Abstract
Mouse models of adrenal tumorigenesis have the potential to give insights in the dysregulation of adrenal growth and differentiation. The inbred mouse strain CE/J has been reported to develop adrenal tumors upon gonadectomy (GDX) similar to mice with targeted deletions of the inhibin alpha subunit (Inh−/−). We performed a detailed morphological and molecular characterization of adrenal glands from CE/J mice 8–50 weeks of age to define the cellular origin of these tumors as well as the spatial and temporal expression of marker genes associated with tumor growth. In contrast to the induction of x-zone growth upon GDX in Inh−/− mice, GDX in CE/J mice induced the appearance of sub-capsular nests of densely packed cells that progress into adrenal tumors. Staining for proliferative cell nuclear antigen confirms a substantial increased in cellular proliferation within this sub-capsular compartment and lack of apoptosis upon GDX. Induction of adrenal tumor growth was accompanied by transcriptional changes that otherwise define gonadal endocrine cells. These regulated genes included transcription factors such as GATA-4, WT-1, FOG-1, and steroidogenic factor-1 (SF-1), peptide hormones such as Mullerian-inhibiting substance (MIS), hormone receptors including luteinizing hormone and MIS receptor, and steroidogenic enzymes such as P450c17 and P450 aromatase. The functional significance of steroid enzyme expression was demonstrated by a gradual increase of adrenal androgens after GDX. Taken together these data suggest that adrenal tumors in gonad-ectomized CE/J mice are direct derivatives from cells of the proposed sub-capsular stem cell zone. The distinct expression pattern of this cell population is consistent with a defect in the differentiation of these cells into a cell population with functional properties that otherwise define a gonadal endocrine phenotype.
Introduction
Adrenal masses are one of the most common endocrine tumors diagnosed. Although most adrenal tumors are endocrine-inactive adenomas, a considerable proportion are associated with hormonal hyperfunction (Barzon et al. 2002) or malignancy (Mantero et al. 2000). Over the last decade, several molecular pathways involved in adrenal carcinogenesis have been identified, and mouse models of adrenal tumorigenesis have aided substantially in the understanding of basic mechanisms in the regulation of adrenocortical growth and differentiation. However, early steps in the pathogenesis of adrenal tumors have not been elucidated in detail.
Only recently, murine adrenal tumor models have provided evidence that luteinizing hormone (LH) and the transforming growth factor-β (TGF-β) ligand family members inhibin and activin play opposite roles in adrenocortical hormone secretion and cellular proliferation (Rilianawati et al. 1998, Kero et al. 2000, Beuschlein et al. 2003). Transgenic overexpression of LH induces adrenal steroidogenesis (Kero et al. 2000) and high levels of gonadotropins are required for the induction of adrenal tumorigenesis in different mouse models (Matzuk et al. 1994, Rilianawati et al. 1998). One of these models, which has provided a significant amount of information on the mechanistic roles of inhibin and activin in the adrenal, is the inhibin null (Inh−/−) mouse, which spontaneously develops activin-secreting gonadal tumors and adrenocortical carcinomas upon gonadectomy (GDX) (Matzuk et al. 1994). As we have demonstrated, the adrenal phenotype in Inh−/− mice is indicative of x-zone growth dysregulation. Development of activin-secreting gonadal tumors in Inh−/− mice is accompanied by a decrease in adrenal weight and regression of the x-zone. Activin, which plays a critical role as a paracrine and autocrine factor regulating cellular growth and differentiation, has been demonstrated to induce apoptosis and suppress proliferation in the human (Spencer et al. 1992, 1999) and murine adrenal cortex (Beuschlein et al. 2003). The ultimate cause of this regression in the murine adrenal cortex is the distinct x-zonal expression pattern of activin receptor subunits and the intracellular mediator Smad-2, which results in a particular responsiveness of the x-zone to activin. As a result, high levels of activin induce apoptosis specifically in the adrenal x-zone, thus preventing adrenal tumorigenesis in the presence of activin-secreting gonadal tumors. Conversely, the surgical removal of activin-secreting gonadal tumors in Inh−/− is followed by unopposed x-zone growth and ultimately by the development of adrenal tumors (Beuschlein et al. 2003).
The CE/J strain of mice, which bases on the extreme dilution strain established and maintained since 1920, has been characterized on a morphological basis in the 1940s. Intriguingly, the CE/J strain shares several phenotypical similarities with the Inh−/− mouse. Like Inh−/− mice, the CE/J strain is characterized by the occurrence of adrenocortical carcinoma when GDX is performed early in life (Woolley & Little 1945). In addition, morphological studies on accessory reproductive organs in gonadectomized CE/J mice have provided indirect evidence for the secretion of sex steroids from the adrenal tumors (Woolley & Little 1946a). Since adrenal tumors in gonadectomized Inh−/− mice secrete sex steroids (Beuschlein et al. 2003), the adrenal phenotype in CE/J mice points towards a dysregulation of x-zone growth after GDX as the basis of adrenal tumor growth. However, based on the early morphological studies (Woolley & Little 1946b) and recent reports on similar phenotypes in other inbred mouse strains (Bielinska et al. 2003, 2005), it seems likely that the precursor of tumor cells in CE/J mice are located in the sub-capsular zone of the adrenal cortex.
The adrenal cortex is a dynamic organ in which senescing cells are constantly replaced by newly differentiated daughter cells. According to the cell migration model, each zone of the adrenal cortex is derived from a common pool of progenitor cells located in the periphery of the cortex, which migrates centripetally and populates the inner cortical zones upon differentiation (Belloni et al. 1978, Spencer et al. 1999). The characteristic zonation of the adrenal cortex in cellular compartments with distinct functional properties is tightly controlled to ensure structural plasticity of the adrenal cortex and to maintain hormonal homeostasis. We hypothesized that dysregulation of adrenal stem cell proliferation and differentiation could be the basis of adrenal tumorigenesis in CE/J mice and undertook a detailed morphological and functional characterization of the adrenal phenotype of these mice.
