Enhanced formation of non-phenolic androgen metabolites with intrinsic oestrogen-like gene transactivation potency in human breast cancer cells: a distinctive metabolic pattern

in Journal of Endocrinology
View More View Less
  • 1 1Reproductive Health Research, Training and Communication Unit, School of Medicine, Universidad Nacional Autónoma de México, Hospital General de México and Instituto Nacional de Perinatología, México City, México
  • 2 2Department of Reproductive Biology, Instituto Nacional de Ciencias Médicas y Nutrición S. Zubirán, México City, México
  • 3 3Department of Reproductive Biology, Universidad Autónoma Metropolitana Iztapalapa, Av. San Rafael Atlixco 186, Colonia Vicentina, Delegación Iztapalapa, México City, México

Breast cancer is a sex steroid hormone-dependent malignant neoplasia. The role of oestradiol in this malignancy has been well documented; however, the involvement of androgens has remained controversial. To determine the role of non-phenolic androgen metabolites in human breast cancer, we studied the metabolism of [14C] testosterone and [14C] androstenedione in oestrogen-dependent MCF-7 cells and non-oestrogen-dependent MDA-MB 231 cells, at different substrate concentrations (1–10 μM) and time periods (30 min–48 h). Cultured non-oestrogen-dependent HeLa and yeast cells served as controls. Metabolites were identified and quantified by reverse isotope dilution. A distinctive pattern of androgen metabolism was identified in MCF-7 cells, being the 5α-androstane-3α,17β-diol (3α,5α-diol) and its 3β epimer (3β,5α-diol), the major conversion products of testosterone (48.3%), with 5α-dihydrotestosterone as intermediary. The formation of 3α,5α-diol and 3β,5α-diol (diols) was substrate concentration- and time-dependent, and abolished by finasteride. In contrast, very little of any diol formation was observed in MDA-MB 231, HeLa and yeast cell incubations. Additional enzyme gene expression studies revealed an overexpression of 5α-steroid reductase type-1 in MCF-7 cells, as compared with MDA-MB 231 cells. The oestrogen-like activities of diols were assessed in HeLa cells co-transfected with expression vectors for α or β subtypes of the human oestrogen receptor (hER) genes and for an oestrogen-responsive reporter gene. The results show that 3β, 5α-diol and to a lesser extent 3α,5α-diol bind with high relative affinity to hERα and hERβ.

Both diols induced hER-mediated reporter gene transactivation in a dose–response manner, similar to that induced by oestradiol, though with lower potency, an effect that was abolished by ICI-182 780. Furthermore, 3β,5α-diol and to lesser extent 3α,5α-diol induced MCF-7 cell proliferation. The overall results demonstrated that MCF-7 cells exhibit enhanced expression and activity of androgen-metabolising enzymes, leading to rapid and large diol formation, and provide evidence that these androgen metabolites exert a potent oestrogen-agonistic effect, at genomic level, in oestrogen-dependent breast cancer cells. The data suggest that diols may act as in situ intracrine factors in breast cancer and that its formation can be pharmacologically inhibited.

Abstract

Breast cancer is a sex steroid hormone-dependent malignant neoplasia. The role of oestradiol in this malignancy has been well documented; however, the involvement of androgens has remained controversial. To determine the role of non-phenolic androgen metabolites in human breast cancer, we studied the metabolism of [14C] testosterone and [14C] androstenedione in oestrogen-dependent MCF-7 cells and non-oestrogen-dependent MDA-MB 231 cells, at different substrate concentrations (1–10 μM) and time periods (30 min–48 h). Cultured non-oestrogen-dependent HeLa and yeast cells served as controls. Metabolites were identified and quantified by reverse isotope dilution. A distinctive pattern of androgen metabolism was identified in MCF-7 cells, being the 5α-androstane-3α,17β-diol (3α,5α-diol) and its 3β epimer (3β,5α-diol), the major conversion products of testosterone (48.3%), with 5α-dihydrotestosterone as intermediary. The formation of 3α,5α-diol and 3β,5α-diol (diols) was substrate concentration- and time-dependent, and abolished by finasteride. In contrast, very little of any diol formation was observed in MDA-MB 231, HeLa and yeast cell incubations. Additional enzyme gene expression studies revealed an overexpression of 5α-steroid reductase type-1 in MCF-7 cells, as compared with MDA-MB 231 cells. The oestrogen-like activities of diols were assessed in HeLa cells co-transfected with expression vectors for α or β subtypes of the human oestrogen receptor (hER) genes and for an oestrogen-responsive reporter gene. The results show that 3β, 5α-diol and to a lesser extent 3α,5α-diol bind with high relative affinity to hERα and hERβ.

Both diols induced hER-mediated reporter gene transactivation in a dose–response manner, similar to that induced by oestradiol, though with lower potency, an effect that was abolished by ICI-182 780. Furthermore, 3β,5α-diol and to lesser extent 3α,5α-diol induced MCF-7 cell proliferation. The overall results demonstrated that MCF-7 cells exhibit enhanced expression and activity of androgen-metabolising enzymes, leading to rapid and large diol formation, and provide evidence that these androgen metabolites exert a potent oestrogen-agonistic effect, at genomic level, in oestrogen-dependent breast cancer cells. The data suggest that diols may act as in situ intracrine factors in breast cancer and that its formation can be pharmacologically inhibited.

Introduction

The key role of oestrogens for both the initiation and progression of most breast cancer tumours has been well established (Kirschner 1979, Nicholson et al. 1988, Pike & Spicer 1991, Pike et al. 1993, Musgrove & Sutherland 1994, Pasqualini & Chetrite 1996, Girdler & Brotherick 2000); however, the precise involvement of other sex steroid hormones on this malignancy has remained a controversial issue. Evidence has accumulated indicating that androgens may act as either stimulating or inhibiting hormonal agents in breast cancer, though the mechanisms by which they exert these effects have not yet been elucidated. Indeed, numerous studies in animal models have shown that androgens, at physiological concentrations, stimulate growth in mammary cancer (Smith & King 1972, Liao et al. 1998, Xie et al. 1999, Liao & Dickson 2002, Somboonporn & Davis 2004), while other reports have indicated that their administration results in tumour regression of chemically and hormone-induced breast cancers (Costlow et al. 1976, Zhou et al. 2000). The inhibitory capability of androgens in human breast cancer has been documented in experimental and clinical studies (Poulin et al. 1988, Jørgensen et al. 1997, Szelei et al. 1997, Adams 1998, Labrie et al. 2003, Greeve et al. 2004, Somboonporn & Davis 2004), though the absence of anti-proliferative effects on several human breast cancer cells has also been reported (Roy et al. 1992). Interestingly, several studies have shown that androgens may exhibit an initial inhibitory effect that shift to a late stimulatory effect on human breast cancer cell proliferation (Lippman et al. 1976, Hackenberg et al. 1993, Labrie et al. 1998, Aspinall et al. 2004).

The presence of androgens in normal and malignant breast tissue, as well as their enzyme-mediated conversion to oestrogens, has been well documented in pre- and post-menopausal women (reviewed in Pasqualini & Chetrite (1996)). Although the aromatisation of androgens in breast cancer cells has remained controversial, low, but reproducible aromatase activity has been detected in MCF-7 cells (Sonne-Hansen & Lykkesfeldt 2005). To avoid oestrogen formation, several aromatase inhibitors have been widely used in therapeutic schemes in breast cancer (Coombes et al. 1987, Santen et al. 1990, Demers 1994, Goss 1999, Ragaz 1999, Sasano et al. 1999), although the oestrogen-like effects of androgens are not completely suppressed by this treatment (Brodie et al. 1977, Brodie & Longcope 1980, Coombes et al. 1984, Wing et al. 1985, Lippman 1998, Buzdar 2002, Lønning 2004, Brueggemeier et al. 2005). These observations raise the important question as to whether androgens are locally bioconverted to non-phenolic metabolites with intrinsic oestrogenic activities. Androgen-metabolising enzymes, other than aromatase, have been identified and characterised in human breast cancer tissue and cells (Bonney et al. 1983, Labrie et al. 1992, 1997, 2000, Sasano et al. 1996, Gingras et al. 1999, Ariga et al. 2000, Suzuki et al. 2000), and an over-expression of 5α-steroid reductase type-1 gene has been reported in human breast cancer tumours (Suzuki et al. 2001).

To determine whether androgens are bioconverted to A-ring-reduced derivatives with intrinsic oestrogen-agonistic potency in breast cancer, we studied the metabolism of [14C]-labelled testosterone and Δ4A in oestrogen-dependent (MCF-7) and non-oestrogen-dependent (MDA-MB 231) human breast cancer cells. Non-oestrogen-dependent human uterine cervical cancer (HeLa) cells and yeast cells served as experimental controls. The results disclose a distinctive androgen-metabolic pathway in MCF-7 cells, characterised by overexpression and enhanced activities of the androgen-metabolising enzymes, resulting in a large formation of 3α,5α-diol and 3β,5α-diol. In subsequent studies, the oestrogen-like activity of both the diols, was assessed by their binding affinity to the α and β subtypes of the human oestrogen receptor (hER), their capability to activate oestrogen response elements of a reporter gene in the construct assay employed, and their ability to induce cell proliferation in MCF-7 cells.

