Abstract
We report the results of molecular analysis in a series of twelve Kallmann syndrome (KS) and five normosmic hypogonadotropic hypogonadism (nHH) Brazilian patients. Kallman syndrome 1 (KAL-1) gene analysis was performed in all patients and the gonadotrophin releasing hormone receptor (GnRH-R) gene was investigated in nHH patients using PCR analysis with exon-flanking primers followed by automated sequencing techniques. Two-point mutations at the KAL-1 locus were found in two KS patients. One case exhibited a novel C deletion (del1956C) in exon 12 leading to a premature stop codon at position 617. The second case, a C to T transition at exon 5, showed a stop codon at aminoacid 191 (Arg191X). Renal agenesis and bimanual synkinesis, which are frequently found in patients with the KAL-1 mutation, were observed in these cases. Among the KS patients, two previously reported cases had intragenic deletions of exons 5–10, while a third patient had a KAL-1 gene microdeletion detected by fluorescence in situ hybridization. For the nHH patients, no abnormalities were observed at the exonic and flanking sequences of the KAL-1 or GnRH-R genes. Nasal embryonic LHRH factor (NELF) and early B-cell factor 2 (EBF2) exons were evaluated in KAL-1/GnRH-R mutation-negative cases (seven KS and five nHH) by sequence analysis but no mutations were identified in the coding regions in these patients. In conclusion, this report includes the description of a novel point mutation of the KAL-1 gene and suggests that the KAL-1 mutations and deletions might be more prevalent in KS Brazilian patients than previously described in other series. NELF and EBF2 genes have been considered good candidates for HH and a large number of patients need to be studied to assess their contribution to reproductive function.
Introduction
Hypogonadotropic hypogonadism (HH) is a failure of sexual development or reproductive function due to abnormalities in the pituitary secretion of gonadotropins, follicle-stimulation hormone (FSH) and luteinizing hormone (LH). This profile can result from deficiencies in gonadotropin-releasing hormone (GnRH) production by the hypothalamus or by defects in the GnRH receptor function at the pituitary level. Congenital HH can be associated with anosmia (Kallmann syndrome (KS)) or is apparently isolated, without anosmia (normosmic HH (nHH)). Although the vast majority of KS and nHH cases are sporadic, recessive-X-linked, autosomal dominant and autosomal recessive modes of inheritance have been described (Quinton et al. 1996).
The discovery of the Kallman syndrome 1 (KAL-1) gene has led to a pathophysiological model correlating GnRH deficiency with abnormal olfactory bulb development in X-linked KS. This gene comprises 14 exons spanning approximately 210 kb on Xp22.3, escapes X-inactivation, and encodes a protein (anosmin)-sharing homology with molecules involved in neuronal migration and axonal pathfinding (Franco et al. 1991, Legouis et al. 1991). Several mutations in the KAL-1 gene have been identified in patients with KS (Hardelin et al. 1993, Quinton et al. 1996). However, in a large number of patients, no KAL-1 gene mutations have been found, suggesting that autosomal genes are most probably responsible for the majority of both familial and sporadic KS cases (Oliveira et al. 2001). Indeed, recent evidence points to loss-of-function mutations in the fibroblast growth factor receptor 1 (FGFR-1)gene underlying an autosomal dominant form of KS (Dodé et al. 2003, Sato et al. 2004).
Inactivating mutations in the gonadotropin release hormone receptor (GnRH-R) represent the first identifiable cause of autosomal recessive nHH in humans (de Roux et al. 1997, Layman et al. 1998). The GnRH-R gene is localized on 4q13 and consists of three exons (Kakar et al. 1992). So far, more than 16 natural point mutations have been described in this gene (reviewed in Karges et al. (2003)). In addition, a second locus has been mapped on 19p13 in a large nHH consanguineous family, leading to the identification of a loss-of-function mutation in the G protein-coupled receptor 54 (GPR54) gene (Acierno et al. 2003, de Roux et al. 2003). Furthermore, a short duplication of the coding sequence of the metastasis supressor (KiSS-1) gene, which encodes a GPR54 ligand, was identified in one sporadic case of nHH, suggesting that this peptide can also play a role in the physiology of the gonadotropic axis (de Roux et al. 2004).
However, despite this genetic heterogeneity, only 10–20% of all patients with HH have their genetic basis elucidated (Oliveira et al. 2001, Layman 2002). New promising candidate loci for human HH include genes with potential influence on migration of GnRH neurons. GnRH neurons arise in medial olfactory placode epithelium, migrating along the nasal septum across the cribriform plate to reach the hypothalamus (Schwanzel-Fukuda & Pfaff 1989). Recently, two genes, NELF and EBF2, have been implicated in this process. The Nelf (nasal embryonic LH releasing hormone factor) protein was first isolated in mouse and the expression patterns of the Nelf gene in the olfactory axons and GnRH cells during development are consistent with its proposed function as a migratory factor for GnRH neurons (Kramer & Wray 2000, 2001). The Ebf2 gene has a key role in the neuroendocrine axis as proposed by Corradi et al.(2003). These authors described Ebf2-null mice in which the migration of GnRH neurons is defective leading to HH.