Materials and Methods
Experimental animals
All experiments involving animals were performed in accordance with institutionally approved and current animal care guidelines. Male CE/J mice were obtained by breeding mice of the inbred CE/J background (Jackson Immuno-Research Laboratories, West Grove, PA, USA), while Inh−/− mice were generated by breeding of heterozygous animals (Inh+/−) on an extensively outbred strain. Genotyping was performed as described earlier (Matzuk et al. 1994). All animals were maintained under standard conditions of temperature (22 °C) and lighting (12 h light:12 h darkness) and ad libitum with food and water. To obtain a time-course of the testicular and adrenal phenotype of gonadectomized and non-gonadectomized CE/J mice, a group of mice (n = 3–4) was euthanized at 8, 14, 20, 26, 38, and 44 weeks of age, while another group of mice (n = 3–4) was gonadectomized at 2 weeks of age following the standard procedures and euthanized at the same time points. Accordingly, Inh−/− and wild-type controls were gonadectomized at 2–4 weeks of age and euthanized at 19–27 weeks. Non-gonadectomized controls of each genotype were euthanized at 9 weeks of age. Trunk blood for hormonal measurements was taken within 60 s after initial mouse handling and adrenals and testes were collected. Following microdissection, adrenal and testicular weights were measured and the tissues were snap frozen for protein/RNA extraction or immersed in para-formaldehyde (PFA) or Bouin’s fixative for histological studies.
Reverse transcription (RT)-PCR and real-time PCR
Individual adrenals from 44-week-old gonadectomized and non-gonadectomized CE/J mice (n = 2 in each group) as well as the adrenals of the non-GDX and GDX Inh−/−knockout and Inh+/+ controls (n = 2 in each group) were used for RNA extraction using the Qiagen RNA mini kit (Qiagen) following the instructions of the manufacturer. cDNA was created from 1.0 μg of total RNA using a reverse transcription kit (Promega). Aliquots of the cDNA samples were subjected to the subsequent PCR for semi- and to real-time PCR for quantitative measurements of mRNA levels. RT-PCR and real-time PCR amplifications were performed with the corresponding primer pairs, as given in Table 1.
The PCR was carried out using the Advantage 2 Polymerase Mix (BD Biosciences, Heidelberg, Germany) with 32–35 cycles of denaturation at 94 °C for 20 s, primer annealing and extension at 68 °C for 20 s. Amplification products were separated on a 1% agarose gel and stained with ethidium bromide.
Real-time PCR was performed using the FastStart DNA MasterPlus SYBR Green I reaction mix and the FastStart Taq DNA Polymerase (Roche) or the SYBR Premix Ex Taq (Cambrex, Baltimore, MD, USA) in an appropriate LightCycler. The real-time PCR conditions started with a preincubation at 95 °C for 10 min, followed by the amplification of 40–45 cycles at 95 °C for 10 s, the annealing temperature (primer dependent as given in Table 1) for 6 s and the extension at 72 °C, at which the time is calculated by the product in bp divided by 25 (Roche) or was run as a three-step PCR following the instructions of the manufacturer (Cambrex).
The melting curve analysis was performed between 65 and 95°C (0.1 °C/s) to determine the Tm of the amplified product and to exclude undesired primer dimers. Furthermore, the products were run on a 1% agarose gel to verify the amplified product.
Quantification was adjusted using the house-keeping gene β2-microglobulin as well as 18 s rRNA. In both instances, comparable results were obtained. To facilitate overall comparison, expression levels of the particular genes were set as 100% for non-GDX control animals (non-GDX CE/J mice and non-GDX Inh+/+ respectively), even though in some cases, the expression levels were not distinct from the value of the water-negative control.
Histology, immunohistochemistry, and in situ hybridization
Adrenal glands and testes were rapidly dissected and placed in 4% PFA for 3 h and Bouin’s fixative overnight respectively. Tissues for histochemistry (n = 3 per group) were dehydrated, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E) following the standard protocols. H&E stained adrenal sections were examined with a standard light microscope using 50× magnification. Areas of the total cortex, the adrenal x-zone, and tumor areas were quantified using the Spot software (Diagnostic Instruments, Sterling Heights, MI, USA) as described elsewhere (Beuschlein et al. 2003). In brief, to ensure a reliable comparison between the specimens, three adjacent sections from the middle portion of each individual adrenal were examined. In order to control for the spherical shape of the mouse adrenal gland, the x-zonal area and tumor area were normalized for the total cortical area and were expressed as the x-zone/total cortical area ratio and tumor/total area ratio, respectively.
For proliferative cell nuclear antigen (PCNA) and CYP17 immunohistochemistry, paraffin-embedded sections were rehydrated, blocked with 0.3% H2O2 in methanol for 10 min, and incubated with blocking buffer for 15 min. PCNA was immunolocalized overnight at 4 °C by means of a rabbit polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) in a dilution of 1:100 in blocking buffer containing 3% BSA (Roche), 5% goat serum (Jackson ImmunoResearch Laboratories), and 0.5% Tween 20, whereas CYP17 (courtesy of Dr Anita Payne, Stanford University, Palo Alto, CA, USA) was diluted 1:200 in blocking buffer. After rinsing for 15 min in PBS, secondary antibody (goat antirabbit biotinylated IgG (Vector Laboratories, Burlingame, CA, USA)) was applied for 30 min at room temperature. For the visualization of the bound CYP17 antibody, Vectastain Elite ABC system (Vector Laboratories) and Sigma Fast diaminobenzidine (Sigma) were used. Bound PCNA antibody was detected using the Santa Cruz Immunocruz Kit (Santa Cruz Biotechnology) according to the manufacturer’s protocol. Presence of apoptotic cells was assayed using a terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) detection kit (Promega) as recommended by the manufacturer.
PCNA and TUNEL stained adrenal sections from both groups were examined with a standard light microscope using 400× magnification. Stained cell nuclei within the zona glomerulosa and outer zona fasciculata of three independent sections from two different animals per group were counted under standardized conditions. Cell counts are expressed as cell number/high power fields (HPF).
To analyze the mRNA expression of CYP17 and LH-receptor (LH-R), the paraffin-embedded sections were subjected to in situ hybridization as described previously (Beuschlein et al. 2004).