Further interest for the conduction of this study stemmed from the recent observations in our laboratory (Lemus et al. 2000, 2001, Larrea et al. 2001, Santillán et al. 2001, García-Becerra et al. 2002), demonstrating that the A-ring tetrahydro-reduced metabolites of norethisterone, levonor-gestrel and gestodene, possess oestrogen-agonistic activities, suggesting that they could be involved in the activation of breast cancer cell proliferation induced by high doses of synthetic contraceptive progestins derived from 19-nor testosterone, as it has been previously reported (Catherino et al. 1993, Schoonen et al. 1995a,1995b).

Materials and Methods

Steroids and chemicals

[4-14C] Testosterone ([14C]-T), specific activity (sp. act.) 45 mCi/mmol; [4-14C] androstenedione ([14C]-Δ4A), sp. act. 57.5 mCi/mmol; [2,4,6,7,16,17-3H] oestradiol ([3H]-E2), sp. act. 148 Ci/mmol, [ring-3,5-3H] chloramphenicol, sp. act. 50 Ci/mmol and [3H] thymidine, sp. act. 14 Ci/mmol were purchased from NEN Research Products (Boston, MA, USA) and non-radioactive steroids were supplied by Sigma. Cell culture media, enzymes, gene primers and reverse transcriptase (RT)-PCR kits and reagents were purchased from Invitrogen. Fetal bovine serum (FBS) was supplied by Hyclone Laboratories, Inc. (Logan, UT, USA). All reagents and solvents used were of analytical grade.

Cell lines and culture

Human breast cancer cells lines MCF-7 (hER dependent) and MDA-MB 231 (hER independent), obtained from Dr A Zentella (Instituto Nacional de Ciencias Médicas y Nutrición S. Zubirán, Mexico City, México) were cultured in T-45 flasks with phenol red Dulbecco’s modified Eagle medium-high glucose (DMEM-HG) containing l-glutamine and supplemented with 5% FBS, 100 U/ml penicillin, 100 μg/ml streptomycin and 10 nM oestradiol, in a 95% air:5% CO2 atmosphere, at 37 °C. Human uterine cervical cancer (HeLa) cells, kindly supplied by Dr A J Cooney (Baylor College of Medicine, Houston, TX, USA), were cultured in T-45 flasks with phenol red DMEM-HG containing l-glutamine and supplemented with 10% stripped FBS, 100 U/ml penicillin and 100 μg/ml streptomycin in a 95% air:5% CO2 atmosphere, at 37 °C. Yeast cells (Saccharomyces cerevisiae), were cultured in gold medium at 32 °C by continuous shaking using air as the gas phase.

Androgen metabolism

To assess the in situ conversion of androgens to A-ring-reduced derivatives in human breast cancer, the metabolism of [14C]-Tand [14C]-Δ4A in MCF-7 and MDA-MB 231 cells maintained in culture was studied using HeLa and yeast cells as experimental controls. Incubations were done at a cell density of 2 × 106, at 37 °C, in a 95% air:5% CO2 atmosphere, using the increasing substrate concentrations (1–10 μM) of either [14C]-T or [14C]-Δ4A, for different time periods (30 min–48 h), at pH 7.4 and 5.2, in the absence or presence of 1 mM finasteride (Merck). All incubations were carried out in phenol red-free and oestradiol-free, supplemented DMEM-HG culture medium. To determine the activities of the two types of 5α-steroid reductases (Russell & Wilson 1994), incubations were carried out at pH 7.4 and 5.2. In addition, similar incubations were done using cell homogenates at pH 7.4 and 5.2, in the presence of 2.5 μM NADPH. Final incubation volume was 3 ml. Cell-free and boiled inactivated cell incubations, carried out under identical conditions, were used as negative controls. Protein content was determined by a protein–dye-binding method (Bradford 1976) using BSA as standard. At the end of the incubation period, the reaction was stopped by the addition of ethyl acetate, and radiolabelled steroids were extracted (4 × ) using three volumes of water-saturated ethyl acetate. The organic extracts were partitioned between petroleum ether and 10% aqueous methanol, and 2.5 μg each of the following steroid carriers were added to the methanolic extracts: testosterone (T), 17β-hydroxy-4-androstene-3-one; 5α-dihydrotestosterone (DHT), 17β-hydroxy-5α-androstane-3-one; 3α,5α-androstanediol (3α,5α-diol), 5α-androstane-3α,17β-diol; 3β,5α-androstane-diol (3β,5α-diol), 5α-androstane-3β,17β-diol; androstenedione (Δ4A) 4-androstene-3,17-dione and 5α-dihydroandrostane-dione (5α-A), 5α-androstane-3,17-dione. The identification and radiochemical purity of androgen metabolites were established by a reverse isotope dilution technique, which included identical behaviour to that of the steroid carriers in two different thin layer chromatographic systems (chloroform:ace-tone, 9:1 and benzene:ethyl acetate, 2:1) and recrystallisations to obtain a constant sp. act. Radioactive labelled [14C] metabolites were located on chromatographic plates using a Packard instant imager (Downers Grove, IL, USA). Radioactivity was otherwise determined in a Packard Tri-Carb liquid scintillation spectrometer model 1900 TR (Packard Instrument Company, Inc.), using toluene containing 4 g/l 2,5-diphenyloxazole (PPO) and 100 mg/l dimethyl 1,4-bis-2-(4-methyl-5-phenyloxazolyl)-benzene as the counting solution. The counting efficiency for [14C] was 86% and [3H] was 65% and quenching was corrected in all samples by external standardisation. Non-radioactive steroid carriers were detected on chromatograms using the p-anisaldehyde–sulphuric/acetic acids reagent. The formation rates of the metabolic conversion products of androgens are expressed as pmol/mg of protein per hour. The enzyme-mediated bioconversion of androgens in MCF-7, MDA-MB 231 and HeLa cells is expressed as the percent conversion of testosterone and Δ4A to their non-phenolic metabolites, as a function of time.

Steroid enzyme expression

The gene expression of androgen-metabolising enzymes in MCF-7 and MDA-MB 231 cells was studied by RT-PCR. Total RNA from the cells (6 × 106) was extracted using TRIzol reagent and an aliquot (5 μg) from each sample was subjected to reverse transcription using a Superscript first strand cDNA synthesis kit (Invitrogen), according to the manufacturer’s protocol. Semi-quantitative PCR was performed using 2.5 U Platinum Taq DNA polymerase, 4 mM MgCl2, 0.4 mM dNTPs and 4 mM of each gene-specific steroid enzyme primer, using GAPDH as an internal standard. All PCRs were done up to 30 cycles, each cycle consisting of 5 min at 94 °C, 30 s at 52–64 °C and 7 min at 72 °C. PCR products were electrophoresed on ethidium bromide-containing 1.2% agarose gels, and the bands were subjected to scanning densitometry using a gel analyzer (Kodak). Results are given as relative density (mRNA enzyme/mRNA GAPDH). Gene-specific primer sequences were as follows: human steroid 5α-reductase type-1 (SRD5A1; NM_001047): 5′TGGGAGGAGGAAAGCCTATG (sense), 5′GCCACA-CCACTCCATGATTTC (anti-sense); human steroid 5α-reductase type-2 (SRD5A2; NM_000348): 5 ′CATACG-GTTTAGCTTGGGTGT (sense), 5′GCTTT CCGAGATTT-GGGGTAG (anti-sense); human 3β-hydroxysteroid dehydrogenase (AKR1C1; NM_001353) 5 ′GTAAAGCTTT-AGAGGCCAC (sense), 5′CACCCAT GCTTATTATCGG (anti-sense); human 3α-hydroxysteroid dehydrogenase (AKR1C2; NM_001354) 5′GTAAA GCTCTAGAGGCCGT (sense), 5′CACCCATGGTTCTT CTCGA (anti-sense) and human GAPDH: 5′TTCGCT CTCTGCTCCTCCTG (sense), 5′ACCCGTTGACTCC GACCTTC (anti-sense).

Each PCR was run three times in duplicate according to the manufacturer’s recommendations and default settings.

Plasmid constructs

The expression vectors for human ERα and ERβ genes (plasmid of the cytomegalovirus (pCMV)5-hERα and pCMV5-hERβ) containing the coding sequence of hERα and hERβ were kindly provided by Dr A J Cooney. The oestrogen responsive reporter plasmid containing a fragment of the vitellogenin A2 gene promoter (positions −331 to −87) upstream of the adenovirus E1b promoter region fused to the chloramphenicol acetyltransferase (CAT) gene (ERE-E1b-CAT) was constructed according to the method described by Smith et al.(1993).

Transfections

The HeLa cells were plated the day before transfections in a six-well plate at a density of 3 × 105 cells/well in phenol red-free DMEM-HG supplemented with 5% stripped FBS, 100 U/ml penicillin and 100 μg/ml streptomycin. Cells were maintained in a 95% air:5% CO2 atmosphere at 37 °C. The next day, cells were visualised in a microscope to assure that the cell density was 30–50% confluent. Transfections were performed in triplicate using SuperFect (Qiagen), according to the manufacturer’s protocol. Briefly, serum-free media (100 μl) was aliquoted and DNA added (1 μg reporter gene plasmid and 0.025 μg of either hERα or hERβ gene expression vectors) and vortexed. SuperFect reagent (10 μl) was added and vortexed for additional 10 s. Following incubation at room temperature for 5–10 min, 600 μl supplemented DMEM-HG was added to each tube. The medium containing the transfection complexes was added to the cell monolayer previously rinsed with PBS. The plates were incubated for 3 h in a 95% air:5% CO2 atmosphere, at 37 °C. After incubation, the plates were rinsed with PBS and 3 ml supplemented DMEM-HG was added to each well.