In this paper, we report the molecular findings regarding the KAL-1, GnRH-R, NELF and EBF2 genes in a group of 17 patients with HH in order to verify the relevance of these genes in the pathogenesis of HH.
Subjects and methods
Patients
The subjects were 17 unrelated males, 12 diagnosed with KS (numbered KS1 to KS12) and 5 with nHH (numbered nHH1 to nHH5) (Table 1). In all patients, the HH was documented based on the following criteria: clinical signs and symptoms of hypogonadism; prepubertal testosterone (<100 ng/dl); low or inappropriately normal gonadotropin levels; normal baseline and reserve testing of other anterior pituitary hormones; and normal radiological imaging of the hypothalamic–pituitary region. Anosmia/hyposmia was evaluated using the olfactory test described by Davidson and Murphy (1997). The protocol was approved by the Ethics Committee of the Faculdade de Ciências Médicas da Universidade Estadual de Campinas (UNICAMP) and all participants provided written informed consent.
Mode of inheritance
In two patients with KS (KS11 and KS7) a recessive X-linked mode of inheritance was detected by the presence of asymptomatic females carriers, the presence of another affected male in the maternal family or among male siblings, the absence of affected females and the absence of male-to-male transmission. In another case (KS2), X-linkage was suspected because of the presence of retinal abnormalities, which are typically observed in X-linked KS. Two cases of KS (KS5 and KS6), have a familial history of HH suggestive of autosomal dominant inheritance based on the direct transmission of the phenotype across generations and the presence of at least one affected female. In the nHH probands, one case (nHH5) presented familial recurrence of hypogonadism (one affected brother) but the mode of transmission could not be ascertained.
Methods
Molecular analysis of the KAL-1 gene was initially carried out both in KS and nHH patients; exceptions were made for the three KS patients (KS1, KS2 and KS7) in which genotypes have been previously described (Trarbach et al. 2001, 2004). The five nHH patients were further screened for mutations in the GnRH-R gene. Subsequently, NELF and EBF2 sequencing analysis was performed in the KAL-1/GnRH-R mutation-negative cases (seven KS and five nHH). Genomic DNA was obtained from whole-blood leukocytes using a routine technique protocol based on cell lysis, proteinase K digestion and phenol/chloroform extraction (Sambrook et al. 1989). PCR was performed with 100–200 ng of DNA samples, 0.2 mM dNTP, 1.5 mM MgCl2, 1 × PCR buffer (20 mM Tris–HCl pH 8.4 and 50 mM KCl), 1 U Taq polymerase (Invitrogen) and 0.6 pmol of each specific set of primers. The primer sequences corresponding to the flanking regions of the KAL-1 and GnRH-R exons, sizes of the amplified products and amplification conditions were as reported by Hardelin et al.(1993) and Beranova et al.(2001) respectively, and those for NELF (NM_015537) and EBF2 (NM_022659) are shown in Tables 2 and 3 respectively. Thirty cycles of PCR amplifications were performed in a thermal cycler (Gene Amp PCR System 9700, Applied Biosystems) with denaturation at 94 °C for 1 min, annealing at 55–63 °C for 1 min and extension at 72 °C for 1 min.
PCR products from all the exons of the KAL-1, GnRH-R, NELF and EBF2 genes were purified by Wizard SV gel and PCR clean-up system (Promega). These products were sequenced for both DNA strands using the BigDye terminator cycle sequencing ready reaction kit (PE Applied Biosystems, Foster City, CA, USA) in an ABI 377 Automated DNA Sequencer (PE Applied Biosystems) and, where a mutation was apparent, confirmed in two independent PCR analyses and sequencing.
Results
KS patients
Two-point mutations in the KAL-1 gene were found in two patients with KS. Patient KS3, a sporadic case, exhibited a single base deletion 1956C in exon 12 (Fig. 1). This as-yet undescribed frameshift mutation leads to the introduction of a TGA termination signal 16 codons after the deletion. This patient had a familial history of X-linked KS and the same mutation was observed in his brother. The second point mutation was found in exon 5 of patient KS11, an already known 721C to T transition changing codon 191 from CGA (arginine) to TGA (premature termination codon). In the remaining seven cases, no mutations were detected for either NELF or EBF2 genes.
nHH patients
No abnormalities were found in the nHH patients for the KAL-1, GnRH-R, NELF and EBF2 genes.
