Abstract
Rats and guinea pigs have frequently been used to study the development of the prostate and the mechanism of androgen action, but the mouse prostate has also become an attractive model for prostate research, because an enormous range of genetically altered mice is now available. However, the secretion of proteins in the mouse prostate has not yet been thoroughly investigated. In the present study, major secreted proteins from the ventral prostate (VP), dorso-lateral prostate (DLP), and anterior prostate (AP) of mice were identified by means of 2D-gel electrophoresis followed by MALDI-TOF mass spectrometric analysis. A quantitative reverse transcriptase-PCR method was further employed to examine the androgen-dependent transcriptional regulation of the identified proteins. Proteome analysis revealed that the VP secretes spermine-binding protein, serine protease inhibitor Kazal type-3, and a 91 kDa hypothetical scavenger receptor (AK035662). DLP and AP secrete a protein similar to immunoglobulin-binding protein, immunoglobulin-binding protein-like protein, and one of the experimental autoimmune prostatitis antigen proteins (EAPA2). Peroxiredoxin-6, glucose-regulated protein 78, zinc-α2-glycoprotein, and phospholipase Cα are also secreted. Castration of animals led to a decrease in the mRNAs of these secreted proteins, although the extents of changes varied greatlyamong different lobes. We present here an outlined view of mouse prostate secretion, which should contribute to an understanding of the biological functions of the prostate gland, as well as the androgen dependency of prostate secretion.
Introduction
Rat models have been widely used to study prostate morphology, development, and pathology, as well as androgen-regulated gene expression, in order to understand the basic functions and pathology of this male accessory sex gland (Cunha et al. 1987). Mice have generally not been used because the small size of the gland makes morphological studies difficult, and because the mouse prostate is less susceptible to carcinogenesis (Shirai et al. 2000). Recently, however, a huge range of transgenic and knockout mice has become available with considerable potential for studies of the prostate (Abate-Shen & Shen 2002, Klein 2005). Transgenic adenocarcinoma of the mouse prostate (TRAMP) mice has been used to study the progression and chemoprevention of prostate cancer (Greenberg et al. 1995). Prolactin transgenic mice have been used to investigate the effect of prolactin on prostate growth (Wennbo et al. 1997). Estrogen receptor knockout mice (αERKO and βERKO) have been used to examine the role of estrogen in prostate development (Weihua et al. 2001, Omoto et al. 2005). Aromatase knockout, prolactin receptor knockout, and conditional deletion of Rb mice have been used to study the involvement of those genes in prostate carcinogenesis (McPherson et al. 2001, Robertson et al. 2003, Maddison et al. 2004). However, despite these recent developments, the basic biological function of the prostate, prostatic secretion, is still poorly understood in the mouse. Identification of the secreted proteins will be helpful in understanding prostate development and pathology.
The rodent prostate consists of the ventral prostate (VP), lateral prostate (LP), dorsal prostate (DP), and anterior prostate (AP or coagulating gland). It is well known that rat prostatic secretory proteins, such as prostatein and cystatin-related protein, are mainly produced in the VP, and other proteins, such as prostatic secretory protein of 94 aa (PSP94), probasin, and seminal vesicle secretion 2 (SVS2) are abundant in the LP and DP (Cunha et al. 1987). An early study revealed that spermine-binding protein (SBP) and serine protease inhibitor Kazal type-3 (SPI-KT3) are abundant in the mouse VP (Mills et al. 1987a, 1987b). Proteins secreted from the dorso-lateral prostate (DLP) and AP have not yet been identified, although Cunha’s group developed a specific polyclonal antibody for major DLP protein(s) to be used as a differentiation marker (Donjacour et al. 1990).
In the present study, the major proteins secreted from the VP, DLP, and AP were identified by means of 2D-gel electrophoresis followed by MALDI-TOF mass spectrometric analysis. Further, a quantitative reverse transcriptase (RT)-PCR method was employed to examine the androgen dependence of the transcriptional regulation of the secretory proteins.
Materials and Methods
Animals
Animal experiments were conducted in accordance with A Guide for the Care and Use of Laboratory Animals of Hiroshima University. The male C57BL mice were purchased from Charles River Japan Co. (Kanagawa, Japan) and maintained with free access to basal diet and tap water. For proteome analysis, three of the 11-week-old mice were killed under ether anesthesia and the prostate and seminal vesicle (SV) were carefully dissected out. In addition, four animals were used for evaluating the sample preparation method. For the study of age-dependent mRNA expression, animals were killed at 1, 2, 4, 6, and 11 weeks (four animals per group), and each of the prostate lobes was dissected under a microscope and immediately fixed in RNA Later solution (Ambion, Inc., Austin, TX, USA). For the castration and hormone-replacement study, animals were divided into three groups, the castrated, castrated plus testosterone injected, and intact. Surgical castration was made at 10 weeks of age and animals were allowed to recover for 1 week. Testosterone propionate (Wako Junyaku KK, Osaka, Japan) was dissolved in the vehicle oil, Panacete 810 (Nippon Oils and Fats Co., Ltd, Tokyo, Japan), and the solution was administered i.p. at a dose of 5 mg/kg body weight. Animals were killed under ether anesthesia 24 h after testosterone injection, and the prostate lobes were collected for RNA extraction.
Preparation of secretion samples
Preparation of secretion samples was performed based on the previously reported method (Donjacour et al. 1990). Each dissected prostate lobe from an 11-week-old mouse was rinsed well in saline and placed on a 35 mm culture dish with 100 μl saline containing 1% protease inhibitor mixture (Sigma). Each lobe was cut into four or five pieces, left to stand for 5 min, and transferred to a 1.5 ml microcentrifuge tube. After centrifugation at 10 000 g for 5 min at room temperature, the supernatant was collected as the secretion sample. The incubation time of 5 min was chosen because inner cellular contamination (glyceraldehyde-3-phosphate dehydrogenase; GAPDH) was confirmed to below by 5 min (Fig. 1). For the SV secretion sample, the content of the vesicle was collected and suspended in saline with protease inhibitors. The protein concentration of each sample solution was determined with a Protein Assay kit (Bio-Rad Lab.). For de-glycosidation, samples were incubated with PNGase F (50 U/μg protein; New England Biolabs, Ipswich, MA, USA) at 37 °C for 1.5 h.