Plasma hormone measurements
Plasma steroid levels (dehydroepiandrosterone (DHEA), and testosterone) were measured using stable isotope dilution/gas chromatography–mass spectrometry as described earlier (Wudy et al. 2002).
Statistical analysis
All results are expressed as mean ± s.e.m. Statistical comparisons were analyzed by ANOVA and Fisher’s protective least significant difference test. Statistical significance is defined as P < 0.05 and is indicated as a star (*) in the figures.
Results
Male CE/J mice do not develop testicular tumors and do not suffer from wasting syndrome
As mice of the inbred CE/J strain have been reported to develop adrenal tumors upon GDX (Woolley & Little 1946b), they share phenotypical similarities with Inh−/− mice. Another characteristic of Inh−/− is the spontaneous development of activin-secreting gonadal tumors that result in the early death of the animals due to a wasting-like syndrome (Zajicek et al. 1986, Matzuk et al. 1994). However, unlike Inh−/− mice, testicular weight in CE/J mice did not change substantially during lifetime (8 weeks, 112.7 ± 5.0 mg; 14 weeks, 108.3 ± 0.7 mg; 20 weeks, 111.5 ± 5.2 mg; 26 weeks, 126.0 ± 11.0 mg; 38 weeks, 127.3 ± 7.6 mg; 44 weeks, 125.3 ± 3.8 mg; Fig. 1, lower panel) and no histological evidence of testicular tumor growth was detectable in anyof the animals (Fig. 1, upper panel). CE/J animals did not suffer from wasting syndrome and premature death (body weight: 8 weeks, 19.3 ± 0.5 g; 14 weeks, 22.7 ± 0.5 g; 20 weeks, 25.0 ± 1.0 g; 26 weeks, 30.0 ± 0.9 g; 38 weeks, 25.6 ± 0.7 g; 44 weeks, 28.3 ± 2.5 g; Fig. 1, lower panel) consistent with the lack of elevated gonadal activin.
Gonadectomy in CE/J mice results in development of sub-capsular tumor nests and delayed regression of the x-zone
Histological examination of adrenals from non-gonadectomized (w/o GDX) male CE/J mice proved the expected x-zone regression after the onset of puberty with a loss of the x-zone after 8 weeks of age (x-zone area/cortical area: 8 weeks, 21.6 ± 3.7%; 14–44 weeks, 0.0 ± 0.0%; Fig. 2A–E, L). In contrast, GDX was accompanied by a significantly larger x-zone area, compared to non-gonadectomized animals of the same age, that decreased gradually over a longer period of time (8 weeks, 29.3 ± 0.9%, P = 0.011; 14 weeks, 32.4 ± 3.7%, P < 0.0001; 20 weeks, 27.4 ± 1.0%, P < 0.0001; 26 weeks, 16.9 ± 1.6%, P < 0.0001; 38 weeks, 9.1 ± 1.3%, P = 0.031; 44 weeks, 6.7 ± 1.4%, P = 0.067; Fig. 2F–J, L). In addition, x-zone regression in gonadectomized animals was accompanied by the appearance of densely packed cell nests in the sub-capsular adrenal cortex that increased in size over time and eventually developed into a tumor (tumor area/cortical area: 20 weeks, 4.6 ± 0.6%; 26 weeks, 7.0 ± 0.4%; 38 weeks, 19.6 ± 0.4%; 44 weeks, 31.5 ± 2.1%; Fig. 2H–J). These results demonstrate that GDX-induced adrenocortical tumors in CE/J mice are situated within the sub-capsular zone, unlike adrenal tumors in Inh−/− mice, which are situated within or contiguous to the x-zone. Overall, GDX resulted in a small, albeit significant higher adrenal weight at each time point (8 weeks, 5.8 ± 0.4 mg, P = 0.02; 14 weeks, 6.6 ± 0.3 mg, P = 0.0008; 20 weeks, 6.4 ± 0.0 mg, P = 0.009; 26 weeks, 6.7 ± 0.7 mg, P = 0.003; 38 weeks, 8.5 ± 0.6 mg, P < 0.0001; 44 weeks, 8.8 ± 0.5 mg, P < 0.0001) as compared to non-gonadectomized animals (8 weeks, 4.4 ± 0.5 mg; 14 weeks, 4.6 ± 0.4 mg; 20 weeks, 4.8 ± 0.2 mg; 26 weeks, 4..2 ± 0.2 mg; 38 weeks, 4.7 ± 0.1 mg; 44 weeks, 4.8 ± 0.2 mg; Fig. 2K). Moreover, tumor -development in gonadectomized mice was accompanied by a significant increase in adrenal weight in comparison to earlier time points (adrenal weight 8 weeks, 5.8 ± 0.4 mg vs 38 weeks, 8.5 ± 0.6 mg, P = 0.0003 and 44 weeks, 8.8 ± 0.5 mg, P < 0.0001 respectively).
Gonadectomy in CE/J mice is followed by an increase in sub-capsular adrenocortical proliferation and lack of adrenocortical apoptosis
To further define the underlying growth dysregulation in the adrenal cortices of gonadectomized CE/J mice and in an attempt to delineate the cellular origin of the developing adrenal tumors, we determined the number and distribution of proliferating and apoptotic cells in adrenals from non-gonadectomized (w/o GDX) and gonadectomized (GDX) CE/J mice. In accordance with the observed tumor development in the sub-capsular zone, PCNA-positive cells were mainly restricted to the sub-capsular cells (Fig. 3C and D) with a significant higher number of proliferating cells (20 weeks, 200.3 ± 16.6; 38 weeks, 810.0 ± 72.7) in comparison to non-gonadectomized animals (20 weeks, 41.7 ± 4.6, P = 0.0008; 38 weeks, 56.0 ± 11.2, P < 0.0001; Fig. 3A and B). In contrast, the number of apoptotic cells per high power field was not different after GDX (20 weeks, 10.0 ± 1.5; 38 weeks, 8.7 ± 7.2; Fig. 3G and H) as compared to non-gonadectomized animals at these time points (20 weeks, 7.7 ± 2.7, P = 0.74; 38 weeks, 3.3 ± 0.7, P = 0.47; Fig. 3E and F). Intriguingly, the tumor cell population which is characterized by high proliferation showed virtually no apoptotic cells (Fig. 3H, insert). Taken together, these results indicate that GDX is followed by high proliferation of the sub-capsular cell population, which results in the unopposed growth of tumor cells.