Polymorphisms
We found two polymorphic changes in the KAL-1 gene in KS and nHH cases. These polymorphisms were: an A to G transition in exon 11 leading to amino acid substitution Ile534 Val (KS4, KS6 and KS8; nHH1) and a neutral nucleotide substitution in exon 12 (ATT>ATC; Ile611 Ile) (KS6 and KS9; nHH1). Both variations have been previously described by other groups (Hardelin et al. 1993, Georgopoulos et al. 1997). For the EBF2 gene a new polymorphism 843 A to G was observed in exon 8 in KS and nHH patients: four were found to be heterozygous (KS5 and KS9; nHH1 and nHH2) and three homozygous (KS3 and KS4; nHH5) for this variation. However, this coding change was conservative with the amino acid serine remaining at position 245.
Discussion
To date, several mutations in the KAL-1 gene have been published (Table 4). Most of these mutations are located in the exon 5–14 region encoding the fibronectin III domain (FNIII)-like repeats (Fig. 2). Mutations causing defects in the amino-terminal of the protein are perhaps a cause of high antenatal mortality rate (Gu et al. 1998). In our series, two point mutations within the coding regions of the KAL-1 gene were identified in two KS patients. One mutation was detected in a sporadic case (KS3) and consists of a novel one-base deletion 1956C leading to a premature stop codon at 617. The second was a familial case (KS11) with X-linked inheritance where a nonsense mutation Arg191X was found. This mutation has been previously reported by Oliveira et al.(2001) in a sporadic case. Both mutations are located in the region encoding FNIII-like repeats and presumably result in a non-functional truncated KAL protein or even in its complete absence, if we consider the degradation of anomalous mRNA by nonsense-mediated RNA decay (Culbertson et al. 1999).
We have previously identified three other KAL-1 abnormalities in this series of Brazilian KS patients: in a sporadic case (KS1) a KAL-1 gene microdeletion was detected by fluorescence in situ hybridization, while in two families with X-linked inheritance (patients KS2 and KS7) similar intragenic deletions of exons 5–10 were found after PCR analysis (Trarbach et al. 2001, 2004). Thus, the prevalence of KAL1 mutations in these Brazilian patients was 100% in the familial X-linked KS (three of three families) and 30% in sporadic cases (two of seven). Although the frequency of KAL-1 mutations in this study is higher than that reported by other authors (Georgopoulos et al. 1997, Oliveira et al. 2001), Sato et al.(2004) observed similar frequencies in familial X-linked KS (100%) and in sporadic cases (33%). However, these investigators acknowledge that there may be an ascertainment bias in the collection of patients, such as features indicative of contiguous gene syndrome and renal aplasia. This did not occur in the present study, and the reason for the high prevalence of KAL-1 mutations in our series remains unknown.
In the remainder of our KS cases, no abnormalities in the coding exons of the KAL-1 gene were found. In fact, Oliveira et al.(2001) concluded that autosomal genes are clearly responsible for the majority of both familial and sporadic KS. To date, only loss-of-function mutations in the FGFR1 gene, located in 8p11.2, were associated with KS (Dodé et al. 2003, Sato et al. 2004). Therefore, formal possibilities of the existence of a second X-linked gene causing KS or of molecular alterations located in the regulatory regions of the KAL-1 gene promoter, in the untranslated regions of exons 1 and 14, or within introns creating new splicing sites, can not be excluded.
The clinical phenotype of our KS patients carrying KAL-1 mutations, includes renal abnormalities and bi-manual synkinesis. Both features had been exclusively associated with X-linked KS. For instance, approximately 40% X-linked KS patients have renal abnormalities (Kirk et al. 1994), but this symptom has recently been reported in a female patient who does not carry a mutation in the KAL-1 gene (Sato et al. 2004). Similarly, bimanual synkinesis is present in over 75% of X-linked KS patients (Quinton et al. 1996, Mayston et al. 1997), nevertheless this anomaly was also observed in an autosomal form of KS associated with loss-of-function of FGFR1 (Dode et al. 2003).
Although GnRH-R gene mutations have usually been detected in 40% of autosomal recessive and 16% of sporadic nHH patients (Beranova et al. 2001), no mutations were found in our five nHH patients. This is not unexpected due to the small number of cases. No mutations were identified in the coding sequences of the NELF or EBF2 genes in our patients (seven KS and five nHH). To date, only one NELF heterozygous missense mutation 1438A>G, resulting in a Thr480Ala, has been reported in a sporadic case of HH. This mutation was not found in 100 control individuals and the observation that the Thr480 is highly conserved among mouse, rat, and human suggested that this amino acid substitution can be associated with the pathogenesis of HH (Miura et al. 2004). To our knowledge, this is the first report of molecular studies of the EBF2 gene in a small series of KS and nHH patients. The above negative results clearly indicate that other genes (e.g. FGFR-1, GPR54, KiSS-1) should be screened in these cases.