Electrophoresis (1D and 2D-PAGE)
For SDS-PAGE gel electrophoresis, 15 μg total protein of each sample were mixed with the SDS-PAGE buffer containing 2-mercaptoethanol, and applied to a 5–20% gradient PAGE gel (10 × 10 cm2 SuperSep pre-cast gel; Wako Jyunyaku) with molecular weight markers, Precision Plus (Bio-Rad Lab.). The electrophoresis was carried out at a constant current of 20 mA. The gel was fixed and stained with 45% methanol and 10% acetic acid containing 0.2% Coomassie Brilliant Blue, followed by de-staining with 7% methanol and 7% acetic acid.
For 2D-gel electrophoresis, 1D isoelectric focusing with immobilized pH gradients was performed with Immobiline DryStrip (Amersham) and the Ettan IPGphor system (Amersham) according to the manufacturer’s protocol. For analytical 2D-PAGE, 10 μg de-glycosidated protein was applied in a 7 cm Immobiline DryStrip (pI 3–11, nonlinear gradient). After rehydration, the strip was isoelectrofocused (15 kVh). The Immobiline gel was then treated with SDS equilibration buffer (50 mM Tris–HCl, pH 8.8, 6 M urea, 30% glycerol, and 2% SDS) containing 10 mg/ml DTT for 15 min, followed by the same buffer containing 25 mg/ml iodoacetamide. The Immobiline gel was then placed on the second SDS-PAGE slab gel with 5–20% gradient (SuperSep pre-cast gel, Wako Jyunyaku) and overlaid with hot agarose solution to connect the two gels. The second electrophoresis was run at a constant current of 20 mA. The gel was fixed with 50% methanol and 7% acetic acid, stained overnight in Sypro Ruby (Invitrogen), and de-stained with 10% methanol and 7% acetic acid. Stained gels were scanned with a Molecular Imager FX Pro (Bio-Rad Lab.), with excitation at 532 nm. In the case of preparative 2D-PAGE for mass spectrometric analysis, 60 μg total protein were subjected to electrophoresis as described previously and then stained with silver nitrate by incubation with 0.2 g/l Na2S2O3 for 1 min followed by 1 g/l AgNO3 for 20 min on ice, and washed with 20 g/l Na2CO3 containing 0.1% HCHO. A 24 cm Immobiline DryStrip (pI, 3–11) was also used for preparation. It was rehydrated with 200 μg secreted protein and isoelectrofocused (25 kVh), then placed on 12.5% SDS-PAGE gel and overlaid with hot agarose solution. The electrophoresis was performed at a constant current of 400 mA. The gel was stained with silver nitrate as described earlier. Three sets of secretion samples from different animals were applied to 2D-electrophoresis and analyzed.
Western blotting
Total proteins, 0.3 μg of each preparation of prostate secretion, were applied to SDS-PAGE (5–20% gel). Proteins were then transferred to a piece of Hybond-P polyvinylidene difluoride (PVDF) membrane (Amersham). The membrane was incubated with a monoclonal antibody to GAPDH (Ambion) at 1 μg/ml followed by a peroxidase-conjugated antibody to mouse IgG (MBL Co., Nagoya, Japan) at a dilution of 1:1000. Protein bands were detected using the ECL system (Amersham).
Mass spectrometry (MS)
The protein spots were excised from the polyacrylamide gel and silver nitrate was removed with 15 mM K3[Fe(CN)6] and 50 mM Na2S2O3. The gel pieces were incubated in distilled water for 1 h, incubated with CH3CN for 10 min, and dried in a centrifuge-vacuum concentration system. Each gel piece was incubated with a 20 μl aliquot of 10 μg/ml trypsin solution (sequence grade, Sigma) for 30 min on ice. Excess trypsin solution was removed, and the gel piece was incubated overnight at 35 °C. To extract the digested peptides, 10 μl of 70% CH3CN containing 0.1% trifluoroacetic acid were added to each gel piece. An aliquot of 0.5 μl of the extract solution was spotted onto a target plate for an UltraFlex mass spectrometer (Bruker Daltonics, Bremen, Germany) along with 0.5 μl of 10 mg/ml α-cyano-4-hydroxycinnamic acid (MS grade, Nacalai tesque Co., Kyoto, Japan). MS was performed using an accelerating voltage of 20 kV, with data acquisition between 1000 and 4000 Da. Some of the fragment peaks were further analyzed by MS/MS. The MS and MS/MS data were evaluated with Biotools software (Bruker Daltonics) in combination with a peptide mass fingerprinting analysis system, MASCOT version 2.1 (Matrix Science, London, UK). The peptide mass fingerprinting was performed based on mass spectroscopy protein sequence database (MSDB; Imperial College London, UK) and the nr database at the National Centre for Biotechnology Information (NCBInr; Bethesda, MD, USA) with terminal modifications of peptides set as fixed carbamidomethyl and flexible oxidation ends. The peptide mass tolerance was set to 0.3%.
Quantification of mRNAs by real-time RT-PCR
Total RNA was prepared from each lobe of the prostate with an RNA Isolation kit (Promega), and 2 μg total RNA were reverse transcribed as described previously (Fujimoto et al. 2004). An ABI Prism 7700 (Perkin–Elmer Life Sciences, Boston, MA, USA) was employed for quantitative measurement of cDNA using a QuantiTect Sybr Green PCR kit (Qiagen). Specific primer sets with a Tm of about 59 °C were designed for each mRNA (Table 1). Prior to quantitative analysis, PCR products were prepared separately and purified by gel electrophoresis. The DNA sequences were confirmed with a capillary DNA sequencer, ABI 310 (Perkin–Elmer Life Sciences). Extracted fragments were used as standards for quantification. The PCR conditions were 15 min of initial activation followed by 45 cycles of 20 s at 94 °C, 30 s at 58 °C, and 40 s at 72 °C. All mRNA contents were normalized with reference to β-actin mRNA.
Serum testosterone levels
Serum testosterone levels were measured with an ELISA kit, purchased from Neogen Corp. (Lexington, KY, USA).
Statistical analysis
Statistical comparisons were made using Student’s t-test.