Adrenal tumors in gonadectomized CE/J and Inh−/− mice express gonadal marker genes and secrete sex steroids
To further define the functional properties of adrenal tumors in gonadectomized CE/J mice, we determined the expression pattern of a variety of marker genes. Interestingly, adrenal tumors in CE/J mice express a distinct pattern of steroidogenic enzymes, including 17α-hydroxylase (P450c17; non-GDX 100.0 ± 7.1% vs GDX 3756.3 ± 75.4%, P < 0.0001) and aromatase (P450c19; non-GDX 100.0 ± 31.7% vs GDX 1800.0 ± 200.0%, P = 0.001), peptide hormone such as Mullerian-inhibiting substances (MISs; P = 0.0012), and hormone receptors including LH-R (P = 0.0008) and MIS receptor (P < 0.0001) that otherwise define gonadal endocrine function. In addition, transcription factors such as GATA-4 (P = 0.0005), Wilms tumor gene-1 (WT-1; P < 0.0001), and steriodogenic factor-1 (SF-1; P = 0.0029) were significantly up-regulated after GDX, while other transcription factors such as FOG-1 (P < 0.0001) and GATA-6 (P = 0.0004) were down-regulated. In contrast, Sox-8 and DAX-1 did not significantly different between the groups (Fig. 4A and B).
As demonstrated in Fig. 4C, a similar expression profile was present in adrenal tumors from gonadectomized Inh−/− animals with significant increase of GATA-4, MIS receptor, CYP17, and CYP19. In contrast, no significant changes in the expression pattern of these genes were evident in gonadectomized wild-type controls, indicating that in addition to GDX, transcriptional activation of these genes is dependent on adrenal tumorigenesis.
To localize some of the up-regulated genes, in situ hybridization and immunohistochemistry were performed, which demonstrated expression of P450c17 and LH-R expression restricted to the tumor cells (Fig. 5C and I) and lack of expression in adjacent areas of morphologically normal adrenal cortex (Fig. 5B and H). To investigate the functional significance of the expression pattern of steroidogenic enzymes, hormonal profiles of gonadectomized CE/J mice were determined. The detected increase of the adrenal androgen DHEA (Fig. 5J) as well as testosterone (Fig. 5K) during the time-course experiment in gonadectomized CE/J mice is in line with the presence of functional active 17α-hydroxylase/17,20 lyase activity in adrenal tumors.
Taken together, these data demonstrate the expression of distinct transcription factors, receptors, and steroidogenic enzymes otherwise expressed in gonadal endocrine cells suggesting a differentiation defect as part of the adrenal phenotype in gonadectomized CE/J mice.
Discussion
The overall similar adrenal phenotype of Inh−/− mice and CE/J mice–induction of adrenal tumorigenesis by GDX–prompted us to compare morphological and molecular alterations initiated by surgical GDX in adrenal glands in these two animal models. As we demonstrate, GDX in CE/J mice is accompanied by development of sub-capsular tumor nests that are characterized by a high proliferation index as measured by PCNA staining. These findings provide evidence that in contrast to Inh−/− mice, which are characterized by tumor growth within or contiguous to the adrenal x-zone (Beuschlein et al. 2003), adrenal tumors in CE/J mice derive from the sub-capsular zone of the adrenal cortex similar to other susceptible strains of mice (Bielinska et al. 2003, 2005). The shared gonadal-like phenotype of the adrenal tumors in both strains, and the clear involvement of the x-zone in Inh−/− mice indicate that both tumors arise from defects in the differentiation and maturation of x-zone cells. However, the results from our present study suggest that adrenal tumorigenesis in CE/J mice reflects dysregulation at an earlier stage that also includes a migration defect of cells descent to be x-zone cells. Indeed, an increasing body of evidence indicates that a common pool of stem cells that reside in this sub-capsular cellular compartment is likely to play a key role for adrenal physiology as distributors of all adrenocortical cells that migrate centripetally upon differentiation (Zajicek et al. 1986, Kataoka et al. 1996). Thus, adrenal tumorigenesis in CE/J mice might be of particular interest as a model of adrenal stem cell dysregulation.
The physiologic role of the murine adrenal x-zone, which becomes evident histologically at 10–14 days of age and subsequently begins to degenerate in males, coinciding with sexual maturity (Howard-Miller 1928), is not defined. In accordance with earlier findings demonstrating prevention of x-zone degeneration in male mice by castration (Howard-Miller 1928, Beuschlein et al. 2003), GDX delays x-zone degeneration and induces adrenal tumor formation in both strains of mice. In addition, at later time points, when adrenal tumors develop, the x-zone cross-sectional area gradually decreases, indicating that the development of adrenal tumors might directly or indirectly affect x-zone growth. Indeed, in Inh−/− mice, the pathological regression of the x-zone is induced by high levels of tumoral activin that result in selective apoptosis of x-zone due to their unique expression of activin receptors and the downstream effector Smad-2 (Beuschlein et al. 2003). In contrast, adrenal tumors in CE/J mice do not display elevated activin mRNA levels (data not shown), indicating that in this mouse, model high levels of activin are not required for the observed tumor-induced x-zone regression. In fact, the role of activin for physiological x-zone regression during puberty in male mice and during first pregnancy in female animals remains unproven. Other potential candidates involved in this process include sex steroids and gonadotropins (Howard-Miller 1928). Since the murine adrenal cortex is deprived of a functional equivalent of the zona reticularis and lacks expression of P450c17, the mouse adrenal does not secrete adrenal androgens. However, adrenal tumors in CE/J mice not only express steroid enzymes required for sex-steroid production, but also adrenal tumor development is accompanied by increasing levels of serum DHEA and testosterone. Thus, sex steroids secreted by the adrenal tumors or secondary suppression of gonadotropins could be responsible for x-zone regression in these animals.