However, it should be noted that the present study is based on genomic DNA analysis and does not rule out localized embryological somatic mutations which would appear as sporadic cases. The clinical relevance of somatic mutations in endocrine diseases, as well as in different endocrine tumors, is becoming increasingly recognized (Bertherat et al. 2005). For instance, in McCune Albright’s syndrome, early embryological activating somatic mutations of the G-s-alpha gene are clearly related to sporadic disease (Shenker et al. 1994). A similar scenario might exist in the GnRH-producing neurons failing to appropriately populate the hypothalamus of patients with KS. Unfortunately, no hypothalamic specimens were available in our patient series to investigate this question.
In conclusion, this report includes the description of a novel point mutation of the KAL-1 gene and suggests that the KAL-1 mutations and deletions might be more prevalent in KS Brazilian patients than previously described in other series. Moreover, although renal agenesis and bimanual synkinesis can not be further considered exclusive for the X-linked KS form, the presence of these features is strongly indicative for the occurrence of KAL-1 abnormalities in patients with HH and anosmia. Attempts to identify mutations within the coding region of NELF and EBF2 genes failed in our series of KS and nHH patients with sporadic and familial cases of GnRH deficiency. However, theses genes have been considered good candidates for HH and a large number of patients need to be studied to assess the contribution of NELF and EBF2 genes to reproductive function.
Funding
E B T was supported by a fellowship from Fundo de Amparo a Pesquisa do Estado de São Paulo, FAPESP, Brazil. The authors declare that there is no conflict of interest that would prejudice the impartiaility of this scientific work.
Clinical characteristics and genotype of evaluated patients with KS and nHH
| Anosmia/hyposmia | Genotype (KAL-1) | Clinical Phenotype | Inheritance | |
|---|---|---|---|---|
| *Patients previously described in Trarbach et al. (2001) (KS1) and Trarbach et al. (2004) (KS2 and KS7). | ||||
| Patient | ||||
| KS1* | + | Complete deletion of KAL-1 locus | High-arched palate | Sporadic |
| KS2* | + | Exons 5–10 deleted | Renal agenesis Mental retardation | Deletion inherited from mother; brother affected |
| KS3 | + | Exon 12: deletion of 1956C creating frameshift and premature STOP codon | Bimanual synkinesis | Sporadic |
| KS4 | + | No coding sequence mutation | Horseshoe kidney | Sporadic |
| KS5 | + | No coding sequence mutation | — | Paternal aunt and cousin affected |
| KS6 | + | No coding sequence mutation | Cubitus valgus | Sister affected and mother anosmic |
| KS7* | + | Exons 5–10 deleted | Renal agenesis High-arched palate Bimanual synkinesis | Clear X-linked |
| KS8 | + | No coding sequence mutation | Mild facial anomalies | Sporadic |
| KS9 | + | No coding sequence mutation | Hypertelorism Epicanthal folds Hypoplasia of 4 and 5 metacarps | Sporadic |
| KS10 | + | No sequence coding mutation | — | Sporadic |
| KS11 | + | Exon 5: 721C to T base substitution creating premature STOP codon | Renal agenesis Pes cavus | Clear X-linked |
| KS12 | + | No coding sequence mutation | — | Sporadic |
| nHH1 | − | No coding sequence mutation | — | Sporadic |
| nHH2 | − | No coding sequence mutation | — | Sporadic |
| nHH3 | − | No coding sequence mutation | — | Sporadic |
| nHH4 | − | No coding sequence mutation | — | Sporadic |
| nHH5 | − | No coding sequence mutation | — | Brother affected |
PCR primers used for amplification of the coding sequence of the NELF gene, and their annealing temperature and product size
| Forward and reverse primers 5′→3′ | Annealing temperature (°C) | Product size (bp) | |
|---|---|---|---|
| DMSO, dimethyl sulfoxide. | |||
| Exon | |||
| 1 | CCTGACGTCACGGTAGGTG ACACACCCTTGGTCCTGGT | 60 (10% DMSO) | 725 |
