Abstract
We studied the protein and mRNA expression of activin-A, follistatin and activin receptors in goat ovaries to find evidence of their possible role in ovarian activity, particularly in the various stages of follicle development. Ovaries of cyclic goats were collected and then either fixed in paraformaldehyde for immunohistochemical localisation of activin-A, follistatin, activin receptors IIA/B (ActR-IIA/B) and IA (ActR-IA) proteins or used to obtain samples to demonstrate mRNA expression of activin-A (βA subunit), follistatin, ActR-IIA, -IIB, -IA and -IB, using RT-PCR. For this latter goal, primordial, primary and secondary follicles were isolated mechanically, washed to remove the stromal cells and then used for RT-PCR. In addition, oocytes, cumulus, mural granulosa and theca cells from small (<3 mm) and large (3–6 mm) antral follicles, luteal cells and surface epithelium were collected to study mRNA expression. Activin-A and follistatin proteins were found in oocytes of all follicle classes, granulosa cells from the primary follicle stage onwards, theca cells of antral follicles, corpora lutea and ovarian surface epithelium. In antral follicles, these proteins were detected both in cumulus and mural granulosa cells. ActR-IIA/B protein was found at the same follicular sites, and also in granulosa cells of primordial follicles onward. The localisation of ActR-IA corresponded with that of ActR-IIA/B, but the former protein was absent in the theca of large antral follicles. The mRNAs for activin-A (βA subunit), follistatin, and ActR-IIA, -IIB, -IA and -IB were detected at all follicular and cellular types studied, except that ActR-IIB was not found in follicles that had not developed an antrum yet. In conclusion, in goat ovaries, transcripts of activin-A (βA subunit), its receptors and its binding protein follistatin are expressed and their proteins formed at all follicular stages and in corpora lutea. These findings indicate a role of activin-A in the local regulatory system during the entire follicular development and during luteal activity.
Introduction
Mammalian folliculogenesis involves the developmental progression from a primordial follicle, containing a single layer of granulosa cells around the oocyte, to a large preovulatory follicle consisting of multiple layers of mural granulosa cells enclosing a cumulus–oocyte complex. During this process, the oocyte and granulosa cells grow and differentiate, while theca cells are recruited from stromal tissue. After ovulation, granulosa and theca cells differentiate into luteal cells. This entire process is regulated and coordinated by endocrine hormones such as the gonadotropins, and by local growth factors in an autocrine or paracrine manner (Richards et al. 2002).
Activin was originally identified as a peptide growth factor from the ovarian follicular fluid that stimulates FSH secretion in cultured anterior pituitary cells (Vale et al. 1986). It is a homodimer or heterodimer of two similar but distinct β subunits (βA and βB). The dimerisation of activin β subunits gives rise to three forms of activin, that is, activin A (βAβA), activin B (βBβB) and activin AB (βAβB). Both βA and βB subunits can also combine with the α subunit and form inhibin-A (αβA) and -B (αβB) respectively. In the ovary, activin-A is the most studied type (Tisdall et al. 1994, Yokota et al. 1997, Zhao et al. 2001, Thomas et al. 2003) and plays an important role in ovarian follicle development (Ohshima et al. 2002, Lovell et al. 2003), but activin-B has also been described (Bristol & Woodruff 2004). The activities of activin are modulated by its binding protein follistatin, which was originally purified from mammalian follicular fluid as a FSH inhibitor (Phillips & de Kretser 1998). Follistatin binds activin with high affinity, and its binding effectively neutralises the bioactivities of activin in a variety of target tissues (Knight & Glister 2001, Fisher et al. 2003).
Like most of the TGFβ superfamily members, activin signals through two types of closely related receptors designated type I and type II, each represented by two isoforms, that is, activin receptor types IA (ActR-IA), IB (ActR-IB), IIA (ActR-IIA) and IIB (ActR-IIB). Activin first binds to a type II receptor, which in turn recruits and activates a type I receptor by phosphorylation. The activated complex of activin and its receptors then stimulates the downstream intracellular signalling molecules that are translocated to the nucleus to regulate target gene transcription (Pangas & Woodruff 2000). ActR-IB is the predominant type I receptor for activin, while ActR-IA might have specificity for either activin or bone morpho-genetic protein signals (Massagué & Chen 2000). In vitro studies have demonstrated that activin-A stimulates pre-antral follicle development in bovine (Hulshof et al. 1997) and rodent isolated follicles (Liu et al. 1998, Smitz et al. 1998, Zhao et al. 2001), increases FSH receptor and FSH-induced luteinising hormone (LH) receptor production in rat granulosa cells (Minegishi et al. 1999, Tsuchiya et al. 1999) and suppresses androgen production in human theca cells (Hillier et al. 1991). Activin also regulates ovarian steroidogenesis in primates (Alak et al. 1998) and oocyte maturation and developmental competence in cattle (Silva & Knight 1998). In contrast, there are also reports that activin-A has no effect on bovine primary follicle development (Fortune 2003) and oocyte maturation in the rat (Tsafiri et al. 1989) and pig (Coskun & Lin 1994).
Expression of protein and mRNA for activin-A and activin receptors in the ovary has been localised in both oocyte and granulosa cells of follicles at various developmental stages (rodents: Wu et al. 1994, Zhao et al. 2001; primates: Roberts et al. 1993, Sidis et al. 1998; pigs: van den Hurk & van de Pavert 2001; and ruminants: Tisdall et al. 1994, Hulshof et al. 1997, Izadyar et al. 1998). In addition, activin-A and activin receptors have been detected in human theca cells (Pangas et al. 2002) and porcine corpora lutea (van den Hurk & van de Pavert 2001). Interestingly, follistatin has also been localised in granulosa cells of rat (Nakatani et al. 1991), sheep (Tisdall et al. 1994) and man (Roberts et al. 1993), and in oocytes, granulosa cells and corpora lutea of cattle (Izadyar et al. 1998, Singh & Adams 1998). Although there is convincing evidence that activin signalling is important for ovarian function, information on its localisation and function is mainly obtained from rodents and cows. Furthermore, most of these studies emphasise only antral follicles, and some of them show conflicting results. To improve our knowledge about the factors that control ovarian follicle development in mammals and to explore possible physiological differences, it is very important to conduct studies with other species, such as goats. Goats are present on all continents and are commercially seen as highly attractive livestock, since they constitute an important source of products such as meat, milk, fibre and skin.