Binding affinity of androgen metabolites to hER

After transfection, cells were harvested by centrifugation and washed with TEDLM buffer (20 mM Tris–HCl, pH 7.4 at 4 °C, 1.5 mM EDTA, 0.25 mM dithiotreitol, 10 μg/ml leupeptine and 10 mM sodium molibdate) in a ratio (w/v) 1:6. The cytosolic fraction was obtained by vortexing the cells with glass beads in TEDLM buffer followed by centrifugation at 180 000 g, for 1 h, at 2 °C, in an SW 50.1 rotor (Beckman Instruments, Palo Alto, CA, USA). To assess the binding affinity of 3α,5α-diol and 3β,5α-diol to hERα and hERβ, cytosol aliquots (0.5 mg protein/ml) of the co-transfected HeLa cells were incubated with 1 nM [3H]-E2 at 4 °C for 18 h, in the absence or presence of increasing concentrations (1–1000 nM) of radioinert oestradiol, 3α,5α-diol and 3β,5α-diol. Bound and free steroid fractions were separated by the addition of 800 μl Dextran-coated charcoal suspension (250 mg Norit-A and 25 mg Dextran T-70) in 100 ml TEDLM buffer and incubated for 10 min at 4 °C. Following centrifugation at 800 g, at 4 °C, for 15 min, aliquots (200 μl) of the supernatants were submitted to radioactive counting. Radioactive content in the aqueous samples was determined using Insta-Gel Plus (Packard, Downers Grove, IL, USA) as counting solution. The results are expressed as the relative binding affinities (RBA) and the inhibition constants (Ki) of steroid competitors, as described by Reel et al.(1979) and Cheng & Prusoff (1973) respectively.

Oestrogen-agonistic effect of androgen metabolites

The oestrogen-agonistic actions of androgen metabolites were assessed in transiently co-transfected HeLa cells with the mammalian expression vector for hERα or hERβ genes and its cognate reporter vector ERE-E1b-CAT, using oestradiol as control. Twenty-four hours after co-transfection, cells were incubated in a complete medium containing the increasing concentrations (1 × 10−12–1 × 10−6 M) of 3α,5α-diol, 3β,5α-diol and oestradiol, using dimethyl sulfoxide as the steroid vehicle. Incubations were carried out in the absence or presence of 1 × 10−7 M ICI-182 780 (Zeneca Farma, Mexico City, Mexico), a potent steroidal antioestrogen, in a 95% air:5% CO2 atmosphere, for 24 h at 37 °C. At the end of the incubation period, cells were harvested and submitted to the liquid CAT assay as previously described (Lemus et al. 2000, García-Becerra et al. 2002). Results of the transactivation studies are expressed as the effective concentration values (EC50) of 3α,5α-diol, 3β,5α-diol and oestradiol, obtained by a non-linear regression analysis, using a scientific graphic software (Origin 6.1; OriginLab, Northampton, MA, USA).

Cell proliferation studies

The MCF-7 cells were cultured in DMEM without phenol red, containing heat-inactivated FBS (5% v/v), 2 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin. Cells were incubated in six-well plates at a density of 1 × 106 cell/well in a 5% CO2 humidified incubator at 37 °C. After 24 h, the medium was replaced with DMEM containing dextran/charcoal-stripped FBS (2.5%) and oestradiol (1 × 10−9 M) or 3α,5α-diol or 3β, 5α-diol (1 × 10−7 M) dissolved in ethanol and incubated for 48 h. Cells were quantified and scored to measure proliferation rate (Lopez-Diazguerrero et al. 2006). [3H]-Thymidine (1 μCi) was added to the culture medium and incubated for additional 24 h. Cells were washed with PBS and fixed for 15 min with 500 μl of 95% methanol in PBS. Subsequently, cells were gently washed twice with PBS and 500 μl 0.2 M NaOH were added. Alkaline extracts were submitted to radioactivity counting. Results were expressed as the cell proliferation (%) induced by diols, using oestradiol and vehicle as controls.

Statistical analysis

The comparisons of experimental groups with controls in metabolic studies were done by one-way ANOVA and statistical differences between groups were established by Student’s t-test, using the SigmaStat statistical software (Jandel Corporation, San Rafael, CA, USA). Group differences were considered significant when P < 0.001 was reached (two-tailed test). Variance analysis of enzyme expression and cell proliferation studies was performed using the statistical software Statistical Package for the Social Sciences (SPSS, Inc., Chicago, IL, USA) and group differences were considered significant when P < 0.05 was reached.

Results

Androgen metabolism in MCF-7 and MDA-MB 231 cells

After partition of the MCF-7 cells organic extracts, 96% of the incubated radioactive material was recovered in the methanolic fraction. When aliquots of methanolic extract from [14C]-T incubations were submitted to thin-layer chromatography, four radioactive zones were detected, as shown in Fig. 1A. Zone 1 (RF = 0.22), representing the major metabolic conversion products of [14C]-T, had a chromatographic behaviour identical to those of the 3α,5α-diol and 3β,5α-diol carriers. After elution, representative aliquots were separately mixed with additional radioinert 3α,5α-diol and 3β,5α-diol and recrystallised to constant sp. act. (Table 1). Formation of 3α,5α-diol was higher than that of its 3β isomer. Zone 2 (RF = 0.34) was identified as unchanged [14C]-T, while zones 3 (RF = 0.46) and 4 (RF = 0.55) corresponded to DHTand Δ4A respectively. The radiochemical purity of these [14C]-T metabolites is shown in Table 1. Chromatographic analysis of the MDA-MB 231 cells methanolic extracts revealed a completely different [14C]-T conversion pattern (Fig. 1B), with limited conversion to DHTand diols, and very little formation of Δ4A. The metabolism of [14C]-T in HeLa cells was characterised by large bioconversion to Δ4A and limited formation of DHT and 5α-A. No diols were detected in the HeLa cells methanolic extracts, as depicted in Fig. 1C.

Chromatographic analysis of the organic extracts from [14C]-Δ4A incubations with MCF-7 cells revealed the presence of five radioactive zones (Fig. 1D). Zone 1 (RF = 0.22) and zone 2 (RF = 0.34), representing one the major metabolic conversion products of [14C]-Δ4A, were identified as diols and testosterone respectively. Their radiochemical purity is shown in Table 1. Zone 3 (RF = 0.46) had a chromatographic behaviour identical to that of DHT. Zone 5 (RF = 0.67) had a chromatographic mobility corresponding to that of 5α-A and zone 4 (RF = 0.55) corresponded to unconverted [14C]-Δ4A. The radiochemical purity of A-ring-reduced metabolites of [14C]-Δ4A is shown in Table 1. In contrast, the metabolic conversion pattern of [14C]-Δ4A in MDA-MB 231 cells (Fig. 1E) was completely different from that observed in MCF-7 cells. The metabolism of [14C]-Δ4A in HeLa cells was characterised by a limited biotransformation to testosterone and 5α-reduced metabolites, as depicted in Fig. 1F.

The metabolism of testosterone in MCF-7, MDA-MB 231 and HeLa cells, as a function of substrate concentration is shown in Fig. 2. Incubations were carried out at 37 °C, for 2 h, at pH 7.4 and 5.2. The metabolic pattern of [14C]-T in MCF-7 cells (Fig. 2A and B) was similar in incubations carried out at both pH levels, with the distinctive feature of a large formation of diols, noticed even at the lowest substrate concentration. Interestingly, a significantly larger formation of diols occurred in incubations at pH 7.4 as compared with those at pH 5.2. In contrast, very little, if any, diol formation was noticed in incubations of MDA-MB 231 and HeLa cells with [14C]-T, even at the highest substrate concentration studied (Fig. 2C–F). A large formation of Δ4A at both pH levels was observed in HeLa cells and a limited bioconversion of testosterone to DHT. When MCF-7 cell homogenates, added with NADPH, were incubated with [14C]-T for 2 h, the percent conversion of testosterone to diols was significantly higher at pH 7.4 (63.2%), as compared with those at pH 5.2 (37.4%).

The metabolism of [14C]-Δ4A in MCF-7, MDA-MB 231 and HeLa cells, as a function of substrate concentration, at pH 7.4 and 5.2 is shown in Fig 3. The bioconversion pattern of Δ4A in MCF-7 cells was similar in incubations carried out at both pH levels (Fig. 3A and B), and was characterised by a simultaneous large formation of testosterone and 5α-reduced metabolites (5α-A, diols and DHT). A moderately large formation of 5α-reduced [14C]-Δ4A metabolite was noticed in incubations at pH 7.4 as compared with those at pH 5.2. Similar results were obtained in incubations of MCF-7 cell homogenates with [14C]-Δ4A. On the contrary, the bioconversion pattern of [14C]-Δ4A in MDA-MB 231 and HeLa cells was characterised by very little formation of testosterone, noticed only at the highest substrate concentration used, and a relatively higher formation of 5α-A, particularly in incubations undertaken at pH 7.4 (Fig. 3C–F).