Results
1D-PAGE analysis
The secretory proteins from the VP, DLP, AP, and SV were treated with a de-glycosidation enzyme, PNGase F, and analyzed with SDS-PAGE (Fig. 2). In the VP, a broad band at 20–25 kDa was evidently the major band, and a 10 kDa band seemed to be secondary. PNGase F treatment shifted the major band to a sharper 19 kDa band, while other bands were unaffected. The main band in the DLP appeared to be a broad band at 80–100 kDa, together with bands at 17 and 13 kDa. PNGase F digested the major band into two sharper bands of approximately 80 and 90 kDa, which showed lower staining intensities. The mobility of other bands was not changed much by PNGase F treatment, although some smear-like staining disappeared. When the AP was compared with the DLP, the patterns of bands larger than 25 kDa were similar, as was the effect of PNGase digestion. However, several DLP-specific bands were present in the molecular weight range below 25 kDa. A band of albumin, 68 kDa, representing contamination from serum, was present in the preparations of prostatic secretion, especially in the VP and DLP. The pattern of SV protein bands was completely different from those of prostatic proteins. The major SV bands were observed between 10 and 16 kDa.
2D-PAGE and identified proteins
Secretory proteins from all the lobes were treated with PNGase F and subjected to 2D-PAGE analysis. Owing to the limitation in the pore size of the immobilized pH gradient gel for isoelectric focusing, proteins with a molecular mass of over 100 kDa could not be analyzed in the 2D-PAGE. Gels were stained and the major spots were picked up for MS analysis (Fig. 3). The analysis of three sets of prostate secretions from independent control mice provided identical patterns. The spots were successfully identified and the results were summarized in Table 2. SBP and SPI-KT3 were major proteins in the VP. In addition, a 91 kDa protein, predicted from urinary bladder cDNA data (AK035662) was identified in the VP, along with glucose-regulated protein 78 (GRP78 or heat-shock 70 kDa protein 5) and peroxiredoxin 6 (Prdx6). Two higher molecular weight proteins in the DLP and AP were identified as experimental autoimmune prostatitis antigen 2 (EAPA2) and a predicted protein similar to immunoglobulin-binding protein (immunoglobulin binding protein-like protein; IgBPLP). Zn-α2-glycoprotein (ZnG), a mammalian homologue of Xenopus anterior gradient 2 (AGR2), as well as PSP94 and probasin, were detected in the DLP secretion. Phospholipase Cα (PLCα), calreticulin (Calr), and protein disulfide isomerase were also identified in both DLP and AP secretions. SVS2, 4, 5, and 6 were identified in the SV fluid.
Lobe-specific mRNA expression of identified secreted proteins
Expression of identified proteins in the prostate was further confirmed by examining the mRNA levels; the results are summarized in Table 3. Lobe-specific expression of secreted proteins was evident. Both SBP and SPI-KT3 mRNAs were extremely abundant in the VP but virtually undetectable in the other lobes. The mRNA expression of the 91 kDa protein was also VP-specific. Abundant expression of IgGBPLP and EAPA2 mRNA was detected in the DLP and AP. Probasin expression was specific to the DLP/AP, while PSP94 mRNA was specific to the VP/DLP. The level of ZnG mRNA was highest in the DLP. The other protein mRNAs were expressed uniformly among the prostatic lobes.
Androgen dependency in mRNA expression of identified secreted proteins
Transcriptional regulation of identified proteins by androgen was examined by comparing mRNA levels among castrated, castrated plus testosterone-treated, and intact animals (Table 4). Serum testosterone levels were 0, 5.2 ± 0.15, and 1.5 ± 0.15 ng/ml in castrated, castrated plus testosterone injected, and intact groups respectively. Serum testosterone levels reached 38 ng/ml, 1 h after a testosterone injection. The mRNA levels of identified secreted proteins decreased 1 week after castration, although the extent of the decrease differed among protein species. For instance, SPI-KT3 mRNA in the VP was greatly decreased in castrated animals to only 1/769 of the intact control level, while castration reduced SBP expression to 1/62 of the control. The extent of change in mRNA expression also varied between lobes. GRP78 mRNA in the DLP, for instance, was decreased to 1/11 of the control by castration but only to about 1/3 of the control in the VP. The mRNA levels were normalized by β-actin levels, which were not affected by castration and testosterone treatment. The β-actin levels in the VP were 3.5 ± 0.36, 3.8 ± 0.30, and 3.5 ± 0.34 fg/ng total RNA in the castrated, the castrated plus testosterone and intact groups respectively. The values were 4.8 ± 0.74, 5.3 ± 0.99, and 4.3 ± 0.40 for the DLP, and 3.9 ± 0.24, 4.2 ± 0.60, and 4.7 ± 0.26 for the AP.
Ontogeny in mRNA expression of identified secreted proteins
The expression of identified secreted protein mRNAs was examined in each lobe of the prostate at ages 1, 2, 4, 6, and 11 weeks (Table 5). Low levels of mRNA expression were noted at 1 week. Significant increases of SBP and EAPA2 mRNAs began at 2 weeks and continued thereafter. Increases in other secretory protein mRNAs, including 91 kDa protein, PSP94 and IgGBPLP mRNAs, were apparent at 4 weeks.
Discussion
In the present study, the major secretory proteins of the mouse VP, DLP, and AP were identified by mass spectrometric analysis after 2D-gel electrophoresis (Table 6). IgBPLP and EAPA2 were major proteins in the DLP/AP. A 91 kDa protein predicted from a mouse urinary bladder cDNA (AK035662), Prdx6 and PLCα were also found in the prostatic secretion for the first time, in addition to previously reported prostatic proteins, including SBP (Mills et al. 1987b), SPI-KT3 (Mills et al. 1987a), PSP94 (Xuan et al. 1999), and probasin (Johnson et al. 2000). The mRNAs for these proteins were expressed in a lobe-specific manner and were regulated by androgen. Our study has delineated the main mouse prostatic secretion pattern for the first time. The data will be useful for studying androgen-dependent gene regulation in the prostate, and may also provide markers for studying functional differentiation of prostate tissue.
Production and secretion of prostatic proteins are the main physiological functions of the prostate gland. Prostatic secretory proteins have been studied in rats as well as in humans, especially from the viewpoint of androgen-dependent regulation of expression and to identify possible markers of prostate cancer. The major human prostatic-secreted proteins are PSA (prostate-specific antigen), PSP94, and prostatic acid phosphatase (Lee et al. 1986). In rat, the composition of prostatic proteins is different; only PSP94 is common with the human case, and the production of each protein varies among lobes. In the VP, prostatic-binding protein or prostatein is the major secreted protein, while cystatin-related protein and kallikreins are also produced abundantly (Heyns 1990). The LP and DP secrete probasin, PSP94, and SVS2 (Imasato et al. 2001). A kinesin heavy chain-like protein and an IgG-binding protein were recently reported in the secretion of the AP (Esposito et al. 2001, Wilhelm et al. 2002).