| 2 | CCGACCCTCCTTCCAGAC GAGGCAGGGATCAGCATC | 60 (10% DMSO) | 250 |
| 3a | CCTTCGGCCTGCTATGAAAC GCTGGCTGTGATGGTGAG | 60 | 352 |
| 3b | CACCCTCACCATCACAGC CACCCCCAAACCTGTCTATG | 60 | 278 |
| 4 | CACCGCTCCTTTTTGTCTCT ATAGGCACGTGGGTCTGTTC | 60 (10% DMSO) | 228 |
| 5 | ACTGTCCCGACGTCTGTGT CAGCACAGACCAGAGATGGA | 60 | 187 |
| 6 | ACCGAAGGGGTGAGAGTAGA TCTTATCGCAGCTAGCAGCA | 60 | 198 |
| 7 | GCTAATGCGGGTTTTGCTC GGTCTAGGGGAGGCTCTGG | 60 (10% DMSO) | 167 |
| 8–9 | TGGCCAGGATAGGAGGTG CGCAAGAGGGCATCTGTT | 60 (10% DMSO) | 547 |
| 10–11 | CTCTGACGCAGCCTTGATGT CTTCTTCCCCTTGGTCTTCC | 59 | 341 |
| 12–13 | AAACTACCTCCCACGCATGT AAGGCTCTGCCCTGTCTGT | 60 | 491 |
| 14–15 | TCTCTCTGCCTCGGACTCAT AGTGGCCTGATGGTGACTG | 60 (10% DMSO) | 357 |
PCR primers used for amplification of coding sequence of EBF2 gene and their annealing temperature and product size
| Forward and reverse primers 5′→3′ | Annealing temperature (°C) | Product size (bp) | |
|---|---|---|---|
| Exon | |||
| 1 | GTCAACAACGGTGAATGTGG AGCAGGCTGGAGTCTGTGTT | 56 | 283 |
| 2 | CCCATGAAAGAACAAACCTGA CCCATGCCTGATTTACTATGA | 58 | 295 |
| 3 | GTCCTTGGTGATGGCTTGTC GAACTAGCGCAAAGGCAAAC | 58 | 243 |
| 4 | AGGTTTGCTTTATAGCCAGGA GCCTGCATTTGTCTAAGTTTCC | 56 | 124 |
| 5–6 | TTTGCCATCTTGGATTTTGC CCCAACCTCTGACTCTGTCC | 56 | 460 |
| 7 | GCACGCCTGTTGATTTACCT TCCCAAAAGGCCCAATAGTA | 56 | 300 |
| 8 | TGTGCCAAATGTGTGAACTG TTTGCTTTACTTTGCCAACC | 56 | 298 |
| 9 | CCCTCATTCTGTTGCATAGCC CAGTTTGTGTAGCCACCATCA | 56 | 297 |
Summary of reported mutations in the KAL-1 gene
| Nucleotide change | Amino acid change | Protein (domain) | References | |
|---|---|---|---|---|
| FNIII, fibronectin III domain like; Cys, domain rich in cysteine; WAP, whey acid protein domain. | ||||
| Exon | ||||
| 5 | 861G>A | W237X | FNIII-1 | Hardelin et al. 1992 |
| 6 | 919C>T | R257X | FNIII-1 | Hardelin et al. 1992 |
| 6 | 924G>A | W258X | FNIII-1 | Hardelin et al. 1992 |
| 9 | 1411C>T | Q421X | FNIII-3 | Hardelin et al. 1993 |
| 9 | 1417C>T | R423 X | FNIII-3 | Hardelin et al. 1993 |
| 7 | 328C>G | Y328X | FNIII-2 | Georgopoulos et al. 1997 |
| 1 | 346C>T | E66X | Cys | Izumi et al.1999 |
| 6 | 934C>T | R262X | FNIII-1 | Söderlund et al. 2002 |
| 13 | 2041C>T | R631X | FNIII-4 | Jansen et al. 2000 |
| 4 | 664T>C | C172X | WAP | Oliveira et al. 2001 |
| 5 | 721C>T | R191X | FNIII-1 | Oliveira et al. 2001 |
| 10 | 1519T>C | R457X | FNIII-3 | Oliveira et al. 2001 |
| 9 | 1270C>T | R424X | FNIII-3 | Sato et al. 2004 |
| 7 | 958G>T | E320X | FNIII-2 | Albuisson et al. 2005 |
| 6 | 981delC | — | FNIII-1 | Hardelin et al. 1992 |
| 7 | 1166insA | — | FNIII-2 | Hardelin et al. 1993 |
| 12 | 1847delC | — | FNIII-4 | Quinton et al. 1996 |
| 10 | 1542_1555delTGAAGCGTGTGCCC | — | FNIII-3 | Georgopoulos et al. 1997 |
| 1 | 242_252delCTGCGCGGCGG | — | Cys-rich | Gu et al. 1998 |
| 12 | 1951delC | — | FNIII-4 | Oliveira et al. 2001 |
| 9 | 1407_1420delTTTTCAAAGACGAC | — | FNIII-3 | Matsuo et al. 2000 |
| 12 | 1956delC | — | FNIII-4 | This paper. |
| 1 | 100_101delCG | — | Cys-rich | Sato et al. 2004 |
| 3 | 262_269delGAGCCCTG | — | Cys-rich | Sato et al. 2004 |
| 5 | 714_715delGA | — | FNIII-1 | Sato et al. 2004 |
| 1 | 53_63dupCGCGGCGGCTG | — | Cys-rich | Söderlund et al.2002 |
| 4 | 570_571insA | — | WAP | Albuisson et al. 2005 |
| 10 | 1651_1654delinsAGCT | — | FNIII-3 | Albuisson et al. 2005 |
| 6 | 951T>A | N267K | FNIII-1 | Hardelin et al. 1993 |
| 11 | 1701C>G | F517L | FNIII-3 | Georgopoulos et al. 1997 |
| 11 | 1690G>A | E514K | FNIII-3 | Maya-Nunez et al. 1998 |
| 4 | 488G>A | C163Y | WAP | Sato et al. 2004 |
| 1 | 3G>A | M1? | Cys | Albuisson et al. 2005 |
| 6 | 784G>C | R262P | FNIII-1 | Albuisson et al. 2005 |
| 12 | 1711T>A | W571R | FNIII-4 | Albuisson et al. 2005 |
| Intron 12 | IVS12+1G>A | — | — | Hardelin et al. 1993 |
| 8 | 1351_1357delAACAACA IVS9+1_2delGT | — | FNIII-2 | Georgopoulos et al. 1997 |
| Intron 4 | IVS4+1G>T | — | Sato et al. 2004 | |