The enzyme-mediated formation of 5α-reduced metabolites of testosterone in MCF-7, MDA-MB 231 and HeLa cells, as a function of time, is depicted in Fig. 4. Cells were incubated with 2 μM [14C]-T at 37 °C, pH 7.4, at different time periods. The results demonstrated that radiolabelled testosterone incubated with MCF-7 cells was extensively bioconverted to diols, presumably through its prior conversion to DHT. Indeed, the maximal accumulation of DHT occurred at 30 min of incubation with a subsequent decline and a concomitant time-dependent increase on the formation of diols (Fig. 4A). At 48 h incubation, 48.3% of the [14C]-labelled testosterone was bioconverted to diols. According to recrystallisation data, the formation of 3α,5α-diol and 3β,5α-diol occurred in a ratio of 2:1. In sharp contrast, the absence of formation of diols was observed in incubations of MDA-MB 231 and HeLa cells with [14C]-T, with very small and delayed formation of DHT (Fig. 4B and C). The effect of a 5α-steroid reductases inhibitor on the metabolism of androgens in MCF-7 cells is shown in Fig. 5. Cells were incubated with 2 μM [14C]-T or [14C]-Δ4A, at 37 °C, for 48 h, at pH 7.4, in the absence or presence of 1 mM finasteride. As it can be seen, the addition of finasteride resulted in a significant diminution of the bioconversion of radiolabelled testosterone and Δ4A to their corresponding 5α-dihydro metabolites and in an abolishment of diols formation (Fig. 5, inserts). In all incubations with MCF-7, MDA-MB 231 and HeLa cells, neither oestradiol nor oestrone was detected as conversion products of [14C]-T and [14C]-Δ4 A. Only unmodified [14C]-labelled substrates were identified in incubations using yeast cells, boiled inactivated cells and cell-free preparations, used as negative controls.

Enzymes gene expression profile in MCF-7 and MDA-MB 231 cells

The results from androgen-metabolising enzymes gene expression in the two cell lines studied, as determined by semi-quantitative RT-PCR assays, are shown in Fig. 6. The level of expression of SRD5A1 was significantly (P < 0.05) higher in MCF-7 cells, as compared with MDA-MB 231 cells. In contrast, the expression of SRD5A2 in both cell lines did not exhibit differences. Interestingly, the expression of SRD5A1 was significantly higher (P < 0.01) in both cell lines, as compared with SRD5A2. The expression level of AKR1C1 and AKR1C2 was similar in MCF-7 and MDA-MB 231 cells, though the expression of AKR1C1 was significantly higher (P < 0.001) than that of AKR1C2 in both cell lines studied.

Binding affinity of androstanediols to hER

The effect of increasing concentrations of non-radioactive diols upon the [3H]-E2 binding to hER in HeLa cells transfected with expression vectors for either hERα or hERβ is shown in Fig. 7. The [3H]-E2 bound to hER in the absence of steroid competitors was set at 100% in this radioligand competitive assay. Even though both diols were competitors for hERα, the 3β,5α-diol exhibited higher affinity (RBA = 1.9%; Ki = 3.25 nM) than its 3α-isomer (RBA = 0.009%; Ki = 625 nM). The 3β,5α-diol was more efficient competitor for the β subtype of hER (RBA = 0.92%; Ki = 6.5 nM) than 3α,5α-diol (RBA = 0.006%; Ki = 950 nM). The 3β,5α-diol and to a lesser extent its 3α-isomer, bound to both subtypes of hER, in a similar manner to that of oestradiol used as positive control, though with lower affinity.

Oestrogen-like transactivation effect of androstanediols

The transactivation effect of 3α,5α-diol and its 3β-isomer in the co-transfected cell expression system employed is shown in Fig. 8. Both diols induced the transactivation of hERα-mediated CAT activity, in a dose–response manner, similar to that induced by oestradiol, yet with lower potency (Fig. 8A and B). At steroid concentrations that induced the highest CAT gene transactivation, the oestrogen-like effect of 3β,5α-diol (1 × 10−7 M) was 100-fold less potent than oestradiol (1 × 10−9 M), whereas 3α,5α-diol (1 × 10−6 M) was tenfold less potent than 3β,5α-diol as depicted in Fig. 8A and B. The effect of both diols on hERβ-mediated reporter gene transcription, as compared to that of oestradiol, is shown in Fig. 8C and D. The highest oestrogen-agonistic transactivation effect of 3β,5α-diol (1 × 10−7 M) was 100-fold less potent than oestradiol (1 × 10−9 M), while 3α,5α-diol induced transactivation only at the highest concentration employed (1 × 10−6 M). The comparative potencies of both diols and oestradiol, to induce CAT gene transactivation mediated by the subtypes α and β of hER, as judged by their EC50, are depicted in Table 2.

The addition of ICI-182 780 to cell culture incubations, significantly inhibited (P < 0.001) the ability of 3β,5α-diol, 3α,5α-diol and oestradiol to stimulate hERα- and hERβ-mediated transcriptional activities as shown in Fig. 9. These results ensured the stimulatory activity of diols via both subtypes of hER.

Effect of diols in cell proliferation

To assess the effect of 3α,5α- and 3β,5α-diols on cell proliferation in MCF-7 cells, a set of experiments using [3H]-thymidine incorporation method was undertaken in triplicate. Oestradiol and vehicle served as experimental controls. The results indicated that after 48 h treatment, 3β,5α-diol (1 × 10−7 M) was capable of increasing the proliferation rate in MCF-7 cells significantly (150%) as compared with vehicle, in a similar fashion to that exerted by 1 × 10−9 M oestradiol (140%). Treatment with 1 × 10−7 M 3α,5α-diol also increased cell proliferation (50%) as compared with vehicle in MCF-7 cells. The effect of oestradiol, 3α,5α- and 3β,5α-diols on MCF-7 cell proliferation was not seen in MDA-MB 231 cells.

Discussion

The results of this study clearly demonstrate that oestrogen-dependent human breast cancer cells efficiently biotransform androgens to A-ring tetrahydro-reduced metabolites, which possess the capability to transactivate oestrogen-regulated genes mediated by the α and β subtypes of hER. Indeed, MCF-7 cells incubated with radiolabelled androgens exhibited a large and rapid formation of tetrahydro-reduced metabolites, thus indicating a great activity of 5α-steroid reductases, types 1 and 2, and two enzymes of the aldo–keto reductases family, the 3α-hydroxysteroid dehydrogenase and the 3β-hydroxysteroid dehydrogenase. The large conversion of testosterone to 3α,5α- and 3β,5α-diols in MCF-7 cells had DHT as an obligatory intermediary as it was demonstrated by its inhibition induced by finasteride. This observation supports the concept that formation of diols from testosterone requires enzyme-mediated 5α-reduction (trans A/B ring junction) as the first metabolic step. In contrast, non-oestrogen-dependent MDA-MB 231 cells exhibited a limited bioconversion of androgens to 5α-reduced metabolites and very little, if any, formation of diols. An absence of bioconversion of androgen to diols was observed in HeLa and yeast cell incubations used as controls. The finding of an enhanced enzyme 5α-steroid reductase activity in MCF-7 cells, particularly in experiments carried out at pH 7.4, is in line with the report of Suzuki et al.(2001), who have demonstrated an overexpression of the 5α-steroid reductase type-1 gene in human breast cancer tissues. Interestingly, our results revealed a selectively higher expression level of SRD5A1 in MCF-7 cells as compared with MDA-MB 231 cells, indicating a good agreement between enzyme expression levels and activities in human breast cancer cells. In contrast, no difference on the expression levels of AKR1C1 and AKR1C2 in MCF-7 and MDA-MB 231 cells was noticed. These results confirm and extend the report of Wiebe et al.(2000), who, using radiolabelled progesterone as substrate, demonstrated an enhanced 5α-steroid reductase activity and also an over-expression of the 5α-steroid reductase type-1 gene in MCF-7 cells, as compared with oestrogen-resistant breast cells (MCF-10A). Furthermore, Wiebe & Lewis (2003) demonstrated the lower expression levels of 3α- and 3β-hydroxysteroid dehydrogenase genes in breast cancer tissues as compared with paired breast normal tissue.

Another striking finding of this study was that 3α,5α- and 3β,5α-diols, the major metabolic conversion products of testosterone in MCF-7 cells, interact with relatively high binding affinity with both subtypes of hER and are capable of transactivating an oestrogen-dependent reporter gene (CAT) in the transiently co-transfected cell expression system employed, resembling the effects of naturally occurring oestradiol, though with lower potency. It must be underlined than even the formation of 3α,5α-diol from testosterone was almost double than that of its 3β-epimer, according to recrystallisation data, the 3β,5α-diol exhibited higher hER-binding affinity and higher oestrogen-like transactivation potency, as compared with its 3α-epimer, as shown in Fig. 8 and Table 2. Further evidence that diols-induced gene transactivation in the construct assay is mediated via hREα and hERβ, was derived from the observation that ICI-182 780 was able to preclude this effect. Our results confirm and extend previous reports on the activation of hERα by 3β,5α-diol. (Maggiolini et al. 1999, García-Becerra et al. 2002). These data are similar, though non-identical, with our previous observations with the tetrahydro-reduced metabolites of synthetic 19-nor progestins, which are also able to transactivate oestrogen-dependent genes mediated through hERα, but not through hERβ, behaving as selective hER modulators (Lemus et al. 2000, Larrea et al. 2001, García-Becerra et al. 2002). Even though the different structural characteristics for the α and β subtypes of hER displayed by the tetrahydro metabolites of naturally occurring androgens and those of 19-nor progestins have been studied (Kubli-Garfias et al. 1998, 2002), the understanding of their binding mechanisms still awaits further studies.