In spite of the morphological similarity of the prostate in mouse and rat, previous studies have suggested a substantial difference in prostatic secretion between the two species (Donjacour et al. 1990). Since mouse prostatic proteins are known to be highly glycosylated, we first examined the effects of glycosidase digestion on prostatic proteins. Endo H glycosidase, which cleaves mainly within the chitobiose core of high mannose, did not change the SDS-PAGE pattern (data not shown). On the other hand, PNGase F, which removes all types of N-linked glycosylation, changed the pattern. A broad band of SBP in the VP was converted to a sharp band with smaller molecular weight, and smear-like bands between 40 and 100 kDa in the DLP/AP were also converted to sharper bands, indicating that proteins were de-glycosylated by the enzyme. In spite of highly glycosylated characteristics of mouse prostate proteins, the biological role of glycosylation is not yet understood.
In the mouse prostate, only VP-secreted proteins have been investigated, and two major proteins, SBP and SPI-KT3, were identified (Mills et al. 1987a,b). The present study confirmed the secretion of these two proteins and also revealed the presence of other proteins, including 91 kDa protein, Prdx6 and GRP78. The 91 kDa protein is expected to consist of 841 aa with two predicted extracellular (CUB) domains and three scavenger receptor cystine-rich (SRCR) domains, and is expressed preferentially in the VP. The size of the protein, however, seems to be less than 91 kDa in the gel. Since the sequence coverage of peptide mass fingerprinting is only 13%, the actual reading frame may be shorter than the predicted one. Prdx6 is another new component of the prostatic secretion found in the present study. Since it is an antioxidant enzyme that reduces peroxide and alkyl hydroperoxide to water and alcohol respectively (Wang et al. 2003), it may provide seminal plasma antioxidant capability. GRP78 belongs to the heat-shock protein 70 family, which had been considered as intercellular proteins. However, a recent proteomic analysis of human prostasomes revealed the presence of heat shock proteins in prostatic secretion (Utleg et al. 2003). In addition, heat-shock protein 70 has been reported to be secreted from a variety of prostatic cell lines, and to show growth-inhibitory activity (Jones et al. 2004, Wang et al. 2004). Secreted mouse GRP78 may have a similar activity.
Although mouse DLP proteins had not been biochemically identified, Cunha’s group has recognized 110 and 55 kDa bands in SDS-PAGE as major DLP/AP proteins (Donjacour et al. 1990). They reported that DLP/AP proteins are highly glycosylated, which was confirmed by the present study. The predicted IgGBPLP sequence derived from the cDNA sequence (XM_620455), however, is calculated to contain 1866 aa with a molecular mass of 201 kDa. Because peptide sequencing by the peptide-mass fingerprinting method covered the whole predicted sequence (27% coverage), the 100 kDa spot probably contains a mixture of cleaved fragments derived from the 201 kDa protein, although this remains to be confirmed. Recently, an IgG-binding protein of 115 kDa was reported to be secreted also from the rat AP, suggesting that a rat homolog exists (Wilhelm et al. 2002). The predicted cDNA sequence corresponding to this rat protein (XM_620455), which became available more recently, encodes 206 kDa protein (1914 aa) instead of 115 kDa. There is 84% similarity between the mouse and the rat sequences. Secretion of EAPA2, which is one of the antigens found in experimental autoimmune prostatitis, is also a noteworthy finding in the present study. This protein of 914 aa contains no known domain structure and has no homology with any known functional protein. Secretion of both PSP94 and probasin was detected in the DLP, as expected, since both proteins are well characterized in rats and have been reported in mice (Xuan et al. 1999, Johnson et al. 2000). The other identified DLP proteins include GRP78, Prdx6, ZnG, AGR2, Calr, and protein disulfide isomerase (PDI). Prostatic secretion of ZnG has been reported in humans, and ZnG is widely distributed in body fluids and in various epithelia (Lei et al. 1998, Hale et al. 2001). AGR2 is a mammalian homolog of Xenopus AGR2, which was recently reported to be secreted from human prostate under androgen regulation (Zhang et al. 2005). It is overexpressed in prostate cancer and the expression level is correlated with pathological grade. Calr is a highly conserved calcium-binding protein involved in a wide variety of cellular processes (Krause & Michalak 1997). Interestingly, the Calr gene was identified as an androgen-inducible gene in the rat VP (Zhu et al. 1998). PDI is involved in the maintenance of folding of synthesized proteins. Specific expression of PDI in the prostate was recently reported in humans (Lexander et al. 2005). Since both Calr and PDI are considered to be localized in the lumen of endoplasmic reticulum, they may represent contaminants introduced during preparation of the secretion sample. Secretion from the AP is similar to that from the DLP, i.e. the major secretory proteins are IgGBPLP and EAPA2, but little ZnG and no PSP94 are found in the secretion. The results of mass spectrometric identification of SV proteins were generally in agreement with previous reports, i.e. SVS2, 4, 5, and 6, as well as SPI-KT3 (Lai et al. 1991, Lundwall et al. 1997). Except SPI-KT3, SV proteins are specifically expressed in the SV and not in the prostate gland, which differs from the rat case, where SVS2, for instance, is highly expressed in DLP/AP.
Quantitative determination of mRNA expression revealed a clear transcriptional differentiation of secreted proteins among the lobes. The levels of secretory protein mRNAs were very high, ranging from 1 to 500 times that of the housekeeping gene β-actin, used as an internal control in the present study. The mRNA levels overall correlated with the intensity of protein staining in the gel, although spots of protein with larger molecular weight, such as EAPA2 and IgBPLP show lesser intensity in the 2D-gel, since the 1D-gel used in the present study is only able to hold proteins with molecular weights less than 80–100 kDa. Since all the identified secreted proteins decreased significantly a week after castration of the animal, these protein transcripts are androgen-dependent directly or indirectly through involution of the gland. In rats, various studies have shown a faster response of the VP to androgen action, as compared with other lobes. For instance, castration decreased probasin mRNA expression to 1% of the control level after a week, while the decrease in the DLP was only 50% (Imasato et al. 2001). In the mouse, however, large decreases in mRNAs were evident in all the lobes. We examined the effect of a single injection of testosterone on the mRNAs in castrated animals to confirm the androgen dependency of transcription. The serum testosterone level well exceeded the control level within 1 h and was still high 24 h after an injection. Although most mRNA levels increased significantly after an injection, which clearly demonstrates their androgen inducibility, most of them were not restored to the intact control level. It may suggest that the full activity of androgen-dependent genes in the prostate is involved in both short- and long-term transcriptional regulation mechanisms by androgen.