The present study was carried out to examine the possible existence of an intrafollicular activin–follistatin–activin receptor system and its distribution in ovaries of cyclic goats to find evidence of a possible role of this system in ovarian activity, folliculogenesis especially. Therefore, mRNA expression of activin-A (βA subunit), its type I and type II receptors and its binding protein follistatin was investigated by reverse-transcription polymerase chain reaction (RT-PCR), while the presence and cellular localisation of the corresponding proteins were analysed by immunohistochemistry.
Materials and Methods
Ovaries
During the breeding season, ovaries (n=56) were recovered from slaughtered cyclic adult mixed-breed goats and transported to the laboratory in a thermos flask within 1 h. Sixteen of those ovaries were fixed overnight at room temperature in 4% (w/v) paraformaldehyde in PBS (pH 7.4), and subsequently dehydrated and embedded in paraffin wax (Histoplast; Shandon Scientific Ltd, Pittsburgh, PA, USA) in preparation for immunohistochemical studies. The remaining 40 ovaries were used to recover cells and tissues for RT-PCR.
Immunohistochemistry
Localisation of activin-A, follistatin and ActR-IIA/B and -IA was performed on serial 5-μm sections cut from ovaries of eight different goats. These sections were mounted on poly-l-lysine-coated slides, dried overnight at 37 °C, deparaffinised in xylene and rehydrated in a graded ethanol series. Endogenous peroxidase was blocked by incubating the deparaffinised sections in 3% hydrogen peroxide in methanol for 10 min. The sections were then washed with PBS, and the epitopes were activated by microwaving the sections for 7 min at 900 W in 0.01 M citrate buffer (pH 6.0). After microwave treatment, the sections were washed in PBS/0.05% Tween (PBS-T; Merck, Darmstadt, Germany) before being incubated for 30 min with 5% normal goat serum in PBS to minimise non-specific binding. The primary antibodies were as follows: 1) rabbit antiactivin-A (Innogenetics, Ghent, Belgium); 2) mouse antifollistatin (R&D System Europe, Abingdon, UK); 3) rabbit anti-Act-RIIA that cross-reacts with ActR-IIB (Celgen, Leuven, Belgium) and mouse anti-ActR-IA (R&D System Europe). All antibodies were diluted 1:50. Unfortunately, the available anti-ActR-IB is not suitable for use in goat tissue. The sections were incubated overnight at 4 °C in appropriate dilutions of the antibodies. All other incubations and washes were performed at room temperature. After incubation with an antibody, sections were washed three times with PBS-T and incubated for 45 min with biotinylated secondary antibody (goat antirabbit or goat antimouse IgG from Vector Laboratories, Burlingame, CA, USA), diluted 1:200 in PBS containing 5% normal goat serum. Next, the sections were washed three times in PBS-T before being incubated for 45 min with an avidin–biotin complex (1:600) (Vectastain Elite ABC kits; Vector Laboratories). The sections were then washed three times in PBS and stained with diaminobenzidine (DAB) (0.05% DAB in Tris/HCl, pH 7.6, and 0.03% H2O2 – Sigma tablets) until a precipitate formed or for a maximum of 20 min. The stained sections were rinsed in PBS and water, and counterstained for 10 s in Mayer’s haematoxylin. Finally, the sections were washed for 10 min in running tap water, and subsequently dehydrated in a graded ethanol series followed by xylene treatment and mounting in Pertex (Cellpath Ltd, Hemel Hempstead, UK). The staining intensity was scored as follows: absent (−), weak (+), moderate (++), or strong (+++). Sections were analysed by two independent researchers. Controls for non-specific staining were performed by (1) replacing the primary antibody with IgGs from the same species in which the specific antibody was raised, at the same concentration, and (2) incubation with diaminobenzidine reagent alone to exclude the possibility of non-suppressed endogenous peroxidase activity.
Classification and measurement of follicles
Ovarian follicles were classified as 1) primordial (one layer of flattened/cuboidal granulosa cells), 2) primary (a single layer of cuboidal granulosa cells), 3) secondary (two or more layers of cuboidal granulosa cells), 4) small antral follicles (<3 mm in diameter, with multiple granulosa cells enclosing an antrum), and 5) large antral follicles (3–6 mm). The diameter of follicles was calculated by the method described by Van den Hurk et al.(1994).
Collection of cells and tissues for RT-PCR
The ovaries were rinsed in saline (0.9% NaCl) containing antibiotics (100 IU/ml penicillin and 100 μg/ml streptomycin), after which 10 of them were used for isolation of primordial, primary and secondary follicles. The remaining ovaries were used for collection of oocytes, cumulus cells, mural granulosa cells and thecal cells from small and large antral follicles; and samples of corpora lutea and ovarian surface epithelium.
Early-stage follicles, that is, primordial, primary and secondary, were isolated by the mechanical procedure described previously (Lucci et al. 1999). After isolation, these follicles were washed several times to remove the stromal cells completely, and then placed by category into separate Eppendorf tubes in groups of 15. This procedure was completed within 2 h, and all samples were stored at −80 °C until the RNA was extracted. In previous work from our group, histological analysis was performed to confirm goat preantral follicle classification after isolation (Lucci et al. 1999).
