D 2008 Signaling pathways involved in sphingosine kinase activation and sphingosine-1-phosphate release in rat myometrium in late pregnancy: role in the induction of cyclooxygenase 2 . Endocrinology 149 4669 – 4679 . doi:10

Free access

Laura E Pascal, Khalid Z Masoodi, June Liu, Xiaonan Qiu, Qiong Song, Yujuan Wang, Yachen Zang, Tiejun Yang, Yao Wang, Lora H Rigatti, Uma Chandran, Leandro M Colli, Ricardo Z N Vencio, Yi Lu, Jian Zhang and Zhou Wang

BTB domain containing GGGGCTTATCCGCACTTACC TGGCCTGATACTCGGTGAACA Human RTN4 Reticulon 4 TGCCTTCATTGTTTGTCGGG TTCCTAGCTGCTGATAGGCGA Mouse S1PR1 Sphingosine-1-phosphate receptor 1 ATGGTGTCCACTAGCATCCC

Free access

P J D Delhanty, B C J van der Eerden, M van der Velde, C Gauna, H A P Pols, H Jahr, H Chiba, A J van der Lely and J P T M van Leeuwen

The phospholipids sphingosine-1-phosphate and lysophosphatidic acid prevent apoptosis in osteoblastic cells via a signaling pathway involving G(i) proteins and phosphatidylinositol-3 kinase. Endocrinology 143 4755 –4763

Free access

P A Hill and A Tumber

Journal 10 1388 – 1397 . Takeshita A Watanabe A Takada Y Hanazawa S 2000 Selective stimulation by ceramide of the expression of the alpha isoform of retinoic acid and retinoid X receptors in osteoblastic cells. A role of sphingosine 1