Although rodent prostate models have been used for investigating the mechanism of prostate carcinogenesis, anatomical differences between rodent and human prostate have led to concerns about the validity of rodents as suitable models for human prostate cancer. Besides, mice are resistant to induction of prostate tumors by chemical carcinogens. However, a number of transgenic or knockout mouse lines have become available in which prostate carcinomas preferentially occur. For instance, the TRAMP transgenic line expresses the SV40 antigen under the control of the rat probasin promoter. The TRAMP mice develop high-grade prostatic intraepithelial neoplasia and prostate cancer within 12 weeks of birth, and ultimately develop metastases to the regional lymph nodes and lung by 30 weeks. In addition, androgen depletion by castration results in decreased tumor incidence. Their futures are similar to the human case, although metastasis to bone, a characteristic feature of human prostate cancer, is rare. The expression pattern of secretion proteins may be related to development of prostate carcinogenesis. Since the present study has revealed mouse prostate secretion, these can now be examined in relation to the development of prostate carcinogenesis as well as androgen-dependent differentiation of the gland. The ontogeny of mRNA expression of secreted proteins indicated that significant expression started 2 weeks after birth, which is consistent with the fact that branching morphogenesis of the mouse prostate is completed in the first 15 days of birth.
The present study has provided an understanding of the major secretory function of the mouse prostate, and identified common aspects of secretory functionality between mouse and human, e.g. for heat-shock proteins, ZnG and peroxiredoxin. The identified secretory proteins should be available as models of androgen-dependent gene regulation and are candidates as markers for prostatic differentiation. Like human PSA or PSP94, some of the identified proteins may be useful as pathological markers associated with prostate disorders; this would facilitate prostate research in mouse models.
Quantitative PCR primers for mouse genes
GenBank accession # | 5′ -Primer (5′ → 3′ ) | 3′ -Primer (5′ → 3′ ) | |
---|---|---|---|
Genes | |||
91 kDa protein | AK035662 | GGACCTTCCACAAGCGAACAT | GCACTCCTCCAGGTGTTCCTC |
AGR2 | M_011783 | TTCATCACTTGGACGAATGCC | ACGTACTGGCCATCAGGAGAA |
Calr | NM_007591 | ACCGTGAAGCATGAGCAGAAT | TGTTGATCAGCACATTCTTGCC |
EAPA2 | AY528666 | CCAGACAGGCAGAATTGGGTT | CTCCTCGGAATCTATATTGGCG |
GRP78 | NM_022310 | TCTTGCCATTCAAGGTGGTTG | TTCTTTCCCAAATACGCCTCAG |
IgBPLP | XM_620455 | CTGTGAGTTGCCCGAGCCT | CACAATGGAGAACGCCTCCT |
PDI | MUSPDIA | CGCAACAACTTTGAGGGTGA | TTGGGCAGGAACAGCAGAAT |
PLCα | M73329 | ATTGCACTGCCAACACAAACA | AACTGAAGCTGGTCCTGCTTG |
Prdx6 | BC013489 | AGGACGCTAACAACATGCCTG | GTGCCTGTCAGCTGGAGAGAG |
Probasin | AF005204 | ACACTGCATGTGCTAGGCGT | TCCCACACAAAATGTGACGG |
PSP94 | U89840 | CCAACGCTACTAGGCCTTTGA | GCCCACACGAAGCACATTTAC |
SBP | NM_011321 | TGGAACCCGGTCAGATAACTTT | TCGACCCCTTCTAACACCAAA |
SPI-KT3 | BC086887 | AGAGGCTAGTTGCCATGATGC | GGACAGGCTCTATGCGTTTCC |
SVS2 | NM_009300 | CAGAGCAGCTCCTCAGAGGG | TCTGGGTCATGTCACCACCA |
ZnG | AF281658 | CCCACAGGACATAGACCCCTT | CTCATGTCAGGCAGAGAGGGTA |
β-Actin | X03765 | CTGTCCCTGTATGCCTCTGGTC | TGAGGTAGTCCGTCAGGTCCC |
Identified mouse prostatic secretory proteins
Protein name | Accession # | Observed MW/pI | Theoretial MW/pI | P | Sequence coverage (%) | |
---|---|---|---|---|---|---|
Abbreviation | ||||||
SBP | Spermine-binding protein | NP_035451 | 18,35/4.5 | 22/4.6 | 0.999 | 46 |
91 kDa | Protein predicted from cDNA AK035662 | Q8BZE1 | 80/4.5 | 93/4.8 | 0.973 | 13 |
GRP78 | Glucose-regulated protein 78 kDa | A37048 | 70/5.0 | 72/5.0 | 1.000 | 39 |
Prdx6 | Peroxiredoxin 6 | O08709 | 25/6.0, 6.5 | 25/5.6 | 1.000 | 57 |
SPI-KT3 | Serine protease inhibitor, KT3 | NP_033284 | 10/7.5 | 9/8.0 | 1.000 | 40 |
PSP94 | Prostatic-secretory protein 94 | NP_065622 | 13,28/5.0 | 13/5.5 | 1.000 | 76 |