From a second group of ovaries (n=20), cumulus–oocyte complexes (COCs) were aspirated from small (1–3 mm) and large (3–6 mm) antral follicles with an 18-gauge needle attached to a tube in line with a vacuum pump. From the follicle content so collected, compact COCs were selected as described by Van Tol & Bevers (1998). Thereafter, the cumulus was separated from the oocyte by a combination of vortexing and aspiration via a narrow-bore Pasteur pipette. Denuded oocytes, and cumulus and mural granulosa cells were separated, washed four times in PBS, packed in tubes in groups of either 10 denuded oocytes, cumulus cells from 10 COCs or samples of mural granulosa, and stored at −80 °C until RNA extraction.
To collect theca cells, small (n=10) and large antral follicles (n=10) were isolated from ovaries (n=5) and dissected free of stromal tissue with forceps, as described previously (Van Tol & Bevers 1998). The follicles were then bisected, and the granulosa cells were scraped off with a scalpel. Next, the theca cell layers were vortexed for 1 min in 1 ml HEPES-buffered M199 (Gibco BRL, Paisley, UK) supplemented with penicillin/streptomycin, transferred to a fresh 1 ml of buffer, vortexed again for 1 min, washed twice in 2 ml HEPES-buffered M199, collected and stored at −80 °C. From another group of ovaries (n=5), small pieces of corpus luteum and surface epithelium were collected and stored at −80 °C until RNA extraction. Three samples of each tissue sample were analysed.
Extraction of total RNA and reverse transcription
Isolation of total RNA combined with on-column DNAse digestion was performed with the RNeasy mini kit and the RNAse-free DNAse set (Qiagen). According to the manufacturer’s instructions, 350 μl lysis buffer were added to each frozen sample, and the lysate was aspirated through a 20-gauge needle before being centrifuged at 10 000 g for 3 min at room temperature. The lysates of theca cells, corpus luteum and ovarian surface samples were then subjected to proteinase K treatment (6.7 mAU/ml, Qiagen) at 55 °C for 10 min. Thereafter, all lysates were diluted 1:1 with 70% ethanol and introduced to a mini-column. After binding of the RNA to the column, DNA digestion was performed with RNAse-free DNAse (340 Kunitz units/ml) for 15 min at room temperature. After washing of the column three times, the RNA was eluted with 30 μl RNAse-free water.
Prior to the reverse-transcription reaction, the eluted RNA samples were incubated for 5 min at 70 °C, and chilled on ice. Reverse transcription was then performed in a total volume of 20 μl made up of 10 μl sample RNA, 4 μl 5X reverse transcriptase buffer (Gibco BRL, Breda, The Netherlands), 8 units RNAsin, 150 units Superscript II reverse transcriptase (Gibco BRL), 0.036 U random primers (Life Technologies BV, Leiden, The Netherlands) and 10 mM DTT and 0.5 mM of each dNTP. The mixture was incubated for 1 h at 42 °C and for 5 min at 80 °C, and then stored at −20 °C. Minus RT blanks were prepared under the same conditions, but without inclusion of reverse transcriptase.
Amplification of cDNA
PCR reactions were carried out in 200 μl tubes (Biozym, Landgraaf, The Netherlands), using 1 μl cDNA as template in 25 μl of a mixture of 2 mM MgCl2, 200 μM of each dNTP and 0.5 μM each of primers, and 0.625 units Taq DNA polymerase (HotStarTaq; Qiagen). The primers used for amplification of the inhibin/activin βA subunit, follistatin, Act-RIIA, -RIIB, -RIA, and -RIB, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), are presented in Table 1.
The thermal cycling profile for the first round of PCR was as follows: initial denaturation and activation of the polymerase for 15 min at 94 °C, followed by 40 cycles of 15 s at 94 °C, 30 s at 55 °C and 45 s at 72 °C. Final extension was for 10 min at 72 °C. During the amplification of inhibin/activin βA subunit and ActR-IIB cDNA, hemi-nesting was used to increase the specificity and sensitivity. For hemi-nesting, 1 μl first-round product was transferred to another 200 μl tube with 24 μl PCR amplification mixture containing the second antisense primer, and amplified for 25 cycles with the same thermal cycling profile. All reactions were performed in a 24-well thermocycler (Perkin-Elmer, Gouda, The Netherlands). Finally, 10 μl product was resolved by electrophoresis in 1% agarose gels containing ethidium bromide. A 100 base pair (bp) DNA ladder (Gibco BRL) was included as a reference for fragment size, and images of each gel were recorded with a digital camera (Olympus C-4040, New York, NY, USA).
A standard sequencing procedure (ABI PRISM 310 Genetic analyzer, Applied Biosystems) was used to verify the specificity of the PCR products.
Results
Protein localisation for activin-A, follistatin and activin receptors
Activin-A and follistatin proteins were detected in oocytes of primordial follicle stage onward (Fig. 1A and J), and in granulosa cells of primary (Fig. 1B and K) and secondary follicles (Fig. 1C and L). Occasionally, activin-A was found in granulosa cells of primordial follicles (Fig. 1A), but no reaction to either activin-A or follistatin was found in theca cells from secondary follicles (Fig. 1C and L). ActR-IIA/B and ActR-IA proteins were found in oocyte and granulosa cells of primordial (Fig. 2A and J), primary (Fig. 2B and K) and secondary follicles (Fig. 2C and L), but not in theca cells of these follicles.