During development, numerous transcriptional cascades are utilized to ensure tight control over cellular proliferation and proper spatio-temporal expression of target genes. A gonadal specific target gene which is expressed in adrenal tumors of CE/J mice is the Mullerian-inhibiting substance (MIS), a glycoprotein dimer that–like inhibin and activin–belongs to the TGF-β super-family (Lee & Donahoe 1993). Secretion of MIS by fetal sertoli cells is essential for normal male sex differentiation, since it induces regression of the Mullerian ducts in the developing male embryo. The specific expression in sertoli and granulosa cells has provided even diagnostic usefulness of the MIS gene for sub-classification of gonadal tumors (Rey et al. 2000). The gonadal restricted expression of the MIS gene requires a specific combination of transcription factors, including the zinc finger factor GATA-4 and the nuclear receptor SF-1, as well as Sox-9 and WT-1 (De Santa Barbara et al. 1998, Nachtigal et al. 1998, Viger et al. 1998).
WT-1 is a zinc finger-containing transcription factor, which has been implicated in the development of the indifferent gonad prior to sexual differentiation as well as in the etiology of certain neoplasia. Interestingly, GATA-4 together with WT-1 is up-regulated in adrenal tumors from gonadectomized CE/J mice. Thus, adrenal tumors in gonadectomized CE/J mice resemble the expression pattern of transcription factors required for the expression of MIS in sertoli cells. In vivo and in vitro data suggest a pathway in which the products of the WT-1 and Lhx-9 genes activate expression of SF-1 and thus mediate early gonadogenesis (Wilhelm & Englert 2002). As SF-1 levels are slightly up-regulated in adrenals from gonadectomized CE/J mice, these data are in line with the concept of transcriptional activation of the SF-1 promoter by WT-1 as part of the dedifferentiation in these adrenal tumors.
The friend of GATA proteins (FOG: FOG-1 and FOG-2) can act as either enhancers or repressors of GATA transcriptional activity, depending on the cell and promoter context. It has been reported that the FOG proteins are co-expressed with GATA factors in testicular cells in which they differentially repress the promoter activities of several GATA-dependent target genes (Robert et al. 2002). Intriguingly, FOG-1 expression is down-regulated in adrenal tumors from gonadectomized CE/J mice, in line with the concept of loss of repression of GATA-dependent transcriptional activation of target genes such as LH-R, CYP17, and CYP19 (Bielinska et al. 2003, 2005).
Although CE/J mice carry a polymorphism in the gene encoding SF-1 (SF-1S172, data not shown), which has been associated with lower steroidogenic capacity and possibly higher susceptibly of GDX-induced adrenal tumorigenesis (Bielinska et al. 2003), it remains unclear from the data presented herein, which steps are the initial dysregulated events that induce adrenal tumor formation in these animals. GDX induces both a decrease of gonadal hormones (including inhibin and sex steroids) and an increase of gonadotropins (including LH). Chronically elevated levels of LH have been demonstrated to induce adrenal LH-R expression (Kero et al. 2000, Beuschlein et al. 2003) and boost adrenal tumor growth (Beuschlein et al. 2003, Mikola et al. 2003), depending on the strain background or targeted genetic alterations. As we could demonstrate, activin, which is secreted from gonadal tumors in Inh−/− mice, leads to the induction of x-zone apoptosis, thus preventing the growth of x-zone derived adrenal tumors (Beuschlein et al. 2003). Since CE/J animals are not prone to spontaneous gonadal tumor growth, activin as a repressor of adrenal tumor growth is not likely to play a similar key role in the pathophysiology of CE/J mice. However, high levels of LH might be sufficient to cause the adrenal phenotype in CE/J mice, as seen after GDX, a hypothesis which will be tested by introducing transgenic LH overexpression on the CE/J background.
In conclusion, the dysregulation of adrenal growth in gonadectomized CE/J, DBA/2J (Bielinska et al. 2003), nude mice (Bielinska et al. 2005), and Inh−/− mice (Beuschlein et al. 2003) is accompanied by a differentiation defect that drives adrenocortical cell differentiation towards a gonadal phenotype. The LH dependency of adrenal tumorigenesis in these tumor models is reminiscent of the clinical situation in patients with chronically elevated levels of proopiomelano-cortin peptides due to steroid hydroxylase deficiencies, who develop adrenal rest tumors in the gonads (Stikkelbroeck et al. 2001). It is tempting to speculate that the ability of the adrenal stem cell population to mimic gonadal endocrine function might reflect the common embryological origin of adrenocortical and gonadal cells from adjacent areas of the urogenital ridge during early development (Smith & Mackay 1991). In fact, expression of P450c17 has been demonstrated in a specific spatio-temporal pattern in a distinct cell population of the developing mouse adrenal (Keeney et al. 1995), highlighting the concept of closely related progenitor cells in adrenal and gonadal development.