IgBPLP | IgG-binding protein-like protein | XP_620455 | 100/5.5 | 210/5.5 | 1.000 | 28 |
EAPA2 | Experimental auto-immune prostatitis antigen 2 | NP_98193 | 100/6.5 | 103/6.2 | 1.000 | 42 |
PLCα | Phospholipase Cα | AAA39944 | 55/6.0 | 57/6.0 | 1.000 | 29 |
ZnG | Zinc-α2-glycoprotein | Q64726 | 35/6.0 | 34/5.8 | 0.992 | 28 |
AGR2 | Homolog of Xenopus anterior gradient 2 | BAB25181 | 20/9.5 | 20/9.5 | 1.000 | 56 |
Probasin | Probasin | AAC01954 | 22/9.5 | 21/10.1 | 1.000 | 56 |
Calr | Calreticulin | NP_031617 | 50/4.5 | 48/4.2 | 1.000 | 35 |
PDI | Protein disulfide isomerase | AAA39906 | 60/5.0 | 57/4.6 | 0.972 | 35 |
mRNA levels of identified proteins in each prostatic lobe in 11-week-old mice
SBP | SPIKT3 | 91 kDa | PSP94 | ZnG | GRP78 | AGR2 | |
---|---|---|---|---|---|---|---|
VP | 511 ± 58.9 | 184 ± 36.0 | 3.6 ± 0.8 | 2.6 ± 0.6 | 0.9 ± 0.1 | 1.7 ± 0.5 | 0.14 ± 0.03 |
DLP | 0 | 0 | 0 | 5.8 ± 1.5 | 12.3 ± 1.1 | 6.1 ± 1.7 | 0.38 ± 0.04 |
AP | 0 | 0 | 0 | 0 | 1.4 ± 0.3 | 2.7 ± 0.2 | 0.54 ± 0.04 |
PLCa | Calr | PDI | Prdx6 | Probasin | EAPA2 | IgBPLP | |
---|---|---|---|---|---|---|---|
Means ± s.e.m. (n = 5). Values are mRNA levels divided by β-actin mRNA levels (mol/mol β-actin). 11-week-old male C57BL mice were killed and total RNA was isolated from each prostate lobe. mRNA levels were measured by real-time RT-PCR. | |||||||
VP | 0.17 ± 0.021 | 0.7 ± 0.1 | 15.0 ± 2.1 | 2.5 ± 0.3 | 0.06 ± 0.02 | 0 | 0.0 ± 0.0 |
DLP | 0.36 ± 0.085 | 1.2 ± 0.3 | 8.3 ± 2.1 | 21.7 ± 2.6 | 2.15 ± 0.23 | 18.9 ± 1.5 | 67.9 ± 10.3 |
AP | 0.60 ± 0.088 | 1.1 ± 0.3 | 4.0 ± 0.8 | 29.0 ± 5.6 | 0.78 ± 0.05 | 5.5 ± 0.8 | 53.0 ± 0.3 |
Androgen regulation of mRNA levels of identified proteins
SBP | SPIKT3 | 91 kDa | PSP94 | ZnG | GRP78 | AGR2 | |
---|---|---|---|---|---|---|---|
VP | |||||||
Cast | 8.2 ± 0.91a | 0.24 ± 0.08 | 0.09 ± 0.02 | 0.011 ± 0.004 | 0.38 ± 0.032 | 0.57 ± 0.36 | 0.03 ± 0.004 |
Cast+T | 48 ± 7.9 (5.9)b | 9.3 ± 3.2 (39) | 0.8 ± 0.23 (8.4) | 0.4 ± 0.008 (38) | 0.56 ± 0.10 (1.5) | 1.02 ± 0.14 (1.8) | 0.14 ± 0.03 (4.9) |
Intact | 511 ± 58.9 (62) | 184 ± 36 (769) | 3.6 ± 0.79 (40) | 2.6 ± 0.55 (236) | 0.92 ± 0.09 (2.4) | 1.7 ± 0.47 (3.0) | 0.12 ± 0.02 (4.3) |
DLP | |||||||
Cast | – | – | – | 0.002 ± 0.001 | 0.64 ± 0.11 | 0.55 ± 0.11 | 0.01 ± 0.001 |
Cast+T | – | – | – | 0.08 ± 0.046 (38) | 2.0 ± 0.48 (3.1) | 3.4 ± 0.73 (1.8) | 0.06 ± 0.02 (6.9) |
Intact | – | – | – | 5.8 ± 1.48 (2633) | 12.3 ± 1.1 (19) | 6.1 ± 1.7 (11) | 0.38 ± 0.04 (45) |
AP | |||||||
Cast | – | – | – | – | 0.06 ± 0.01 | 0.33 ± 0.59 | 0.01 ± 0.002 |
Cast+T | – | – | – | – | 0.21 ± 0.05 (3.6) | 1.33 ± 0.19 (4.1) | 0.08 ± 0.013 (9.5) |
Intact | – | – | – | – | 1.4 ± 0.3 (24) | 2.7 ± 0.22 (8.3) | 0.54 ± 0.04 (64) |
PLCa | Calr | PDI | Prdx6 | Probasin | EAPA2 | IgBPLP | |
---|---|---|---|---|---|---|---|
aMean ± s.e.m. (n = 5). Values are mRNA levels divided by β-actin mRNA levels (mol/mol β-actin). | |||||||
bValues in parenthesis are fold change in mRNA over the castrated.10-week-old male C57BL mice were castrated and maintained for a week (cast). They were killed 24 h after testosterone administration at 5 mg/kg bw, ip (Cast+T). Total RNA was isolated from each prostate lobe and amounts of mRNA were measured by real-time RT-PCR. | |||||||
VP | |||||||
Cast | 0.14 ± 0.081 | 0.2 ± 0.03 | 5.6 ± 1.2 | 3.7 ± 0.73 | – | – | – |
Cast+T | 0.23 ± 0.03 (1.6) | 0.7+0.1 (3.3) | 11.7 ± 2.1 (2.1) | 3.8 ± 1.41 (1.0) | – | – | – |
Intact | 0.17 ± 0.021 (1.2) | 0.7+0.09 (3.5) | 15.0 ± 2.1 (2.7) | 2.5 ± 0.3 (0.7) | – | – | – |
DLP | |||||||
Cast | 0.09 ± 0.014 | 0.2 ± 0.05 | 1.7 ± 0.32 | 1.5 ± 0.41 | 0.02 ± 0.003 | 0.19 ± 0.072 | 1.2 ± 0.29 |
Cast+T | 0.15 ± 0.02 (1.7) | 0.3+0.07 (1.5) | 4.5 ± 1.0 (2.7) | 2.1 ± 0.22 (1.4) | 0.05 ± 0.002 (2.3) | 2.4 ± 0.55 (13) | 1.6 ± 0.6 (1.4) |
Intact | 0.36 ± 0.085 (4.0) | 1.2+0.3 (6.4) | 8.3 ± 2.1 (5.0) | 21.7 ± 2.6 (14) | 2.2 ± 0.23 (124) | 18.9 ± 1.5 (102) | 67.9 ± 10.3 (58) |
AP | |||||||
Cast | 0.20 ± 0.03 | 0.4 ± 0.06 | 1.4 ± 0.3 | 1.2 ± 0.15 | 0.02 ± 0.004 | 0.17 ± 0.52 | 0.25 ± 0.18 |