| Intron 1 | IVS1+1G>t | — | Albuisson et al. 2005 | |
| Deletion of exon 2 | — | — | — | Parenti et al. 1995 |
| Deletion of exon 11 | — | — | — | Quinton et al. 1996 |
| Deletion of exon 1 | — | — | — | Quinton et al. 1996 |
| Deletion of exon 5 | — | — | — | Söderlund et al.2002 |
| Deletion of exon 13–14 | — | — | — | Bick et al.1992 |
| Deletion of exon 3–5 | — | — | — | Maya-Nunez et al. 1998 |
| Deletion of exon 5–10 | — | — | — | Nagata et al. 2000 |
| Deletion of exon 3–13 | — | — | — | Massin et al. 2003 |
| Whole gene deletion | — | — | — | Hardelin et al. 1993 |
Sequence analysis of exon 12 of the KAL-1 gene. The mutation in patient KS3 was a deletion of one base, 1956C, at codon 602. The deletion causes a frameshift and a premature termination codon TGA, sixteen codons after the deletion. The base deleted is indicated with an asterisk and the normal sequence can be seen on the left.
Citation: Journal of Endocrinology 187, 3; 10.1677/joe.1.06103
Sites of small deletions (horizontal bars) and point mutations (arrows) identified in the KAL-1 gene to date. The distribution of KAL protein domains is indicated below. The location of the novel mutation identified in the present study is indicated by the asterisk.
Citation: Journal of Endocrinology 187, 3; 10.1677/joe.1.06103
References
Acierno JS, Shagoury JK, Bo-Abbas Y, Crowley WF Jr & Seminara SB 2003 A locus for autosomal recessive idiopathic hypogonadotropic hypogonadism on chromosome 19p13.3. Journal of Clinical Endocrinology and Metabolism 88 2947–2950.
Albuisson J, Pecheux C, Carel JC, Lacombe D, Leheup B, Lapuzina P, Bouchard P, Legius E, Matthijs G, Wasniewska M, Delpech M, Young J, Hardelin JP & Dode C 2005 Kallmann syndrome: 14 novel mutations in KAL1 and FGFR1 (KAL2). Human Mutation 25 98–99.
Beranova M, Oliveira LM, Bedecarrats GY, Schipani E, Vallejo M, Ammini AC, Quintos JB, Hall JE, Martin KA, Hayes FJ, Pitteloud N, Kaiser UB, Crowley WF Jr & Seminara SB 2001 Prevalence, phenotypic spectrum, and modes of inheritance of gonadotropin-releasing hormone receptor mutations in idiopathic hypogonadotropic hypogonadism. Journal of Clinical Endocrinology and Metabolism 86 1580–1588.
Bertherat J & Gimenez-Roqueplo AP 2005 New insights in the genetics of adrenocortical tumors, pheochromocytomas and paragangliomas. Hormone and Metabolism Research 37 384–390.
Bick D, Franco B, Sherins RJ, Heye B, Pike L, Crawford J, Maddalena A, Incerti B, Pragliola A, Meitinger T & Ballabio A 1992 Intragenic deletion of the KALIG-1 gene in Kallmann’s syndrome. New England of Journal Medicine 25 1752–1755.
Corradi A, Croci L, Broccoli V, Zecchini S, Previtali S, Wurst W, Amadio S, Maggi R, Quattrini A & Consalez GG 2003 Hypogonadotropic hypogonadism and peripheral neuropathy in Ebf2-null mice. Development 130 401–410.
Culbertson R 1999 RNA surveillance – unforeseen consequences for gene expression, inherited genetic disorders and cancer. Trends in Genetics 15 74–80.
Davidson TM & Murphy C 1997 Rapid clinical evaluation of anosmia. Archives of Otolaryngology – Head and Neck Surgery 123 591–594.
de Roux N, Young J, Misrahi M, Genet R, Chanson P, Schaison G & Milgrom E 1997 A family with hypogonadotropic hypogonadism and mutations in the gonadotropin releasing hormone receptor. New England Journal of Medicine 337 1597–1602.
de Roux N, Acierno JS, Houang M, Derbois D, Matsuda F, Meysing AU, Pugeat M, Le Bouc Y, Crowley WF Jr, Kelly P & Seminara S 2004 An unique short 3′ duplication of the coding sequence of the GPR54 ligand identified in a large cohort of isolated hypogonadotropic hypogonadism patients. ENDO 2004, Endocrine Society’s 86th Annual Meeting, New Orleans, LA, USA. http://www.endo-society.org/scimeetings/endo2004/index.cfm.
de Roux N, Genin E, Carel JC, Matsuda F, Chaussain JL & Milgrom E 2003 Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. PNAS 100 10972–10976.