In antral stages, all follicular compartments, that is, the oocyte, cumulus cells, mural granulosa cells and thecal cells, generally had a moderate to strong reaction to both activin-A (Fig. 1D–F) and follistatin (Fig. 1M–O), except for small antral follicles that had a weak reaction to activin-A (Fig. 1D, Table 2). Additionally, these same sites had a positive reaction to both ActR-IIA/B (Fig. 2D–F) and ActR-IA (Fig. 2M–O), except the theca cells of large antral follicles, which did not react to ActR-IA (Fig. 2O). Apart from follicles, immunoreactions to activin-A, follistatin, ActR-IIA/B and ActR-IA were observed in corpora lutea (Fig. 1G and P) and ovarian surface epithelium (Fig. 1H and Q). The relative intensity of immunohistochemical staining for activin-A, follistatin, ActR-IIA/B and ActR-IA in all cell types studied is illustrated in Table 2. For all antibodies tested, control reactions (Figs 1I and R and 2I and R) confirmed the absence of non-specific staining.
mRNA expression for activin βA subunit, follistatin and activin receptors
Amplification of cDNA from primordial, primary and secondary follicles resulted in specific products for inhibin/activin βA subunit, follistatin, ActR-IIA, -IA and -IB (Fig. 3). Transcripts for both the βA subunit of activin (653 bp) and follistatin (566 bp), and all activin receptors (IIA (527 bp), IIB (184 bp), IA (431 bp) and IB (315 bp)) were also detected in cDNA from oocytes, cumulus, mural granulosa and theca cells collected from small and large antral follicles as well as from corpus luteum and ovarian surface epithelium (Fig. 3). The expression of the housekeeping gene (GAPDH) is also illustrated in Fig. 3. Sequence analysis of the amplified βA subunit of activin, follistatin, and ActR-IIA, -IIB, -IA and -IB products confirmed their specificity. Amplification of –RT (without reverse transcriptase) or water blanks (cDNA replaced by water) controls yielded no specific products in any of the reactions.
Discussion
The current study has demonstrated the presence of protein for both the inhibin/activin βA subunit and follistatin in primordial, primary and secondary goat follicles. Both proteins are synthesised in these follicles, since the present RT-PCR studies additionally showed their mRNA expression. Activin-A protein was previously detected in oocyte and granulosa cells from early follicles in sheep (McNatty et al. 1999), cow (Hulshof et al.1997), man (Yamoto et al. 1992), pig (van den Hurk & van de Pavert 2001), rat (Zhao et al. 2001) and cat (Bristol & Woodruff 2004). However, Pangas et al.(2002) could not detect activin-A protein in mouse early follicles. For this follicular category, activin-A mRNA was demonstrated in pig by in situ hybridisation (van den Hurk & van de Pavert 2001), but not in sheep (Braw-Tal 1994, Tisdall et al. 1994). The follistatin protein was previously demonstrated in sheep oocytes of primordial follicles and in oocytes and granulosa cells of primary and secondary follicles (McNatty et al. 1999), but its mRNA was detected only in granulosa cells of secondary follicles (Braw-Tal 1994, Tisdall et al. 1994). Because follistatin binds and neutralises activin-A (de Winter et al. 1996, Sidis et al. 2001, 2002, Fisher et al. 2003), co-expression of both compounds in goat primordial, primary and secondary follicles suggests that follistatin may control the biological action of activin-A during early follicle growth. To support possible autocrine and/or paracrine actions of activin-A in such goat follicles, we demonstrated the proteins for ActR-IIA/B and ActR-IA, as well as the mRNA for ActR-IIA, -IA and -IB. The only exception was ActR-IIB, since no cDNA amplification from primordial, primary and secondary follicles was detected. Previous studies have shown ActR-IIA/B protein in early follicles from cow (Hulshof et al. 1997), while those of cat and rat have ActR-IIA, -IIB, -IA and -IB (Drummond et al. 2002, Bristol & Woodruff 2004). In contrast, ActR-IIA protein was not found in mouse early follicles (Pangas et al. 2002). In pig, both protein and mRNA for ActR-IIA were detected in these follicle types (van den Hurk & van de Pavert 2001). In vitro studies have shown that activin-A stimulates early follicle development in cows (Hulshof et al. 1997), sheep (Thomas et al. 2003) and rodents (Liu et al. 1998, Smitz et al. 1998, Zhao et al. 2001).
In caprine antral follicles, both activin-A and follistatin proteins were present in the oocyte, cumulus cells, mural granulosa cells and theca cells. These compounds apparently are formed in these cells, since their mRNA was also detected at the same locations. Transcription of βA subunit can also form inhibin-A, but this will occur only when there is an excess of βA subunit production (Findlay 1993, Knight & Glister 2001). The role of inhibin on folliculogenesis has been recently reviewed by Knight & Glister 2001. Activin-A protein has been detected in oocytes and granulosa cells in rat (Ogawa et al. 1991), human (Yamoto et al. 1992, Roberts et al. 1993, Wada et al. 1996), bovine (Izadyar et al. 1998, Silva et al. 2003) and porcine (van den Hurk & van de Pavert 2001) antral follicles. In man (Roberts et al. 1993) and pig (van den Hurk & van de Pavert 2001), theca cells of antral follicles also immuno-reacted to the activin-A protein. Thus far, expression of activin-A mRNA in antral follicles has appeared to be restricted to the granulosa cells in rat (Meunier et al. 1988), primate (Roberts et al. 1993), sheep (Braw-Tal 1994, Tisdall et al. 1994) and pig (van den Hurk & van de Pavert 2001), while in cows it was also detected in oocytes (Izadyar et al. 1998). Follistatin protein and mRNA have been demonstrated in oocyte and granulosa cells from bovine antral follicles (Izadyar et al. 1998, Silva et al. 2003). Expression of follistatin mRNA in antral follicles has also been reported in rat (Nakatani et al. 1991), man (Roberts et al. 1993, Sidis et al. 1998) and sheep (Braw-Tal 1994, Tisdall et al. 1994), and it appeared to be confined to granulosa cells.