Primer sequences used in reverse transcription- and real time-PCR experiments
| Purpose | Sequence | Nucleotides | Annealing temp. | Reference | |
|---|---|---|---|---|---|
| Amplification product | |||||
| β2Microgl (fwd) | Real-time PCR | GCTATCCAGAAAACCCCTCAA | 64–363 | 60 °C | |
| ß2Microgl (rev) | CATGTCTCGATCCCAGTAGACGGT | ||||
| 18s rRNA (fwd) | Real-time PCR | GTAACCCGTTGAACCCCATT | 1579–1730 | 58 °C | |
| 18s rRNA (rev) | CCATCCAATCGGTAGTAGCG | ||||
| SF-1 (fwd) | Real-time PCR | TGCACTGCAGCTGGACCGCCAGGAGTT | 1248–1638 | 61 °C | |
| SF-1 (rev) | AGGGCTCCTGGATCCCTAATGCAAGGA | ||||
| Dax-1 (fwd) | RT-PCR | GTCAAGTACTTGCCCTGCTTCCA | 811–1323 | ||
| Dax-1 (rev) | GATGAATCTCAGCAGGAAAAGGGC | ||||
| Real-time PCR | TCCTGTACCGCAGCTATGTG | 604–941 | 58 °C | ||
| CTCGAAGTGCAGGTGATCTTG | |||||
| WT-1 (fwd) | RT-PCR | GGGGAAGCTTCCGCCATGGGTTCCGACGTGCGGGAC | 477–910 | (Wilhelm & Englert 2002) | |
| WT-1 (rev) | GGATGGTAGGCTGGCTCTCCAG | ||||
| Real-time PCR | GCC TTC ACC TTG CAC TTC TC | 271–704 | 62 °C | ||
| CAT TCA AGC TGG GAG GTC AT | |||||
| GATA-4 (fwd) | RT-PCR | GCCTGTATGTAATGCCTGCG | 1442–1938 | ||
| GATA-4 (rev) | CCGAGCAGGAATTTGAAGAGG | ||||
| Real-time PCR | TGTGCCAACTGCCAGACTAC | 1415–1859 | 60 °C | ||
| GCGATGTCTGAGTGACAGGA | |||||
| GATA-6 (fwd) | RT-PCR | GCAATGCATGCGGTCTCTAC | 1487–2041 | ||
| GATA-6 (rev) | CTCTTGGTAGCACCAGCTCA | ||||
| Real-time PCR | ATGCTTGCGGGCTCTATATG | 1652–1872 | 59 °C | ||
| TGA GGTGGTCGCTTGTGTAG | |||||
| FOG-1 (fwd) | RT-PCR | CGGGATCCCGGCGCAGCGGGAACACCCAC | 2067–2504 | (Robert et al. 2002) | |
| FOG-1 (rev) | CGGAATTCCGCAGTAGTAGCGCTTGTGC | ||||
| Real-time PCR | GCTATATG GCGCCTTGTCA | 943–1098 | 59 °C | ||
| TTGATGACTGCGGTAGCAAG | |||||
| Sox-8 (fwd) | RT-PCR | TGGAGTCTGGTGCCTATGCCTGT | 397–780 | (Schepers et al. 2000) | |
| Sox-8 (rev) | GCCGAGCACTGCATCAGCTTTGT | ||||
| Real-time PCR | GCTCAATGGGCTCTCTATGC | 1476–1821 | 58 °C | ||
| TATCCAAACCGGAGAGCAAC | |||||
| Sox-9 fwd) | RT-PCR | GCGTATGAATCTCCTGGACC | 369–902 | ||
| Sox-9 (rev) | GCGGCTGGTACTTGTAATCC | ||||
| Real-time PCR | TACGACTACGCTGACCATCAGAACT | 1673–2237 | 60 °C | ||
| GATTCTCCAATCGTCCTCCATGT | |||||
| MIS (fwd) | RT-PCR | GAGCTCTTGCTGAAGTTC | 426–658 | (Arango et al. 1999) | |
| MIS (rev) | CTGCTTGGTTGAAGGGTTAAG | ||||
| Real-time PCR | GGGGGGTCTGAACAGCTATGAGT | 221–453 | 60 °C | ||
| GAGGCTCTTGGAACTTCAGCAA | |||||
| MIS-R (fwd) | RT-PCR | TCCAGCTGGCATCCTTTTGC | 32–683 | (Mishina et al. 1996) | |
| MIS-R (rev) | TGACCTCCTTCCTGGATTAC | ||||
| Real-time PCR | CCTGGGAATGTTTCTCGTGT | 507–818 | 60 °C | ||
| CGAACGATATGGTCATGCTG | |||||
| LH-R (fwd) | RT-PCR | ATGGATCCCTCTCACCTATCTCCCTGT | 176–878 | (Beuschlein et al. 2003) | |
| LH-R (rev) | AGTCTAGATCTTTCTTCGGCAAATTCCTG | ||||
| Real-time PCR | CTCGCCCGACTATCTCTCAC | 168–618 | 58 °C | ||
| AGATTAGCGTCGTCCCATTG | |||||
| P450c17 (fwd) | RT-PCR | CGAAGCTTGGAACTTGTGGGTCTCTTGC | 6–1513 | (Beuschlein et al. 2003) | |
| P450c17 (rev) | CGCTCGAGAACCTCAACCTGTGCATCCT | ||||
| Real-time PCR | CAAGCCAAGATGAATGCAGA | 930–1367 | 60 °C | ||
| CATAAACCGATCTGGCTGGT | |||||
| P450arom (fwd) | RT-PCR | GACACATCATGCTGGACACC | 575–1297 | (Beuschlein et al. 2003) | |
| P450arom (rev) | CAAAGCCAAAAGGCTGAAAG | ||||
| Real-time PCR | ATGAACGATCCGTCAAGGAC | 731–1216 | 63 °C | ||
| ACTCGAGCCTGTGCATTCTT | |||||
| MSTAR (fwd) | Real-time PCR | GACCTTGAAAGGCTCAGGAAGAAC | 7–987 | 60 °C | |
| MSTAR (rev) | TAGCTGAAGATGGACAGACTTGC |
Male mice of the inbred strain CE/J do not develop testicular tumors and do not die from wasting syndrome. (A–C) Hematoxylin and eosin stained testicular sections from 8- to 44-week-old animals demonstrating regular morphology without evidence of tumor growth. (D) Time-course for body weight and testicular weight from male CE/J mice (n = 3–4) without indication of (tumor-induced) increase of testicular weight. Bars in (A–C) = 20 μm.
Citation: Journal of Endocrinology 190, 1; 10.1677/joe.1.06750
Time-course for adrenal morphology, weight, and zonal distribution in non-gonadectomized (w/o GDX; A–E) and gonadectomized (GDX; F–J) CE/J mice at 8 weeks (A, F), 14 weeks (B, G), 20 weeks (C, H), 38 weeks (D, I), and 44 weeks (E, J) of age. Whereas the x-zone regresses in non-gonadectomized mice within the first 14 weeks of age (A, B, L), it is retained in gonadectomized animals for a longer period of time before it gradually regresses (F–I, L). In gonadectomized mice, dense, sub-capsular tumor nests appear (H), which eventually develop into adrenocortical tumors (I, J). Bars in (A–J) = 100 μm. D, definitive zone; X, x-zone; M, medulla; T, tumor. Stars in (L) denote significant differences in x-zone area between gonadectomized and non-gonadectomized animals from the same age group.