Cast+T | 0.34 ± 0.085 (1.7) | 0.7 ± 0.05 (1.8) | 2.8 ± 0.5 (2.0) | 4.7 ± 0.93 (4.0) | 0.04 ± 0.008 (2.6) | 4.8 ± 0.9 (29) | 1.1 ± 0.8 (4.4) |
Intact | 0.60 ± 0.088 (3.0) | 1.1 ± 0.3 (2.8) | 4.0 ± 0.8 (2.8) | 29.0 ± 5.6 (25) | 0.78 ± 0.051 (49) | 5.5 ± 0.8 (33) | 53.0 ± 0.31 (215) |
Ontogeny of mRNA levels of identified proteins in the prostate
SBP | 91 K | PSP94 | EAPA2 | IgBPLP | |
---|---|---|---|---|---|
Means ± s.e.m. (n = 4). Values are mRNA levels divided by β-actin mRNA levels (mol/mol β-actin) 1, 2, 4, 6 and 11-week-old (W) male C57BL mice were killed. Total RNA was isolated from each prostate lobe and amounts of mRNA were measured by real-time RT-PCR. *P < 0.05 and †P < 0.01 vs. 1W. | |||||
VP | |||||
1W | 0.1 ± 0.04 | 0.1 ± 0.02 | 0.1 ± 0.05 | – | – |
2W | 17.9 ± 3.8* | 0.1 ± 0.01 | 0.2 ± 0.08 | – | – |
4W | 78.5 ± 15.3* | 0.8 ± 0.07† | 2.6 ± 0.23† | – | – |
6W | 503.0 ± 106* | 3.6 ± 0.23† | 16.0 ± 3.9† | – | – |
11W | 474.9 ± 77.3* | 4.4 ± 0.50† | 4.2 ± 0.6† | – | – |
DLP | |||||
1W | – | – | 0.0 ± 0.03 | 0.18 ± 0.06 | 0.05 ± 0.02 |
2W | – | – | 0.0 ± 0.01 | 0.42 ± 0.06* | 0.09 ± 0.02 |
4W | – | – | 1.1 ± 0.32* | 0.88 ± 0.27 | 0.68 ± 0.21 |
6W | – | – | 12.7 ± 1.5† | 3.95 ± 0.79* | 7.43 ± 1.5* |
11W | – | – | 4.0 ± 0.2† | 15.3 ± 2.36† | 102 ± 22.0† |
AP | |||||
1W | – | – | – | 0.18 ± 0.04 | 0.04 ± 0.01 |
2W | – | – | – | 0.74 ± 0.02* | 0.1 ± 0.02 |
4W | – | – | – | 1.10 ± 0.4 | 1.9 ± 0.26† |
6W | – | – | – | 3.55 ± 0.53† | 30.1 ± 3.6† |
11W | – | – | – | 5.50 ± 0.80† | 53.2 ± 8.1† |
Summary: identified mouse prostatic secretory proteins
Lobe specificity | mRNA decrease by castration | Description | |
---|---|---|---|
Abbreviation | |||
SBP | VP | + + | Known prostatic protein (Mills et al. 1987b) |
SPI-KT3 | VP, (SV) | + + + | Known prostatic protein (Mills et al. 1987a) |
91 kDa | VP | + + | Scavenger receptor cys-rich (SRCR) domains |
PSP94 | VP, DLP | + + + | Known prostatic protein (Xuan et al. 1999) |
ZnG | DLP > VP, AP | + | Ribonuclease activity? |
GRP78 | VP, DLP, AP | + | Heat-shock protein 70 family |
AGR2 | VP, DLP, AP | + | Human homolog expressed in prostatic cancer cell lines |
PLCa | VP, DLP, AP | + | Enzyme involved in phosphatidylinositol metabolism |
Calr | VP, DLP, AP | + | Calcium-binding protein |
PDI | VP, DLP, AP | + | Enzyme involved in protein folding |
Prdx6 | DLP, AP > VP | + + | Antioxidant protein |
Probasin | DLP, AP | + + + | Known prostatic protein (Johnson et al. 2002) |
EAPA2 | DLP, AP | + + + | No homology with any known protein |
IgBPLP | DLP, AP | + + + | IgG binding? Willebrand factor D domains, trypsin inhibitor like |
We thank Ms R Tai for her expert technical assistance and Dr S Izumi for his expert suggestions for mass spectrometry. This work was supported in part by a Grant-in-Aid (H16-Seikatsu) from the Ministry of Health, Labor and Welfare, Japan and a Grant-in-Aid (#17510046) from the Ministry of Education, Culture, Sports, Science and Technology, Japan. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.
References
Abate-Shen C & Shen MM 2002 Mouse models of prostate carcinogenesis. Trends in Genetics 18 S1–S5.
Cunha GR, Donjacour AA, Cooke PS, Mee S, Bigsby RM, Higgins SJ & Sugimura Y 1987 The endocrinology and developmental biology of the prostate. Endocrine Reviews 8 338–362.
Donjacour AA, Rosales A, Higgins SJ & Cunha GR 1990 Characterization of antibodies to androgen-dependent secretory proteins of the mouse dorsolateral prostate. Endocrinology 126 1343–1354.
Esposito C, Mariniello L, Cozzolino A, Amoresano A, Orru S & Porta R 2001 Rat coagulating gland secretion contains a kinesin heavy chain-like protein acting as a type IV transglutaminase substrate. Biochemistry 40 4966–4971.
Fujimoto N, Igarashi K, Kanno J, Honda H & Inoue T 2004 Identification of estrogen-responsive genes in the GH3 cell line by cDNA microarray analysis. Journal of Steroid Biochemistry and Molecular Biology 91 121–129.
Greenberg NM, DeMayo F, Finegold MJ, Medina D, Tilley WD, Aspinall JO, Cunha GR, Donjacour AA, Matusik RJ & Rosen JM 1995 Prostate cancer in a transgenic mouse. PNAS 92 3439–3443.