Dodé C, Levilliers J, Dupont J-M, De Paepe A, Dû NL, Soussi-Yanicostas N, Coimbra RS, Delmaghani S, Compain-Nouaille S, Baverel F, Pêcheaux C, Le Tessier D, Cruaud C, Delpech M, Speleman F, Vermeulen S, Amalfitano A, Bachelot Y, Bouchard P, Cabrol S, Carel J-C, Delemarrevan der Waal H, Goulet-Salmon B, Kottler A-L & Richard O 2003 Loss-of-function mutations in FGFR1 cause autosomal dominant Kallmann syndrome. Nature Genetics 33 463–465.
Franco B, Guioli S, Pragliola A, Incerti B, Bardoni B, Tonlorenzi R, Carrozzo R, Maestrini E, Pieretti M, Taillon-Miller P, Brown CJ, Willard HF, Lawrence C, Persico MG, Camerino G & Ballabio A 1991 A gene deleted in Kallmann’s syndrome shares homology with neural cell adhesion and axonal path-finding molecules. Nature 353 529–536.
Georgopoulos NA, Pralong FP, Seidman CE, Seidman JG, Crowley WF Jr & Vallejo M 1997 Genetic heterogeneity evidenced by low incidence of KAL-1 gene mutations in sporadic cases of gonadotropin-releasing hormone deficiency. Journal of Clinical Endocrinology and Metabolism 82 213–217.
Gu WX, Colquhoun-Kerr JS, Kopp P, Bode HH & Jameson JL 1998 A novel aminoterminal mutation in the KAL-1 gene in a large pedigree with X-linked Kallmann syndrome. Molecular Genetics and Metabolism 6 59–61.
Hardelin J-P, Levilliers J, del Castillo I, Cohen-Salmon M, Legouis R, Blanchard S, Compain S, Bouloux P, Kirk J, Morainet C, Chaussain JL, Weissenbach J & Petit C 1992 X chromosome-linked Kallmann syndrome: stop mutations validate the candidate gene. PNAS 89 8190–8194.
Hardelin J-P, Levilliers J, Blanchard S, Carel JC, Leutenegger M, Pinard-Bertellettom JP, Bouloux P & Petit C 1993 Heterogeneity in the mutations responsible for X chromosome-linked Kallmann syndrome. Human Molecular Genetics 2 373–377.
Izumi Y, Tatsumi K, Okamoto S, Hosokawa A, Ueno S, Fukui H & Amino N 1999 A novel mutation of the KAL-1 gene in Kallmann syndrome. Endocrinology Journal 46 651–658.
Jansen C, Hendriks-Stegeman BI & Jansen M 2000 A novel nonsense mutation of the KAL gene in two brothers with Kallmann syndrome. Hormone Research 53 207–212.
Kakar SS, Musgrove LC, Devor DC, Sellers JC & Neill JD 1992 Cloning, sequencing, and expression of human gonadotropin releasing hormone (GnRH) receptor. Biochemical and Biophysical Research Communications 30 289–395.
Karges B, Karges W & de Roux N 2003 Clinical and molecular genetics of the human GnRH receptor. Human Reproduction Update 6 523–530.
Kirk JM, Grant DB, Besser GM, Shalet S, Quinton R, Smith CS, White M, Edwards O & Bouloux PM 1994 Unilateral renal aplasia in X-linked Kallmann’s syndrome. Clinical Genetics 46 260–262.
Kramer PR & Wray S 2000 Novel gene expressed in nasal region influences outgrowth of olfactory axons and migration of luteinizing hormone-releasing hormone (LHRH) neurons. Genes and Development 14 1824–1834.
Kramer PR & Wray S 2001 Nasal embryonic LHRH factor (NELF) expression within the CNS and PNS of the rodent. Gene Expression Patterns 1 23–26.
Layman LC 2002 Human gene mutations causing infertility. Journal of Medical Genetics 39 153–161.
Layman LC, Cohen DP, Jin M, Xie J, Li Z, Reindollar RH, Bolbolan S, Bick DP, Sherins RR, Duck LW, Musgrove LC, Sellers JC & Neill JD 1998 Mutations in gonadotropin releasing hormone receptor gene cause hypogonadotropic hypogonadism. Nature Genetics 18 14–15.
Legouis R, Hardelin JP, Levilliers J, Claverie J-M, Compain S, Wunderle V, Millasseau P, Le Paslier D, Cohen D, Caterina D, Bougueleret L, Dlemarrevan der waal H, Lutfalla G, Weissenbach J & Petit C 1991 The candidate gene for the X-linked Kallmann syndrome encodes a protein related to adhesion molecules. Cell 67 423–435.