Citation: Journal of Endocrinology 190, 1; 10.1677/joe.1.06750
Distribution of proliferating (PCNA immunohistochemistry; A–D) and apoptotic (TUNEL staining; E–H) cells in adrenals from non-gonadectomized (A, B, E, F) and gonadectomized (C, D, G, H) CE/J mice at different time points. Gonadectomy is followed by an increase in the number of PCNA, mainly found in the sub-capsular tumor cell nests (C, D). In contrast, while the number of TUNEL-positive cells after GDX (G, H) is comparable with non-gonadectomized mice (E, F), the tumor cell population, which is characterized by high proliferation, shows no apoptotic cells (magnified tumor area in H insert). Bars in (A–H) = 100 μm; for high magnification inserts = 50 μm; D, definitive zone; X, x-zone; M, medulla; T, tumor.
Citation: Journal of Endocrinology 190, 1; 10.1677/joe.1.06750
(A) Semi-quantitative RT-PCR panel of adrenals from gonadectomized (GDX) and non-gonadectomized (w/o GDX) CE/J mice. (B) Expression levels by means of real-time PCR analysis for CE/J mice with non-gonadectomized mice set as 100%. In accordance with the semi-quantitative RT-PCR analysis, a significant increase in the expression of transcription factors such as SF-1, WT-1, and GATA-4 is evident, whereas GATA-6 and FOG-1 expression is down-regulated in adrenals from gonadectomized animals. In addition, Mullerian-inhibiting substance (MIS) and MIS receptor (MIS-R) as well as LH-R and steroidogenic enzymes such as 17α-hydroxylase (CYP17) and aromatase (CYP19) are significantly up-regulated. (C) Real-time PCR analysis from gonadectomized and non-gonadectomized Inh−/− and wild-type controls (with non-gonadectomized wild-type animals set as 100%) demonstrate similar expressional changes for GATA-4, MIS-R, CYP17, and CYP19 only in adrenal tumors from gonadectomized Inh−/−animals, whereas gonadectomy in wild-type animals does not significantly affect transcriptional levels. Stars denote significant differences in expression levels between GDX and non-GDX animals, whereas a cross indicates significant differences between gonadectomized inhibin knockout mice (Inh−/−) and wild-type controls (WT).
Citation: Journal of Endocrinology 190, 1; 10.1677/joe.1.06750
In situ hybridization (A–C) and immunohistochemistry (D–F) for 17α-hydroxylase (CYP17) and in situ hybridization for LH-R (G–I) in adrenals from gonadectomized CE/J mice at 8, 38, and 50 weeks of age, demonstrating staining specifically in tumorous areas. High magnification of immunohistochemical staining (D–F) and control reactions for in situ hybridization with sense probes (A–C, G–I) are shown as inserts. Bars including low magnification inserts = 100 μm; bars in high magnification inserts (D–F) = 20 μm; D, definitive zone; X, x-zone; M, medulla; T, tumor. Time-course of steroid profile in gonadectomized CE/J mice suggesting functional significance of up-regulated expression of CYP17 in adrenal tumors with increase of the adrenal androgen DHEA (J) as well as testosterone (K).
Citation: Journal of Endocrinology 190, 1; 10.1677/joe.1.06750
We are indebted to Dr Anita Payne (Stanford University School of Medicine, Stanford, CA) for the generous gift of the anti-CYP17 antibody as well as to the late Roy Hertz and George Chrousos, who drew our attention to the manuscript which originally described the adrenal phenotype of CE/J mice (Wolley & Little 1946a).
Funding This work was supported by a grant from the Wilhelm-Sander-Stiftung to F B and M R (2003.145.1) and a grant from the Landesstiftung Baden-Württemberg (P-LS-ASN/5) to F B. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.
References
Arango NA, Lovell-Badge R & Behringer RR 1999 Targeted mutagenesis of the endogenous mouse Mis gene promoter: in vivo definition of genetic pathways of vertebrate sexual development. Cell 99 409–419.
Barzon L, Fallo F, Sonino N & Boscaro M 2002 Development of overt Cushing’s syndrome in patients with adrenal incidentaloma. European Journal of Endocrinology 146 61–66.
Belloni AS, Mazzocchi G, Meneghelli V & Nussdorfer GG 1978 Cytogenesis in the rat adrenal cortex: evidence for an ACTH-induced centripetal cell migration from the zona glomerulosa. Archives Anatomia, Histologia, Embryologia 61 195–205.
Beuschlein F, Looyenga BD, Bleasdale SE, Mutch C, Bavers DL, Parlow AF, Nilson JH & Hammer GD 2003 Activin induces x-zone apoptosis that inhibits luteinizing hormone-dependent adrenocortical tumor formation in inhibin-deficient mice. Molecular Cell Biology 23 3951–3964.
Beuschlein F, Looyenga BD, Reincke M & Hammer GD 2004 Role of the inhibin/activin system and luteinizing hormone in adrenocortical tumorigenesis. Hormone and Metabolic Research 36 392–396.
Bielinska M, Parviainen H, Porter-Tinge SB, Kiiveri S, Genova E, Rahman N, Huhtaniemi IT, Muglia LJ, Heikinheimo M & Wilson DB 2003 Mouse strain susceptibility to gonadectomy-induced adrenocortical tumor formation correlates with the expression of GATA-4 and luteinizing hormone receptor. Endocrinology 144 4123–4133.
Bielinska M, Genova E, Boime I, Parviainen H, Kiiveri S, Leppaluoto J, Rahman N, Heikinheimo M & Wilson DB 2005 Gonadotropin-induced adrenocortical neoplasia in NU/J nude mice. Endocrinology 146 3975–3984.