We furthermore demonstrated ActR-IIA/B and ActR-IA proteins and the mRNAs for ActR-IIA, -IIB, -IA and -IB in oocytes, cumulus cells, mural granulosa cells and theca cells in the goat. Previously, our group reported the expression of ActR-IIA mRNA and protein in oocytes and granulosa cells of pig (van den Hurk & van de Pavert 2001) and cow (Izadyar et al. 1998) antral follicles, while in those of the human, ActR-IIA and -IIB were detected in granulosa cells and theca cells (Pangas et al. 2002). In mouse and human antral follicles, mRNAs for all four activin receptor subtypes were expressed in both oocytes and granulosa cells (Sidis et al. 1998). In vitro, activin-A stimulated antrum formation (rat: Zhao et al. 2001), FSH receptor and FSH-induced LH receptor production (rat: Minegishi et al. 1999, Tsuchiya et al. 1999), cytochrome P-450 aromatase activity, and thus oestrogen synthesis, in granulosa cells (human: Mukasa et al. 2003). Activin also suppressed androgen production in theca cells from different species (human: Hillier et al. 1991; bovine: Wrathall & Knight 1995; and ovine: Campbell & Baird 2001). Consequently, activin is thought to play a crucial role in basal growth, recruitment and selection of antral follicles through stimulation of proliferation and FSH receptor expression in granulosa cells and modulation of steroidogenesis in granulosa and theca cells, its actions being time and concentration dependent and regulated by follistatin (reviewed by Findlay et al. 1993, 2002, Driancourt 2001, Knight & Glister 2001). Activin-A is also involved in the regulation of oocyte maturation in several species (bovine: Silva & Knight 1998; human: Alak et al. 1998; and mouse: Sidis et al. 1998). The distribution pattern of activin-A, its binding protein follistatin and activin receptors in goat antral follicles points to an important role of these proteins in antral follicle development in this species.
Apart from follicles, we found evidence for the presence of an activin–follistatin–activin receptor system in corpora lutea and ovarian surface epithelium, because of the presence of both mRNA and protein for activin-A, follistatin and all four types of activin receptors at these sites. With regard to corpora lutea, expression of protein and mRNA for activin-A and follistatin has previously been demonstrated in man (Roberts et al. 1993, Wada et al. 1996) and cow (Singh & Adams 1998). Both Act-RIIA protein and mRNA were detected in pig luteal tissue (van den Hurk & van de Pavert 2001), and, in vitro, activin-A suppressed progesterone production by primate luteal cells (Brannian et al. 1992). Expression of activin-A protein and mRNA in ovarian surface epithelium has previously been demonstrated in pig (van den Hurk & van de Pavert 2001) and cow (Hulshof et al. 1997). Choi et al.(2001) demonstrated that activin inhibits growth and induces apoptosis in cultured ovarian surface epithelial cells. As mentioned above, the activin–follistatin system has been demonstrated to control growth and differentiation of antral follicles by affecting gonadotrophin receptor synthesis and steroidogenesis. The activin–follistatin system presence in goat corpora lutea and surface epithelium may therefore point to a regulatory function in or fine tuning of their activity.
In conclusion, activin-A, its binding protein follistatin and its receptors are formed in all types of goat follicles and in antral follicles in all compartments. In addition, they are generated in corpora lutea and ovarian surface epithelium. The widespread distribution pattern of the follistatin–activin–activin receptor system in goat ovaries points to a crucial role of this system in various reproductive processes, including follicle growth and differentiation, and luteal activity.
Oligonucleotide primers used for PCR analysis of goat cells and tissues
| Primer sequence (5′→3′) | Sense | Position | Genbank accession number | |
|---|---|---|---|---|
| s: sense; as: anti-sense, anti-sense primer used in the first (1) and second round (2). | ||||
| Target gene | ||||
| Activin-A | ACCTCGGAGATCATCACGTT | s | 357–376 | GI: 563747 (2002) |
| CAGTCATTCCAGCCAATGTC | as (2) | 990–1009 | Bos taurus Act-βA | |
| CACGACTTGAGGTTGGCGAA | as (1) | 1146–1165 | ||
| Follistatin | TGTGAGAACGTGGACTGTGG | s | 289–308 | GI: 404023 (1994) |
| ACAGGCTCCTCAGACTTACT | as | 835–854 | Bos taurus follistatin | |
| ActR-IIA | AACGAGGCACCAGTGTTGAT | s | 760–769 | GI: 393113 (1995) |
| CTGCATGTCTTCAAGAGAGG | as | 1277–1296 | Bos taurus ActR-IIA | |
| ActR-IIB | CAACTTCCAGAGAGACGCCT | s | 1280–1299 | GI: 31341841 (2003) |
| CTTCTTGTGCACCACCACCT | as (2) | 1444–1463 | Bos taurus ActR-IIB | |
| ACACTCGCTCCTCCACACAG | as (1) | 1574–1593 | ||
| ActR-IA | AGATGAGAAGCCCAAGGTAAA | s | 193–213 | GI: 31341405 (1996) |
| GTGCCATATTCCACATCTCTGG | as | 603–624 | Bos taurus ActR-IA | |
| ActR-IB | AAGATGCAGTCACTGACACC | s | 14–33 | GI: 28193915 (2003) |
| GCCTCATAACTCTGCCACCA | as | 310–329 | Ovis aries ActR-IB | |
| GAPDH | AGGCCATCACCATCTTCCAG | s | 179–198 | GI: 2285902 (1997) |
| GGCGTTGGACAGTGGTCATAA | as | 485–504 | Bos taurus GAPDH | |