The study of enzyme gene expression disclosed that the large formation of diols in MCF-7 cells, with potent intrinsic oestrogen-agonistic effects at the genomic level, is the result of enhanced local activities of 5α-steroid reductases. This is mainly due to an overexpression of SRD5A1 and may have an important physiopathological significance, since these locally produced androgen metabolites are exerting their oestrogen-like intracrine effects in the same cells in which their synthesis take place, without significant diffusion into the circulation (Gingras et al. 1999, Labrie et al. 2003, Suzuki et al. 2005). Although diols could be inactivated via glucuroconjugation, the enzymes responsible for this metabolic process (glucuronosyl-transferases) have not been characterised in the human mammary gland (Labrie et al. 2003). This observation is in line with the results of the present study, in which no water-soluble androgen metabolites were found. Furthermore, the role of 3β,5α-diol in breast cancer and other hormone-dependent neoplasias deserves further investigation because, in addition to its potent oestrogen-agonistic effects mediated via both subtypes of hER, its bioformation, in contrast to 3α,5α-diol, is virtually irreversible (Steckelbroeck et al. 2004). In addition, 3β,5α-diol may exert anti-proliferative and apoptotic effects in prostate epithelial cells through its interaction with hERβ (Weihua et al. 2001, 2002). The preliminary results presented herein demonstrating that 3β,5α-diol and to a lesser extent its 3α-epimer are capable of inducing cell proliferation in cultured MCF-7 cells, in a similar manner to that of oestradiol, yet with lower potency, suggest the involvement of diols in breast cancer progression, however, further studies are required to have a better understanding on the role of diols in this malignancy. The on-going studies in our laboratories indicate that diols bind with low affinity to the human androgen receptor (hAR) and induce very limited hAR-mediated transactivation, particularly the 3α,5α-diol (A E Lemus, P Damian-Matsumura, R Garcia-Becerra, L Gonzalez, D Orolaz, F Larrea & G Perez, Unpublished observations). The finasteride-induced inhibition of DHTand diols formation in MCF-7 cells, as demonstrated in this study, may have additional interest, since various locally formed A-ring-reduced metabolites of progesterone (Wiebe et al. 2000, Wiebe & Muzia 2001, Wiebe & Lewis 2003) are capable of inducing cell proliferation in human breast cancer, through a novel, non-genomic mechanism (Weiler & Wiebe 2000). The overall results demonstrated that finasteride inhibits the formation of oestrogenic steroids (diols) generated downstream of DHT, as suggested recently by Ishikawa et al.(2006). In all, this study discloses a distinctive metabolic pathway of androgens in MCF-7 cells leading to a large formation of diols with oestrogen-agonistic activities, providing an insight into the controversial role of testosterone in human breast cancer. The data also demonstrated that pharmacological inhibition of 5α-steroid reductases precludes the bioconversion of androgens to non-phenolic metabolites with oestrogen-like effects, opening a new avenue of approach in breast cancer research and treatment.

Table 1

Representative radiochemical purity of isolated metabolites after in vitro incubations of human breast and uterine cervical cancer with [14C]-labelled testosterone (T) and androstenedione (Δ4A)

Successive crystallizations specific activity ([14C] dpm/mg)Isolated metabolites from [14C]-Δ4 A incubationsSuccessive crystallizations specific activity ([14C] dpm/mg)
aCrystals.
bMother liquors.
Isolated metabolites from [14C]-T incubations
3α, 5α-AndrostanediolC1a7975α-AndrostanedioneC1527
C2658C2518
C3597C3509
ML3b504ML3562
3β, 5α-AndrostanediolC1385TestosteroneC11285
C2291C21133
C3214C3987
ML3224ML3915
5α-DihydrotestosteroneC1741
C2660
C3697
ML3515
AndrostenedioneC1981
C2763
C3525
ML3493
Table 2

Human oestrogen receptors (hER)-mediated gene transactivation induced by androstanediols in a co-transfected cell expression system

EC50
hERα (mol/l)hERβ (mol/l)
Oestradiol served as control. Results are presented as the effective concentration values (EC50). For details see text.
Steroids
Oestradiol6.74 × 10−113.37 × 10−12
3β,5α-Androstanediol1.61 × 10−91.41 × 10−8
3α,5α-Androstanediol9.10 × 10−83.05 × 10−6
Figure 1
Figure 1

Representative chromatographic profiles of the methanolic extracts of MCF-7, MDA-MB 231 and HeLa cells incubated with 2 μM [14C]-labelled androgens. Extract aliquots were chromatographed on thin-layer plates. The radioactive zones detected are numbered according to their chromatographic mobility. The major metabolic conversion products of [14C] testosterone (T) in MCF-7 cells (A) were 3α,5α- and 3β,5α-androstanediols (diols), while in MDA-MB 231 cells was 5α-dihydrotestosterone (DHT) (B) and in HeLa cells (C) was androstenedione (Δ4A). [14C]-Δ4A incubated with MCF-7 cells (D), was extensively bioconverted to testosterone and diols and to a lesser extent to DHT, whereas [14C]-Δ4A incubated with MDA-MB 231 cells (E) was extensively bioconverted to 5α-A and DHT. The major metabolic conversion products of [14C]-Δ4A in HeLa cells (F) were 5α-A, testosterone and DHT. Only unchanged [14C]-labelled substrates were detected in the extracts from yeast cells, cell-free and boiled inactivated cells, used as negative controls. For details see text.

Citation: Journal of Endocrinology 190, 3; 10.1677/joe.1.06407

Figure 2
Figure 2

Bioconversion of [14C] testosterone to non-phenolic metabolites in MCF-7, MDA-MB 231 and HeLa cells, as a function of substrate concentration. Incubations were carried out for 2 h at 37 °C, using increasing substrate concentrations, at two different pH levels. The 3α,5α- and 3β,5α-androstanediols (diols) were identified as the major metabolic conversion products in MCF-7 cells, even at the lowest substrate concentration. Diol formation was higher in incubations at pH 7.4 (A), as compared with those at pH 5.2 (B). Androstenedione (Δ4A) and 5α-dihydrotestosterone (DHT), in a smaller proportion, were also identified as testosterone metabolites at both pH levels (A) and (B). On the contrary, very little formation of metabolites occurred in incubations of [14C]-testosterone with MDA-MB 231 cells (C) and (D), whereas a large bioconversion of [14C]-testosterone to Δ4A was observed in HeLa cells incubations, at both pH levels (E) and (F). Each point represents the mean ± s.e.m. of five experiments in triplicate.

Citation: Journal of Endocrinology 190, 3; 10.1677/joe.1.06407

Figure 3
Figure 3

Bioconversion of [14C]-labelled androstenedione (Δ4A) to non-phenolic metabolites in MCF-7, MDA-MB 231 and HeLa cells, as a function of substrate concentration. Incubations were carried out for 2 h at 37 °C, using increasing substrate concentrations, at two different pH levels. Testosterone (T) and 3α,5α- and 3β,5α-androstanediols (diols) were identified as the major metabolic conversion products in MCF-7 cells (A) and (B). A larger formation of Tand 5α-reduced Δ4A metabolites occurred at pH 7.4 (A), as compared with incubations at pH 5.2 (B). The major metabolic product of [14C]-Δ4A in MDA-MB 231 and HeLa cells (C–F) was 5α- dihydroandrostanedione (5α-A) with very little formation of T and DHT. Each point represents the mean ± s.e.m. of five experiments in triplicate.

Citation: Journal of Endocrinology 190, 3; 10.1677/joe.1.06407

Figure 4
Figure 4

Formation of 5α-reduced testosterone metabolites in MCF-7, MDA-MB 231 and HeLa cells, as a function of time. Incubations were carried out using 2 μM [14C] testosterone, at 37 °C, pH 7.4, for different time periods. An early (30 min) bioconversion of testosterone to 5α-dihydrotestosterone (DHT) and a subsequent large formation of 3α,5α- and 3β,5α-androstanediols (diols) were observed in MCF-7 cells (A). After 48 h incubation, 48.3% of the radiolabelled substrate was bioconverted to diols. A limited formation of diols was observed in MDA-MB 231 cells incubations (B), while a delayed formation of DHT without further conversion to diols occurred in HeLa cells incubations (C). Each point represents the mean ± s.e.m. in five experiments in triplicate.

Citation: Journal of Endocrinology 190, 3; 10.1677/joe.1.06407

Figure 5
Figure 5

Effects of finasteride (F), a 5α-steroid reductases inhibitor, on androgen metabolism in MCF-7 cells. Incubations were carried out with 2 μM [14C] testosterone ([14C]-T) or 2 μM [14C] androstenedione ([14C]-Δ4 A), at 37 °C, pH 7.4, for 48 h, in the presence or absence of 1 mM finasteride. Addition of the enzyme inhibitor diminished the formation of 5α-dihydrotestosterone (DHT) or 5α-androstanedione (5α-A) and precluded the formation of androstanediols (diols). The data represent the mean ± s.e.m. of five experiments in triplicate. Location of radiolabelled steroids in chromatographic plates is shown in the inserts.