De Santa Barbara P, Bonneaud N, Boizet B, Desclozeaux M, Moniot B, Sudbeck P, Scherer G, Poulat F & Berta P 1998 Direct interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates transcription of the human anti-Mullerian hormone gene. Molecular Cell Biology 18 6653–6665.
Howard-Miller E 1928 A transitory zone in the adrenal cortex which shows age and sex relationships. American Journal of Anatomy 40 251–293.
Kataoka Y, Ikehara Y & Hattori T 1996 Cell proliferation and renewal of mouse adrenal cortex. Journal of Anatomy 188 375–381.
Keeney DS, Jenkins CM & Waterman MR 1995 Developmentally regulated expression of adrenal 17 alpha-hydroxylase cytochrome P450 in the mouse embryo. Endocrinology 136 4872–4879.
Kero J, Poutanen M, Zhang FP, Rahman N, McNicol AM, Nilson JH, Keri RA & Huhtaniemi IT 2000 Elevated luteinizing hormone induces expression of its receptor and promotes steroidogenesis in the adrenal cortex. Journal of Clinical Investigation 105 633–641.
Lee MM & Donahoe PK 1993 Mullerian inhibiting substance: a gonadal hormone with multiple functions. Endocrine Reviews 14 152–164.
Mantero F, Terzolo M, Arnaldi G, Osella G, Masini AM, Ali A, Giovagnetti M, Opocher G & Angeli A 2000 A survey on adrenal incidentaloma in Italy. Study group on adrenal tumors of the Italian society of endocrinology. Journal of Clinical Endocrinology and Metabolism 85 637–644.
Matzuk MM, Finegold MJ, Mather JP, Krummen L, Lu H & Bradley A 1994 Development of cancer cachexia-like syndrome and adrenal tumors in inhibin-deficient mice. PNAS 91 8817–8821.
Mikola M, Kero J, Nilson JH, Keri RA, Poutanen M & Huhtaniemi I 2003 High levels of luteinizing hormone analog stimulate gonadal and adrenal tumorigenesis in mice transgenic for the mouse inhibin-alpha-subunit promoter/Simian virus 40 T-antigen fusion gene. Oncogene 22 3269–3278.
Mishina Y, Rey R, Finegold MJ, Matzuk MM, Josso N, Cate RL & Behringer RR 1996 Genetic analysis of the Mullerian-inhibiting substance signal transduction pathway in mammalian sexual differentiation. Genes and Development 10 2577–2587.
Nachtigal MW, Hirokawa Y, Enyeart-Van Houten DL, Flanagan JN, Hammer GD & Ingraham HA 1998 Wilms’tumor 1 and Dax-1 modulate the orphan nuclear receptor SF-1 in sex-specific gene expression. Cell 93 445–454.
Rey R, Sabourin JC, Venara M, Long WQ, Jaubert F, Zeller WP, Duvillard P, Chemes H & Bidart JM 2000 Anti-Mullerian hormone is a specific marker of sertoli- and granulosa-cell origin in gonadal tumors. Human Pathology 31 1202–1208.
Rilianawati, Paukku T, Kero J, Zhang FP, Rahman N, Kananen K & Huhtaniemi I 1998 Direct luteinizing hormone action triggers adreno-cortical tumorigenesis in castrated mice transgenic for the murine inhibin alpha-subunit promoter/simian virus 40 T-antigen fusion gene. Molecular Endocrinology 12 801–809.
Robert NM, Tremblay JJ & Viger RS 2002 Friend of GATA (FOG)-1 and FOG-2 differentially repress the GATA-dependent activity of multiple gonadal promoters. Endocrinology 143 3963–3973.
Schepers GE, Bullejos M, Hosking BM & Koopman P 2000 Cloning and characterisation of the Sry-related transcription factor gene Sox8. Nucleic Acids Research 28 1473–1480.
Smith C & Mackay S 1991 Morphological development and fate of the mouse mesonephros. Journal of Anatomy 174 171–184.
Spencer SJ, Rabinovici J, Mesiano S, Goldsmith PC & Jaffe RB 1992 Activin and inhibin in the human adrenal gland. Regulation and differential effects in fetal and adult cells. Journal of Clinical Investigation 90 142–149.
Spencer SJ, Mesiano S, Lee JY & Jaffe RB 1999 Proliferation and apoptosis in the human adrenal cortex during the fetal and perinatal periods: implications for growth and remodeling. Journal of Clinical Endocrinology and Metabolism 84 1110–1115.
Stikkelbroeck NM, Otten BJ, Pasic A, Jager GJ, Sweep CG, Noordam K & Hermus AR 2001 High prevalence of testicular adrenal rest tumors, impaired spermatogenesis, and Leydig cell failure in adolescent and adult males with congenital adrenal hyperplasia. Journal of Clinical Endocrinology and Metabolism 86 5721–5728.
Viger RS, Mertineit C, Trasler JM & Nemer M 1998 Transcription factor GATA-4 is expressed in a sexually dimorphic pattern during mouse gonadal development and is a potent activator of the Mullerian inhibiting substance promoter. Development 125 2665–2675.
Wilhelm D & Englert C 2002 The Wilms tumor suppressor WT1 regulates early gonad development by activation of Sf1. Genes and Development 16 1839–1851.
Woolley GW & Little CC 1945 The incidence of adrenal cortical carcinoma in gonadectomized female mice of the extreme dilution strain. I Observation on the adrenal cortex. Cancer Research 5 193–202.
Woolley GW & Little CC 1946a Transplantation of an adrenal cortical carcinoma. Cancer Research 6 712–717.
Wolley GW & Little CC 1946b Prevention of adrenal cortical carcinoma by diethylstilbestrol. PNAS 32 239–240.
Wudy SA, Hartmann M & Homoki J 2002 Determination of 11-deoxycortisol (Reichstein’s compound S) in human plasma by clinical isotope dilution mass spectrometry using benchtop gas chromatography-mass selective detection. Steroids 67 851–857.
Zajicek G, Ariel I & Arber N 1986 The streaming adrenal cortex: direct evidence of centripetal migration of adrenocytes by estimation of cell turnover rate. Journal of Endocrinology 111 477–482.