Relative intensity of immunohistochemical staining for activin-A, follistatin, ActR-IIA/B and ActR-IA, and localisation of mRNA for activin-A, follistatin, ActR-IIA, ActR-IIB, ActR-IA and ActR-IB in the ovaries of goats
| Activin-A | Follistatin | ActR-IIA/B | ActR-IIA | ActR-IIB | ActR-IA | ActR-IA | ActR-IB | |||
|---|---|---|---|---|---|---|---|---|---|---|
| Protein | mRNA | Protein | mRNA | Protein | mRNA | MRNA | Protein | mRNA | mRNA | |
| *Whole follicles. | ||||||||||
| (−/+) occasionally found; (−) absent; (+) weak; (++) moderate; (+++) strong immunoreaction. | ||||||||||
| Structure | ||||||||||
| Primordial follicle | ||||||||||
| Oocyte | ++ | +* | + | +* | ++ | +* | −* | ++ | +* | +* |
| Granulosa | +/− | − | ++ | + | ||||||
| Primary follicle | ||||||||||
| Oocyte | + | +* | + | +* | ++ | +* | −* | + | +* | +* |
| Granulosa | ++ | +/− | ++ | + | ||||||
| Secondary follicle | ||||||||||
| Oocyte | ++ | + | ++ | + | ||||||
| Granulosa | ++ | +* | + | +* | ++ | +* | −* | + | +* | +* |
| Theca | − | − | − | − | ||||||
| Antral follicle <3 mm | ||||||||||
| Oocyte | + | + | +++ | + | ++ | + | + | ++ | + | + |
| Cumulus | + | + | +++ | + | ++ | + | + | + | + | + |
| Mural granulosa | + | + | +++ | + | ++ | + | + | + | + | + |
| Theca | + | + | + | + | +/− | + | + | + | + | + |
| Antral follicle <3–6 mm | ||||||||||
| Oocyte | ++ | + | ++ | + | +++ | + | + | ++ | + | + |
| Cumulus | ++ | + | + | + | +++ | + | + | ++ | + | + |
| Mural granulosa | +++ | + | +++ | + | +++ | + | + | ++ | + | + |
| Theca | ++ | + | ++ | + | + | + | + | − | + | + |
| Corpus luteum | +++ | + | ++ | + | ++ | + | + | +++ | + | + |
| Ovarian surface | +++ | + | ++ | + | ++ | + | + | +++ | + | + |
Activin-A and follistatin immunoreactivity in the different structures found within goat ovaries. (A and J) Primordial follicle, (B and K) primary follicle, (C and L) secondary follicle, (D and M) small antral follicle, (E and N) COC of a large antral follicle, (F and O) mural granulosa and theca cells from a large antral follicle, (G and P) corpus luteum, (H and Q) ovarian surface epithelium and (I and R) negative control reaction. O: oocyte; G: granulosa cells; MGC: mural granulosa cells; CC: cumulus cells; T: theca cells; CL: corpus luteum; S: ovarian surface epithelium. Scale bars represent 25 μm.
Citation: Journal of Endocrinology 183, 2; 10.1677/joe.1.05756
ActR-IIA/B, and ActR-IA immunoreactivity in the different structures found within goat ovaries. (A and J) Primordial follicle, (B and K) primary follicle, (C and L) secondary follicle, (D and M) small antral follicle, (E and N) COC of a large antral follicle, (F and O) mural granulosa and theca cells from a large antral follicle, (G and P) corpus luteum, (H and Q) ovarian surface epithelium and (I and R) negative control reaction. O: oocyte; G: granulosa cells; MGC: mural granulosa cells; CC: cumulus cells; T: theca cells; CL: corpus luteum; S: ovarian surface epithelium. Scale bars represent 25 μm.
Citation: Journal of Endocrinology 183, 2; 10.1677/joe.1.05756
Expression of activin-A, follistatin, ActR-IIA, ActR-IIB, ActR-IA and ActR-IB mRNA in different follicle and cell types in goat ovaries. Follicle and cell types are indicated at the top. One hundred base pair ladders are included as markers for fragment size. Tests to ensure sample purity were performed in previous research (J R V Silva, R van den Hurk, H T A van Tol, B A J Roelen & J R Figueiredo, unpublished observations).
Citation: Journal of Endocrinology 183, 2; 10.1677/joe.1.05756
This work was supported by Coordenação de Aperfeiçoa-mento de Pessoal de Nível Superior – CAPES, Brazil. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work. The authors thank the members of the Department of Image Processing and Design (Faculty of Biology, University of Utrecht, The Netherlands) for helping with photography and Drs K. Verschueren and D. Huylebroeck (CELGEN, Leuven, Belgium) for providing the anti-ActR-IIA/B. We also thank K. Peterson (University of Utrecht) for providing some of the goat ovaries.
References
Alak BM, Coskun S, Friedman CI, Kennard EA, Kim MH & Seifer DB 1998 Activin A stimulates meiotic maturation of human oocytes and modulates granulosa cell steroidogenesis in vitro. Fertility and Sterility 70 1126–1130.
Brannian JD, Woodruff TK, Mather JP & Stouffer RL 1992 Activin-A inhibits progesterone production by macaque luteal cells in culture. Journal of Clinical Endocrinology and Metabolism 75 756–761.
Braw-Tal R 1994 Expression of mRNA for follistatin and inhibin/activin subunits during follicular growth and atresia. Journal of Molecular Endocrinology 13 253–264.
Bristol SK & Woodruff TK 2004 Follicle-restricted compartmentalization of transforming growth factor-β superfamily ligands in the feline ovary. Biology of Reproduction 70 846–859.
Campbell BK & Baird DT 2001 Inhibin A is a follicle stimulating hormone-responsive marker of granulosa cell differentiation, which has both autocrine and paracrine actions in sheep. Journal of Endocrinology 169 333–345.
Choi K, Kang SK, Tai C, Auersperg N & Leung PCK 2001 The regulation of apoptosis by activin and transforming growth factor-β in early neoplastic and tumorigenic ovarian surface epithelium. Journal of Clinical Endocrinology and Metabolism 86 2125–2135.