Citation: Journal of Endocrinology 190, 3; 10.1677/joe.1.06407

Figure 6
Figure 6

5α-Steroid reductases type-1 (SRD5A1) and type-2 (SRD5A2), 3β-hydroxysteroid dehydrogenase (AKR1C1) and 3α-hydroxysteroid dehydrogenase (AKR1C2) mRNA expression levels in MCF-7 and MDA-MB 231 cells. The expression of SRD5A1-mRNA is significantly higher in MCF-7 cells (1.45-fold) as compared with those of MDA-MB 231. No differences were observed in the SRD5A2 expression levels in both cell lines. Interestingly, the mRNA expression of SRD5A1 in MCF-7 and MDA-MB 231 cells were significantly higher than that of SRD5A2 expression (4.4- and 3.4-fold respectively). The AKR1C1 expression levels in MCF-7 and MDA-MB 231 cells did not exhibit significant differences, while the mRNA expression of AKR1C2 was higher in MCF-7 as compared with MDA-MB 231 cells. The expression of AKR1C1 in MCF-7 and MDA-MB 231 cells was significantly higher than that of AKR1C2 (2.4- and 3.6-fold respectively). Values are given as relative density ratios. The data represent the mean ± s.d. of four experiments performed in duplicate. *P < 0.05, P < 0.01, P < 0.001.

Citation: Journal of Endocrinology 190, 3; 10.1677/joe.1.06407

Figure 7
Figure 7

Binding affinities of 3α,5α- and 3β,5α- androstanediols (diols) to human oestrogen receptors (hER). Cytosol aliquots of HeLa cells transfected with either hERα or hERβ gene expression vectors were incubated with 1 nM [3H] oestradiol at 4 °C, for 48 h, in the absence or presence of increasing concentrations of radioinert 3α,5α-diol, 3β,5α-diol and oestradiol (E2). Bound and free steroid fractions were separated by the addition of dextran-coated charcoal. The 3β,5α-diol efficiently bound to both subtypes of hER, though with higher affinity for hERα. The 3α,5α-diol also bound to hERα and hERβ, but only at the highest concentration used. E2, used as the control, was the most potent competitor for α and β subtypes of hER. Results represent the mean ± s.d. of five experiments in triplicate.

Citation: Journal of Endocrinology 190, 3; 10.1677/joe.1.06407

Figure 8
Figure 8

Oestrogen-like transactivation effects of androstanediols. Increasing concentrations of 3α,5α-androstanediol (3α,5α-diol), 3β,5α-androstanediol (3β,5α-diol) and oestradiol (E2) were incubated with HeLa cells transiently co-transfected with expression vectors for hERα or hERβ and an ERE-E1b-CAT reporter gene, for 24 h, at 37 °C. Results are expressed as percentage of CAT activity. Concentrations of 1 × 10−8 M onwards of 3β,5α-Diol efficiently induced hERα- and hERβ-mediated transactivation, in a similar manner to that of E2 (A) and (C). 3α,5α-diol also induced hERα-and hERβ-mediated transactivation, yet with lower potency (B) and (D). Values are the mean ± s.d. of five experiments performed in triplicate. For details see text.

Citation: Journal of Endocrinology 190, 3; 10.1677/joe.1.06407

Figure 9
Figure 9

Effect of the antioestrogen ICI-182 780 on hER-mediated transactivation induced by androstanediols. HeLa cells transiently co-transfected with expression vectors for hERα or hERβ and an ERE-E1b-CAT reporter gene were incubated with 1 × 10−7 M 3β,5α-androstanediol (3β,5α-diol), 3α,5α-androstanediol (3 ,5α-diol) and 1 × 10−8 M oestradiol (E2), in the presence or absence of 1 × 10−7 M ICI-182 780 (ICI). Incubations with ICI alone and with steroid vehicle (DMSO) served as controls. Results are expressed as percentage of CAT activity. Addition of the antioestrogen significantly inhibited (P < 0.001) the transactivation induced by androstanediols and E2. Values are the mean ± s.d. of five experiments performed in triplicate. *P < 0.001 vs DMSO. For details see text.

Citation: Journal of Endocrinology 190, 3; 10.1677/joe.1.06407

Supported partially by Research Macroproject Programme, School of Medicine and PAPIIT (Grant IN202102-3), DGAPA, UNAM; Special Programme of Research, Development and Research Training in Human Reproduction, World Health Organization (Geneva) and the Division of C B S, UAM-I. The expert assistance of Dr Armando Tovar is greatly appreciated. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.

References

  • Adams JB 1998 Adrenal androgens and human breast cancer: a new appraisal. Breast Cancer Research and Treatment 51 183–188.

  • Ariga N, Moriya T, Suzuki T, Kimura M, Ohuchi N, Satomi S & Sasano H 2000 17β-Hydroxysteroid dehydrogenase type 1 and type 2 in ductal carcinoma in situ and intraductal proliferative lesions of the human breast. Anticancer Research 20 1101–1108.

    • Search Google Scholar
    • Export Citation
  • Aspinall SR, Stamp S, Davison A, Shenton BK & Lennard TWJ 2004 The proliferative effects of 5-androstene-3β, 17β-diol and 5α-dihydrotestos-terone on cell cycle analysis and cell proliferation in MCF7, T47D and MDAMB231 breast cancer cell lines. Journal of Steroid Biochemistry and Molecular Biology 88 37–51.

    • Search Google Scholar
    • Export Citation
  • Bonney RC, Reed MJ, Davidson K, Beranek PA & James VH 1983 The relationship between 17 beta-hydroxysteroid dehydrogenase activity and oestrogen concentrations in human breast tumours and in normal breast tissue. Clinical Endocrinology 19 727–739.

    • Search Google Scholar
    • Export Citation
  • Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72 248–254.

    • Search Google Scholar
    • Export Citation
  • Brodie AM & Longcope C 1980 Inhibition of peripheral aromatization by aromatase inhibitors, 4-hydroxy- and 4-acetoxy-androstene-3,17-dione. Endocrinology 106 19–21.

    • Search Google Scholar
    • Export Citation
  • Brodie AM, Schwarzel WC, Shaikh AA & Brodie HJ 1977 The effect of an aromatase inhibitor, 4-hydroxy-4-androstene-3,17-dione, on estrogen-dependent processes in reproduction and breast cancer. Endocrinology 100 1684–1695.

    • Search Google Scholar
    • Export Citation
  • Brueggemeier RW, Hackett JC & Diaz-Cruz ES 2005 Aromatase inhibitors in the treatment of breast cancer. Endocrine Reviews 26 331–345.

  • Buzdar AU 2002 New generation aromatase inhibitors – from the advanced to the adjuvant setting. Breast Cancer Research and Treatment 75 S13–S17.

    • Search Google Scholar
    • Export Citation
  • Catherino WH, Jeng MH & Jordan VC 1993 Norgestrel and gestodene stimulate breast cancer cell growth through an oestrogen receptor mediated mechanism. British Journal of Cancer 67 945–952.

    • Search Google Scholar
    • Export Citation
  • Cheng YC & Prusoff WH 1973 Relationship between the inhibition constant (K i) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochemical Pharmacology 22 3099–3108.

    • Search Google Scholar
    • Export Citation
  • Coombes RC, Goss P, Dowsett M, Gazet JC & Brodie A 1984 4-Hydroxy androstenedione in treatment of postmenopausal patients with advanced breast cancer. Lancet 2 1237–1239.

    • Search Google Scholar
    • Export Citation
  • Coombes RC, Goss PE, Dowsett M, Hutchinson G, Cunningham D, Jarman M & Brodie AMH 1987 4-Hydroxyandrostenedione treatment for postmenopausal patients with advanced breast cancer. Steroids 50 245–252.

    • Search Google Scholar
    • Export Citation
  • Costlow ME, Buschow RA & McGuire WL 1976 Prolactin receptors and androgen-induced regression of 7,12-dimethylbenz(a)anthracene induced mammary carcinoma. Cancer Research 36 3324–3329.

    • Search Google Scholar
    • Export Citation
  • Demers LM 1994 Effects of fadrozole (CGS 16949A) and letrozole (CGS20267) on the inhibition of aromatase activity in breast cancer patients. Breast Cancer Research and Treatment 30 95–102.

    • Search Google Scholar
    • Export Citation
  • García-Becerra R, Borja-Cacho E, Cooney AJ, Jackson KJ, Lemus AE, Pérez-Palacios G & Larrea F 2002 The intrinsic transcriptional estrogenic activity of a non-phenolic derivative of levonorgestrel is mediated via the estrogen receptor-α. Journal of Steroid Biochemistry and Molecular Biology 82 333–341.

    • Search Google Scholar
    • Export Citation
  • Gingras S, Moriggl R, Groner B & Simard J 1999 Induction of 3β-hydroxysteroid dehydrogenase/Δ54 isomerase type 1 gene transcription in human breast cancer cell lines and in normal mammary epithelial cells by interleukin-4 and interleukin-13. Molecular Endocrinology 13 66–81.

    • Search Google Scholar
    • Export Citation
  • Girdler F & Brotherick I 2000 The oestrogen receptors (ERα and ERβ) and their role in breast cancer: a review. Breast 9 194–200.