Massin N, Pêucheux C, Eliot C, Bensinmon J-L, Galey J, Kuttenn F, Hardelin J-P, Dodé C & Touraine P 2003 X chromosome-linked Kallmann syndrome: clinical heterogeneity in three siblings carrying an intragenic deletion of KAL-1 gene. Journal of Clinical Endocrinology and Metabolism 88 2003–2008.
Matsuo T, Okamoto S, Izumi Y, Hosokawa A, Takegawa T, Fukui H, Tun Z, Honda K, Matoba R, Tatsumi K & Amino N 2000 A novel mutation of the KAL 1 gene in monozygotic twins with Kallmann syndrome. European Journal of Endocrinology 143 783–787.
Maya-Nunez G, Zenteno JC, Ulloa-Aguirre A, Kofman-Alfaro S & Mendez JP 1998 A recurrent missense mutation in the KAL-1 gene in patients with X-linked Kallmann’s syndrome. Journal of Clinical Endocrinology and Metabolism 83 1650–1653.
Mayston MJ, Harrison LM, Quinton R, Stephens JA, Krams M & Bouloux PM 1997 Mirror movements in X-linked Kallmann s syndrome. I. A neurophysiological study. Brain 120 1199–1216.
Miura K, Acierno JS Jr & Seminara SB 2004 Characterization of the human nasal embryonic LHRH factor gene, NELF, and a mutation screening among 65 patients with idiopathic hypogonadotropic hypogonadism (IHH). Journal of Human Genetics 49 265–268.
Nagata K, Yamomoto T, Chikumi H, Ikeda T, Yamamoto H, Hashimoto K, Yoneda K, Nanba E, Ninomiya H & Ishitobi K 2000 A novel interstitial deletion of KAL-1 in a Japanese family with Kallmann syndrome. Journal of Human Genetics 45 237–240.
Oliveira LM, Seminara SB, Beranova M, Hayes FJ, Valkenburgh SB, Schipani E, Costa EM, Latronico AC, Crowley WF Jr & Vallejo M 2001 The importance of autosomal genes in Kallmann syndrome: genotype-phenotype correlations and neuroendocrine characteristics. Journal of Clinical Endocrinology and Metabolism 86 1532–1538.
Parenti G, Rizzolo MG, Ghezzi M, Di Maio S, Sperandeo MP, Incerti B, Franco B, Ballabio A & Andria G 1995 Variable penetrance of hypogonadism in a sibship with Kallmann syndrome due to a deletion of the KAL gene. American Journal of Medical Genetics 57 476–478.
Quinton R, Duke VM, Priyal A, Zoysa PA, Platis AD, Valentine A, Kendall B, Pickman S, Kirk JMW, Besser GM, Jacobs HS & Bouloux PMG 1996 The neuroradiology of Kallmann’s syndrome: a genotypic and phenotypic analysis. Journal of Clinical Endocrinology and Metabolism 81 3010–3017.
Sambrook J, Fritsch EF & Maniatis T 1989 Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sato N, Katsumata N, Kagami M, Hasegawa T, Hori N, Kawakita S, Minowada S, Shimotsuka A, Shishiba Y, Yokozawa M, Yasuda T, Nagasaki K, Hasegawa D, Hasegawa Y, Tachibana K, Naiki Y, Horikawa R, Tanaka T & Ogata T 2004 Clinical assessment and mutation analysis of Kallmann syndrome 1 (KAL1) and fibroblast growth factor receptor 1 (FGFR1, or KAL2) in five families and 18 sporadic patients. Journal of Clinical Endocrinology and Metabolism 89 1079–1088.
Schwanzel-Fukuda M & Pfaff DW 1989 Origin of luteinizing hormone-releasing hormone neurons. Nature 338 161–164.
Shenker A, Weinstein LS, Sweet DE & Spiegel AM 1994 An activating Gs alpha mutation is present in fibrous dysplasia of bone in the McCune-Albright syndrome. Journal of Clinical Endocrinology and Metabolism 79 750–755.
Söderlund D, Canto P & Méndez JP 2002 Identification of three novel mutations in the KAL1 gene in patients with Kallmann syndrome. Journal of Clinical Endocrinology and Metabolism 87 2579–2582.
Trarbach EB, Baptista MTM, Maciel-Guerra A & Hackel C 2001 Cytogenetics analysis and detection of KAL-1 gene deletion with fluorescence in situ hybridization. Arquivos Brasileiros de Endocrinologia e Metabolismo 45 552–557.
Trarbach EB, Monlleo IL, Porciuncula CGG, Fontes MIB, Baptista MTM & Hackel C 2004 Similar interstitial deletions of the KAL-1 gene in two Brazilian families with X-linked Kallmann syndrome. Genetics and Molecular Biology 27 337–341.