Coskun S & Lin YC 1994 Effects of transforming growth factors and activin-A on in vitro porcine oocyte maturation. Molecular Reproduction and Development 38 153–159.
de Winter JP, ten Dijke P, de Vries CJ, van Achterberg TA, Sugino H, de Waele P, Huylebroeck D, Verschueren K & van den Eijnden-van Raaij AJ 1996 Follistatins neutralize activin bioactivity by inhibition of activin binding to its type II receptors. Molecular and Cellular Endocrinology 116 105–114.
Driancourt MA 2001 Regulation of ovarian follicular dynamics in farm animals. Implications for manipulation of reproduction. Theriogenology 55 1211–1239.
Drummond AE, Le MT, Ethier JF, Dyson M & Findlay JK 2002 Expression and localisation of activin receptors, Smads, and beta glycan to the postnatal rat ovary. Endocrinology 143 1423–1433.
Findlay JK 1993 An update on the roles of inhibin, activin, and follistatin as local regulators of folliculogenesis. Biology of Reproduction 48 15–23.
Findlay JK, Drummond AE, Dyson ML, Baillie AJ, Robertson DM & Ethier JF 2002 Recruitment and development of the follicle; the roles of the transforming growth factor-beta superfamily. Molecular and Cellular Endocrinology 191 35–43.
Fisher WF, Park M, Donaldson C, Wiater E, Vaughan J, Bilezikjian LM & Vale W 2003 Residues in the C-terminal region of activin A determine specificity for follistatin and type II receptor binding. Journal of Endocrinology 176 61–68.
Fortune JE 2003 The early stages of follicular development: activation of primordial follicles and growth of preantral follicles. Animal Reproduction Science 78 135–163.
Hillier SG, Yong EL, Illingworth PJ, Baird DT, Schwall RH & Mason AJ 1991 Effect of recombinant activin on androgen synthesis in cultured human thecal cells. Journal of Clinical Endocrinology and Metabolism 72 1206–1211.
Hulshof SCJ, Figueiredo JR, Beckers JF, Bevers MM, Vanderstichele H & van den Hurk R 1997 Bovine preantral follicles and activin: immunohistochemistry for activin and activin receptor and the effect of bovine activin A in vitro. Theriogenology 48 133–142.
Izadyar F, Dijkstra G, Van Tol HTA, Van den Eijnden-van Raaij AJM, Van den Hurk R, Colenbrander B & Bevers MM 1998 Immunohistochemical localisation and mRNA expression of activin, inhibin, follistatin, and activin receptor in bovine cumulus-oocyte complexes during in vitro maturation. Molecular Reproduction and Development 49 186–195.
Knight PG & Glister C 2001 Potential local regulatory functions of inhibins, activins and follistatin in the ovary. Reproduction 121 503–512.
Liu X, Andoh K, Yokota H, Kobayashi J, Abe Y, Yamada K, Mizunuma H & Ibuki Y 1998 Effects of growth hormone, activin, and follistatin on the development of preantral follicle from immature female mice. Endocrinology 139 2342–2347.
Lovell TM, Gladwell RT, Groome NP & Knight PG 2003 Ovarian follicle development in the laying hen is accompanied by divergent changes in inhibin A, inhibin B, activin A and follistatin production in granulosa and theca layers. Journal of Endocrinology 177 45–55.
Lucci CM, Amorim CA, Bao SN, Figueiredo JR, Rodrigues APR, Silva JRV & Goncalves PBD 1999 Effect of the interval of serial sections of ovarian tissue in the tissue chopper on the number of isolated caprine preantral follicles. Animal Reproduction Science 56 39–49.
Massagué J & Chen YG 2000 Controlling TGF-β signaling. Genes and Development 14 627–644.
McNatty KP, Heath DA, Lundy T, Fidler AE, Quirke L, O’Connell A, Smith P, Groome N & Tisdall DJ 1999 Control of early ovarian follicular development. Journal of Reproduction and Fertility Supplement 54 3–16.
Meunier H, Cajander SB, Roberts VJ, Rivier C, Sawchenko PE, Hsueh AJ & Vale W 1988 Rapid changes in the expression of inhibin alpha-, beta A-, and beta B-subunits in ovarian cell types during the rat estrous cycle. Molecular Endocrinology 2 1352–1363.
Minegishi T, Kishi H, Tano M, Kameda T, Hirakawa T & Miyamoto K 1999 Control of FSH receptor mRNA expression in rat granulosa cells by 3′,5′-cyclic adenosine monophosphate, activin, and follistatin. Molecular and Cellular Endocrinology 149 71–77.
Mukasa C, Nomura M, Tanaka T, Tanaka K, Nishi Y, Okabe T, Goto K, Yanase T & Nawata H 2003 Activin signaling through type IB activin receptor stimulates aromatase activity in the ovarian granulosa cell-like human granulosa (KGN) cells. Endocrinology 144 1603–1611.
Nakatani A, Shimasaki S, Depaolo LV, Erickson GF & Ling N 1991 Cyclic changes in follistatin messenger ribonucleic acid and its protein in the rat ovary during the estrous cycle. Endocrinology 129 603–611.
Ogawa K, Kurohmaru M, Shiota K, Takahashi M, Nishida T & Hayashi Y 1991 Histochemical localisation of inhibin and activin alpha, beta A and beta B subunits in rat gonads. Journal of Veterinary Medical Science 53 207–212.
Ohshima K, Ohshima K, Arai KY, Kishi H, Itoh M, Watanabe G, Terranova PF, Arai K, Uehara K, Groome NP & Taya K 2002 Potential role of activin A in follicular development during the second half of pregnancy in the golden hamster: utero-placental source of activin A. Journal of Endocrinology 172 247–253.
Pangas SA & Woodruff TK 2000 Activin signal transduction pathways. Trends in Endocrinology and Metabolism 11 309–314.