  • Goss PE 1999 Risks versus benefits in the clinical application of aromatase inhibitors. Endocrine-Related Cancer 6 325–332.

  • Greeve MA, Allan RK, Harvey JM & Bentel JM 2004 Inhibition of MCF-7 breast cancer cell proliferation by 5alpha-dihydrotestosterone; a role for p21 (Cip1/Waf1). Journal of Molecular Endocrinology 32 793–810.

    • Search Google Scholar
    • Export Citation
  • Hackenberg R, Turgetto I, Filmer A & Schulz KD 1993 Estrogen and androgen receptor mediated stimulation and inhibition of proliferation by androst-5-ene-3β,17β-diol in human mammary cancer cells. Journal of Steroid Biochemistry and Molecular Biology 46 597–603.

    • Search Google Scholar
    • Export Citation
  • Ishikawa T, Glidewell-Kenney C & Jameson JL 2006 Aromatase-independent testosterone conversion into estrogenic steroids is inhibited by a 5α-reductase inhibitor. Journal of Steroid Biochemistry and Molecular Biology 98 133–138.

    • Search Google Scholar
    • Export Citation
  • Jørgensen L, Brünner N, Spang-Thomsen M, James MR, Clarke R, Dombernowsky P & Svenstrup B 1997 Steroid metabolism in the hormone dependent MCF-7 human breast carcinoma cell line and its two hormone resistant subpopulations MCF-7/LCC1 and MCF-7/LCC2. Journal of Steroid Biochemistry and Molecular Biology 63 275–281.

    • Search Google Scholar
    • Export Citation
  • Kirschner MA 1979 The role of hormones in the development of human breast cancer. In Breast Cancer 3: Advances in Research and Treatment, Current Topics., New York: Plenum Press. pp 199–229.

  • Kubli-Garfias C, Vázquez R & Mendieta J 1998 Austin model 1 study of the effect of carbonyl and hydroxyl functional groups on the electronic structure of androstane. Journal of Molecular Structure (Theochem) 428 189–194.

    • Search Google Scholar
    • Export Citation
  • Kubli-Garfias C, Vázquez R, Cooney AJ & Larrea F 2002 Ab initio electronic structure of the progestogen norethisterone and its 5α-derivatives. Journal of Steroid Biochemistry and Molecular Biology 82 385–391.

    • Search Google Scholar
    • Export Citation
  • Labrie F, Simard J, de Launoit Y, Poulin R, Theriault C, Dumont M, Dauvois S, Martel C & Li S-M 1992 Androgens and breast cancer. Cancer Detection and Prevention 16 31–38.

    • Search Google Scholar
    • Export Citation
  • Labrie F, Luu-The V, Lin S-X, Labrie C, Simard J, Breton R & Bélanger A 1997 The key role of 17β-hydroxysteroid dehydrogenases in sex steroid biology. Steroids 62 148–158.

    • Search Google Scholar
    • Export Citation
  • Labrie F, Bélanger A, Luu-The V, Labrie C, Simard J, Cusan L, Gomez J-L & Candas B 1998 DHEA and the intracrine formation of androgens and estrogens in peripheral target tissues: its role during aging. Steroids 63 322–328.

    • Search Google Scholar
    • Export Citation
  • Labrie F, Luu-The V, Lin SX, Simard J, Labrie C, El-Alfy M, Pelletier G & Bélanger A 2000 Intracrinology: role of the family of 17β-hydroxysteroid dehydrogenases in human physiology and disease. Journal of Molecular Endocrinology 25 1–16.

    • Search Google Scholar
    • Export Citation
  • Labrie F, Luu-The V, Labrie C, Bélanger A, Simard J, Lin S-X & Pelletier G 2003 Endocrine and intracrine sources of androgens in women: inhibition of breast cancer and other roles of androgens and their precursor dehydroepiandrosterone. Endocrine Reviews 24 152–182.

    • Search Google Scholar
    • Export Citation
  • Larrea F, García-Becerra R, Lemus AE, García GA, Pérez-Palacios G, Jackson KJ, Coleman KM, Dace R, Smith CL & Cooney AJ 2001 A-ring reduced metabolites of 19-nor synthetic progestins as subtype selective agonists for ERα. Endocrinology 142 3791–3799.

    • Search Google Scholar
    • Export Citation
  • Lemus AE, Zaga V, Santillán R, García GA, Grillasca I, Damián-Matsumura P, Jackson KJ, Cooney AJ, Larrea F & Pérez-Palacios G 2000 The oestrogenic effects of gestodene, a potent contraceptive progestin, are mediated by its A-ring reduced metabolites. Journal of Endocrinology 165 693–702.

    • Search Google Scholar
    • Export Citation
  • Lemus AE, Santillán R, Damián-Matsumura P, García GA, Grillasca I & Pérez-Palacios G 2001 In vitro metabolism of gestodene in target organs: formation of A-ring reduced derivatives with oestrogenic activity. European Journal of Pharmacology 417 249–256.

    • Search Google Scholar
    • Export Citation
  • Liao DJ & Dickson RB 2002 Roles of androgens in the development, growth, and carcinogenesis of the mammary gland. Journal of Steroid Biochemistry and Molecular Biology 80 175–189.

    • Search Google Scholar
    • Export Citation
  • Liao D-ZJ, Cooley GP, Pantazis CG, Hou X & Li SA 1998 Promotion of estrogen-induced mammary gland carcinogenesis by androgen in the male Noble rat: probable mediation by steroid receptors. Carcinogenesis 19 2173–2180.

    • Search Google Scholar
    • Export Citation
  • Lippman M 1998 Endocrine-responsive cancer. In Williams Textbook of Endocrinology, pp 1675–1692. Eds JD Wilson, DW Foster, HM Kronenberg & PR Larsen. Philadelphia, PA: W.B. Saunders Company.

  • Lippman M, Bolan G & Huff K 1976 The effects of androgens and antiandrogens on hormone responsive human breast cancer in long-term tissue culture. Cancer Research 36 4610–4618.

    • Search Google Scholar
    • Export Citation
  • Lønning PE 2004 Aromatase inhibitors in breast cancer. Endocrine-Related Cancer 11 179–189.

  • Lopez-Diazguerrero NE, Lopez-Araiza H, Conde-Perezprina JC, Bucio L, Cardenas-Aguayo MC, Ventura JL, Covarrubias L, Gutierrez-Ruiz MC, Zentella A & Konigsberg M 2006 Bcl-2 protects against oxidative stress while inducing premature senescence. Free Radical Biology and Medicine 40 1161–1169.

    • Search Google Scholar
    • Export Citation
  • Maggiolini M, Donzé O, Jeannin E, Andò S & Picard D 1999 Adrenal androgens stimulate the proliferation of breast cancer cells as direct activators of estrogen receptor α. Cancer Research 59 4864–4869.

    • Search Google Scholar
    • Export Citation
  • Musgrove EA & Sutherland RL 1994 Cell cycle control by steroid hormones. Seminars in Cancer Biology 5 381–389.

  • Nicholson RI, Gotting KE, Gee J & Walker KJ 1988 Actions of oestrogens and antioestrogens on rat mammary gland development: relevance to breast cancer prevention. Journal of Steroid Biochemistry 30 95–103.

    • Search Google Scholar
    • Export Citation
  • Pasqualini JR & Chetrite G 1996 Activity, regulation and expression of sulfatase, sulfotransferase, and 17β-hydroxysteroid dehydrogenase in breast cancer. In Hormone-Dependent Cancer, pp 25–80. Eds JR Pasqualini & BS Katzenellenbogen. New York, NY, USA: Marcel Dekker, Inc.

  • Pike MC & Spicer DV 1991 Endogenous estrogen and progesterone as the major determinants of breast cancer risk: prospects for control by “natural” and “technological” means. In Hormonal Carcinogenesis, pp 209–216. Eds JJ Li, S Nandi & SA Li. New York, NY, USA: Springer-Verlag.

  • Pike MC, Spicer DV, Dahmoush L & Press MF 1993 Estrogens, progestogens, normal breast cell proliferation, and breast cancer risk. Epidemiologic Reviews 15 17–35.

    • Search Google Scholar
    • Export Citation
  • Poulin R, Baker D & Labrie F 1988 Androgens inhibit basal and estrogen-induced cell proliferation in the ZR-75-1 human breast cancer cell line. Breast Cancer Research and Treatment 12 213–225.

    • Search Google Scholar
    • Export Citation
  • Ragaz J 1999 Status of aromatase inhibitors in relation to other breast cancer treatment modalities. Endocrine-Related Cancer 6 277–291.

  • Reel JR, Humphrey RR, Shih Y-H, Windsor BL, Sakowski R, Creger PL & Edgren RA 1979 Competitive progesterone antagonists: receptor binding and biological activity of testosterone and 19-nortestosterone derivatives. Fertility and Sterility 31 552–561.

    • Search Google Scholar
    • Export Citation
  • Roy R, Dauvois S, Labrie F & Bélanger A 1992 Estrogen-stimulated glucuronidation of dihydrotestosterone in MCF-7 human breast cancer cells. Journal of Steroid Biochemistry and Molecular Biology 41 579–582.

    • Search Google Scholar
    • Export Citation
  • Russell DW & Wilson JD 1994 Steroid 5α-reductase: two genes/two enzymes. Annual Review of Biochemistry 63 25–61.