Hale LP, Price DT, Sanchez LM, Demark-Wahnefried W & Madden JF 2001 Zinc alpha-2-glycoprotein is expressed by malignant prostatic epithelium and may serve as a potential serum marker for prostate cancer. Clinical Cancer Research 7 846–853.
Heyns W 1990 Androgen-regulated proteins in the rat ventral prostate. Andrologia 22 (Suppl 1) 67–73.
Imasato Y, Onita T, Moussa M, Sakai H, Chan FL, Koropatnick J, Chin JL & Xuan JW 2001 Rodent PSP94 gene expression is more specific to the dorsolateral prostate and less sensitive to androgen ablation than probasin. Endocrinology 142 2138–2146.
Johnson MA, Hernandez I, Wei Y & Greenberg N 2000 Isolation and characterization of mouse probasin: an androgen-regulated protein specifically expressed in the differentiated prostate. Prostate 43 255–262.
Jones EL, Zhao MJ, Stevenson MA & Calderwood SK 2004 The 70 kilodalton heat shock protein is an inhibitor of apoptosis in prostate cancer. International Journal of Hyperthermia 20 835–849.
Klein RD 2005 The use of genetically engineered mouse models of prostate cancer for nutrition and cancer chemoprevention research. Mutation Research 576 111–119.
Krause KH & Michalak M 1997 Calreticulin. Cell 88 439–443.
Lai ML, Chen SW & Chen YH 1991 Purification and characterization of a trypsin inhibitor from mouse seminal vesicle secretion. Archives of Biochemistry and Biophysics 290 265–271.
Lee C, Tsai Y, Sensibar J, Oliver L & Grayhack JT 1986 Two-dimensional characterization of prostatic acid phosphatase, prostatic specific antigen and prostate binding protein in expressed prostatic fluid. Prostate 9 135–146.
Lei G, Arany I, Tyring SK, Brysk H & Brysk MM 1998 Zinc-alpha 2-glycoprotein has ribonuclease activity. Archives of Biochemistry and Biophysics 355 160–164.
Lexander H, Franzen B, Hirschberg D, Becker S, Hellstrom M, Bergman T, Jornvall H, Auer G & Egevad L 2005 Differential protein expression in anatomical zones of the prostate. Proteomics 5 2570–2576.
Lundwall A, Peter A, Lovgren J, Lilja H & Malm J 1997 Chemical characterization of the predominant proteins secreted by mouse seminal vesicles. European Journal of Biochemistry 249 39–44.
Maddison LA, Sutherland BW, Barrios RJ & Greenberg NM 2004 Conditional deletion of Rb causes early stage prostate cancer. Cancer Research 64 6018–6025.
McPherson SJ, Wang H, Jones ME, Pedersen J, Iismaa TP, Wreford N, Simpson ER & Risbridger GP 2001 Elevated androgens and prolactin in aromatase-deficient mice cause enlargement, but not malignancy, of the prostate gland. Endocrinology 142 2458–2467.
Mills JS, Needham M & Parker MG 1987a A secretory protease inhibitor requires androgens for its expression in male sex accessory tissues but is expressed constitutively in pancreas. EMBO Journal 6 3711–3717.
Mills JS, Needham M & Parker MG 1987b Androgen regulated expression of a spermine binding protein gene in mouse ventral prostate. Nucleic Acids Research 15 7709–7724.
Omoto Y, Imamov O, Warner M & Gustafsson JA 2005 Estrogen receptor alpha and imprinting of the neonatal mouse ventral prostate by estrogen. PNAS 102 1484–1489.
Robertson FG, Harris J, Naylor MJ, Oakes SR, Kindblom J, Dillner K, Wennbo H, Tornell J, Kelly PA, Green J et al.2003 Prostate development and carcinogenesis in prolactin receptor knockout mice. Endocrinology 144 3196–3205.
Shirai T, Takahashi S, Cui L, Futakuchi M, Kato K, Tamano S & Imaida K 2000 Experimental prostate carcinogenesis – rodent models. Mutation Research 462 219–226.
Utleg AG, Yi EC, Xie T, Shannon P, White JT, Goodlett DR, Hood L & Lin B 2003 Proteomic analysis of human prostasomes. Prostate 56 150–161.
Wang X, Phelan SA, Forsman-Semb K, Taylor EF, Petros C, Brown A, Lerner CP & Paigen B 2003 Mice with targeted mutation of peroxiredoxin 6 develop normally but are susceptible to oxidative stress. Journal of Biological Chemistry 278 25179–25190.
Wang MH, Grossmann ME & Young CY 2004 Forced expression of heat-shock protein 70 increases the secretion of Hsp70 and provides protection against tumour growth. British Journal of Cancer 90 926–931.
Weihua Z, Makela S, Andersson LC, Salmi S, Saji S, Webster JI, Jensen EV, Nilsson S, Warner M & Gustafsson JA 2001 A role for estrogen receptor beta in the regulation of growth of the ventral prostate. PNAS 98 6330–6335.
Wennbo H, Kindblom J, Isaksson OG & Tornell J 1997 Transgenic mice overexpressing the prolactin gene develop dramatic enlargement of the prostate gland. Endocrinology 138 4410–4415.
Wilhelm B, Keppler C, Henkeler A, Schilli-Westermann M, Linder D, Aumuller G & Seitz J 2002 Identification and characterization of an IgG binding protein in the secretion of the rat coagulating gland. Biological Chemistry 383 1959–1965.
Xuan JW, Kwong J, Chan FL, Ricci M, Imasato Y, Sakai H, Fong GH, Panchal C & Chin JL 1999 cDNA, genomic cloning, and gene expression analysis of mouse PSP94 (prostate secretory protein of 94 amino acids). DNA and Cell Biology 18 11–26.
Zhang JS, Gong A, Cheville JC, Smith DI & Young CY 2005 AGR2, an androgen-inducible secretory protein overexpressed in prostate cancer. Genes, Chromosomes and Cancer 43 249–259.
Zhu N, Pewitt EB, Cai X, Cohn EB, Lang S, Chen R & Wang Z 1998 Calreticulin: an intracellular Ca++-binding protein abundantly expressed and regulated by androgen in prostatic epithelial cells. Endocrinology 139 4337–4344.