Pangas SA, Rademaker AW, Fishman DA & Woodruff TK 2002 Localisation of the activin signal transduction components in normal human ovarian follicles: implications for autocrine and paracrine signaling in the ovary. Journal of Clinical Endocrinology and Metabolism 87 2644–2657.
Phillips DJ & de Kretser DM 1998 Follistatin: a multifunctional regulatory protein. Frontiers in Neuroendocrinology 19 287–322.
Richards JS, Russell DL, Ochsner S, Hsieh M, Doyle KH, Falender AE, Lo YK & Sharma SC 2002 Novel signaling pathways that control ovarian follicular development, ovulation, and luteinization. Recent Progress in Hormone Research 57 195–220.
Roberts VJ, Barth S, el-Roeiy A & Yen SS 1993 Expression of inhibin/activin subunits and follistatin messenger ribonucleic acids and proteins in ovarian follicles and the corpus luteum during the human menstrual cycle. Journal of Clinical Endocrinology and Metabolism 77 1402–1410.
Sidis Y, Fujiwara T, Leykin L, Isaacson K, Toth T & Schneyer AL 1998 Characterization of inhibin/activin subunit, activin receptor, and follistatin messenger ribonucleic acid in human and mouse oocytes: evidence for activin’s paracrine signaling from granulosa cells to oocytes. Biology of Reproduction 59 807–812.
Sidis Y, Schneyer AL, Sluss PM, Johnson LN & Keutmann HT 2001 Follistatin: essential role for the N-terminal domain in activin binding and neutralization. Journal of Biological Chemistry 276 17718–17726.
Sidis Y, Tortoriello DV, Holmes WE, Pan Y, Keutmann HT & Schneyer AL 2002 Follistatin-related protein and follistatin differentially neutralize endogenous versus exogenous activin. Endocrinology 143 1613–1624.
Silva CC & Knight PG 1998 Modulatory actions of activin-A and follistatin on the developmental competence of in vitro-matured bovine oocytes. Biology of Reproduction 58 558–565.
Silva CC, Groome NP & Knight PG 2003 Immunohistochemical localisation of inhibin/activin alpha, betaA and betaB subunits and follistatin in bovine oocytes during in vitro maturation and fertilization. Reproduction 125 33–42.
Singh J & Adams GP 1998 Immunohistochemical distribution of follistatin in dominant and subordinate follicles and the corpus luteum of cattle. Biology of Reproduction 59 561–570.
Smitz J, Cortvrindt R, Hu Y & Vanderstichele H 1998 Effects of recombinant activin A on in vitro culture of mouse preantral follicles. Molecular Reproduction and Development 50 294–304.
Tisdall DJ, Hudson N, Smith P & McNatty KP 1994 Localisation of ovine follistatin and alpha and beta A inhibin mRNA in the sheep ovary during the oestrous cycle. Journal of Molecular Endocrinology 12 181–193.
Thomas FH, Armstrong DG & Telfer EE 2003 Activin promotes oocyte development in ovine preantral follicles in vitro. Reproductive Biology and Endocrinology 1 76.
Tsafriri A, Vale W & Hsueh AJ 1989 Effects of transforming growth factors and inhibin-related proteins on rat preovulatory Graafian follicles in vitro. Endocrinology 125 1857–1862.
Tsuchiya M, Minegishi T, Kishi H, Tano M, Kameda T, Hirakawa T, Ibuki Y, Mizutani T & Miyamoto K 1999 Control of the expression of luteinizing hormone receptor by local factors in rat granulosa cells. Archives of Biochemistry and Biophysics 367 185–192.
Vale W, Rivier J, Vaughan J, McClintock R, Corrigan A, Woo W, Karr D & Spiess J 1986 Purification and characterization of an FSH releasing protein from porcine ovarian follicular fluid. Nature 321 776–779.
Van den Hurk R & Van de Pavert SA 2001 Localisation of an activin/activin receptor system in the porcine ovary. Molecular Reproduction and Development 60 463–471.
Van den Hurk R, Dijkstra G, Hulshof SCJ & Vos PLAM 1994 Micromorphology of antral follicles in cattle after prostaglandin-induced luteolysis, with particular reference to atypical granulosa cells. Journal of Reproduction and Fertility 100 137–142.
Van Tol HTA & Bevers MM 1998 Theca cells and theca-cell conditioned medium inhibit the progression of FSH-induced meiosis of bovine oocytes surrounded by cumulus cells connected to membrana granulosa. Molecular Reproduction and Development 51 315–321.
Wada M, Shintani Y, Kosaka M, Sano T, Hizawa K & Saito S 1996 Immunohistochemical localisation of activin A and follistatin in human tissues. Endocrine 43 375–385.
Wrathall JH & Knight PG 1995 Effects of inhibin-related peptides and oestradiol on androstenedione and progesterone secretion by bovine theca cells in vitro. Journal of Endocrinology 145 491–500.
Wu TC, Jih MH, Wang L & Wan YJ 1994 Expression of activin receptor II and IIB mRNA isoforms in mouse reproductive organs and oocytes. Molecular Reproduction and Development 38 9–15.
Yamoto M, Minami S, Nakano R & Kobayashi M 1992 Immunohistochemical localisation of inhibin/activin subunits in human ovarian follicles during the menstrual cycle. Journal of Clinical Endocrinology and Metabolism 74 989–993.
Yokota H, Yamada K, Liu X, Kobayashi J, Abe Y, Mizunuma H & Ibuki Y 1997 Paradoxical action of activin A on folliculogenesis in immature and adult mice. Endocrinology 138 4572–4576.
Zhao J, Taverne MA, van der Weijden GC, Bevers MM & van den Hurk R 2001 Effect of activin A on in vitro development of rat preantral follicles and localisation of activin A and activin receptor II. Biology of Reproduction 65 967–977.