  • Santen RJ, Manni A, Harvey H & Redmond C 1990 Endocrine treatment of breast cancer in women. Endocrine Reviews 11 221–265.

  • Santillán R, Pérez-Palacios G, Reyes M, Damián-Matsumura P, García GA, Grillasca I & Lemus AE 2001 Assessment of the oestrogenic activity of the contraceptive progestin levonorgestrel and its non-phenolic metabolites. European Journal of Pharmacology 427 167–174.

    • Search Google Scholar
    • Export Citation
  • Sasano H, Frost AR, Saitoh R, Harada N, Poutanen M, Vihko R, Bulun SE, Silverberg SG & Nagura H 1996 Aromatase and 17β-hydroxysteroid dehydrogenase type 1 in human breast carcinoma. Journal of Clinical Endocrinology and Metabolism 81 4042–4046.

    • Search Google Scholar
    • Export Citation
  • Sasano H, Sato S, Ito K, Yajima A, Nakamura J, Yoshihama M, Ariga K, Anderson TJ & Miller WR 1999 Effects of aromatase inhibitors on the pathobiology of human breast, endometrial and ovarian carcinoma. Endocrine-Related Cancer 6 197–204.

    • Search Google Scholar
    • Export Citation
  • Schoonen WGEJ, Joosten JWH & Kloosterboer HJ 1995a Effects of two classes of progestagens, pregnane and 19-nortestosterone derivatives, on cell growth of human breast tumor cells: I. MCF-7 cell lines. Journal of Steroid Biochemistry and Molecular Biology 55 423–437.

    • Search Google Scholar
    • Export Citation
  • Schoonen WGEJ, Joosten JWH & Kloosterboer HJ 1995b Effects of two classes of progestagens, pregnane and 19-nortestosterone derivatives, on cell growth of human breast tumor cells: II, T47D cell lines. Journal of Steroid Biochemistry and Molecular Biology 55 439–444.

    • Search Google Scholar
    • Export Citation
  • Smith JA & King RJ 1972 Effects of steroids on growth of an androgen-dependent mouse mammary carcinoma in cell culture. Experimental Cell Research 73 351–359.

    • Search Google Scholar
    • Export Citation
  • Smith CL, Conneely OM & O’Malley BW 1993 Modulation of the ligand-independent activation of the human estrogen receptor by hormone and antihormone. PNAS 90 6120–6124.

    • Search Google Scholar
    • Export Citation
  • Somboonporn W & Davis SR 2004 Testosterone effects on the breast: implications for testosterone therapy for women. Endocrine Reviews 25 374–388.

    • Search Google Scholar
    • Export Citation
  • Sonne-Hansen K & Lykkesfeldt AE 2005 Endogenous aromatization of testosterone results in growth stimulation of the human MCF-7 breast cancer cell line. Journal of Steroid Biochemistry and Molecular Biology 93 25–34.

    • Search Google Scholar
    • Export Citation
  • Steckelbroeck S, Jin Y, Gopishetty S, Oyesanmi B & Penning TM 2004 Human cytosolic 3α-hydroxysteroid dehydrogenases of the aldo–keto reductase superfamily display significant 3β-hydroxysteroid dehydrogenase activity. Journal of Biological Chemistry 279 10784–10795.

    • Search Google Scholar
    • Export Citation
  • Suzuki T, Moriya T, Ariga N, Kaneko C, Kanazawa M & Sasano H 2000 17β-Hydroxysteroid dehydrogenase type 1 and type 2 in human breast carcinoma: a correlation to clinicopathological parameters. British Journal of Cancer 82 518–523.

    • Search Google Scholar
    • Export Citation
  • Suzuki T, Darnel AD, Akahira J-I, Ariga N, Ogawa S, Kaneko C, Takeyama J, Moriya T & Sasano H 2001 5α-Reductases in human breast carcinoma: possible modulator of in situ androgenic actions. Journal of Clinical Endocrinology and Metabolism 86 2250–2257.

    • Search Google Scholar
    • Export Citation
  • Suzuki T, Miki Y, Nakamura Y, Moriya T, Ito K, Ohuchi N & Sasano H 2005 Sex steroid producing enzymes in human breast cancer. Endocrine-Related Cancer 12 701–720.

    • Search Google Scholar
    • Export Citation
  • Szelei J, Jimenez J, Soto AM, Luizzi MF & Sonnenschein C 1997 Androgen-induced inhibition of proliferation in human breast cancer MCF7 cells transfected with androgen receptor. Endocrinology 138 1406–1412.

    • Search Google Scholar
    • Export Citation
  • Weihua Z, Mäkelä S, Andersson LC, Salmi S, Saji S, Webster JI, Jensen EV, Nilsson S, Warner M & Gustafsson J-Å 2001 A role for estrogen receptor β in the regulation of growth of the ventral prostate. PNAS 98 6330–6335.

    • Search Google Scholar
    • Export Citation
  • Weihua Z, Lathe R, Warner M & Gustafsson J-Å 2002 An endocrine pathway in the prostate, ERβ, AR, 5α-androstane-3β,17β-diol, and CYP7B1, regulates prostate growth. PNAS 99 13589–13594.

    • Search Google Scholar
    • Export Citation
  • Weiler PJ & Wiebe JP 2000 Plasma membrane receptors for the cancer-regulating progesterone metabolites, 5α-pregnane-3,20-dione and 3α-hydroxy-4-pregnen-20-one in MCF-7 breast cancer cells. Biochemical and Biophysical Research Communications 272 731–737.

    • Search Google Scholar
    • Export Citation
  • Wiebe JP & Muzia D 2001 The endogenous progesterone metabolite, 5α-pregnane-3,20-dione, decreases cell-substrate attachment, adhesion plaques, vinculin expression, and polymerized F-actin in MCF-7 breast cancer cells. Endocrine 16 7–14.

    • Search Google Scholar
    • Export Citation
  • Wiebe JP & Lewis MJ 2003 Activityand expression of progesterone metabolizing 5α-reductase, 20α-hydroxysteroid oxidoreductase and 3α(β)-hydroxysteroid oxidoreductases in tumorigenic (MCF-7, MDA-MB-231, T-47D) and nontumorigenic (MCF-10A) human breast cancer cells. BMC Cancer 3 1–15.

    • Search Google Scholar
    • Export Citation
  • Wiebe JP, Muzia D, Hu J, Szwajcer D, Hill SA & Seachrist JL 2000 The 4-pregnene and 5α-pregnane progesterone metabolites formed in nontumorous and tumorous breast tissue have opposite effects on breast cell proliferation and adhesion. Cancer Research 60 936–943.

    • Search Google Scholar
    • Export Citation
  • Wing LY, Garrett WM & Brodie AM 1985 Effects of aromatase inhibitors, aminoglutethimide, and 4-hydroxyandrostenedione on cyclic rats and rats with 7,12-dimethylbenz(a)anthraceneinduced mammary tumors. Cancer Research 45 2425–2428.

    • Search Google Scholar
    • Export Citation
  • Xie B, Tsao SW & Wong YC 1999 Sex hormone-induced mammary carcinogenesis in female Noble rats: the role of androgens. Carcinogenesis 20 1597–1606.

    • Search Google Scholar
    • Export Citation
  • Zhou J, Ng S, Adesanya-Famuiya O, Anderson K & Bondy CA 2000 Testosterone inhibits estrogen-induced mammary epithelial proliferation and suppresses estrogen receptor expression. FASEB Journal 14 1725–1730.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 356 45 3
PDF Downloads 137 41 4
  • View in gallery

    Representative chromatographic profiles of the methanolic extracts of MCF-7, MDA-MB 231 and HeLa cells incubated with 2 μM [14C]-labelled androgens. Extract aliquots were chromatographed on thin-layer plates. The radioactive zones detected are numbered according to their chromatographic mobility. The major metabolic conversion products of [14C] testosterone (T) in MCF-7 cells (A) were 3α,5α- and 3β,5α-androstanediols (diols), while in MDA-MB 231 cells was 5α-dihydrotestosterone (DHT) (B) and in HeLa cells (C) was androstenedione (Δ4A). [14C]-Δ4A incubated with MCF-7 cells (D), was extensively bioconverted to testosterone and diols and to a lesser extent to DHT, whereas [14C]-Δ4A incubated with MDA-MB 231 cells (E) was extensively bioconverted to 5α-A and DHT. The major metabolic conversion products of [14C]-Δ4A in HeLa cells (F) were 5α-A, testosterone and DHT. Only unchanged [14C]-labelled substrates were detected in the extracts from yeast cells, cell-free and boiled inactivated cells, used as negative controls. For details see text.

  • View in gallery

    Bioconversion of [14C] testosterone to non-phenolic metabolites in MCF-7, MDA-MB 231 and HeLa cells, as a function of substrate concentration. Incubations were carried out for 2 h at 37 °C, using increasing substrate concentrations, at two different pH levels. The 3α,5α- and 3β,5α-androstanediols (diols) were identified as the major metabolic conversion products in MCF-7 cells, even at the lowest substrate concentration. Diol formation was higher in incubations at pH 7.4 (A), as compared with those at pH 5.2 (B). Androstenedione (Δ4A) and 5α-dihydrotestosterone (DHT), in a smaller proportion, were also identified as testosterone metabolites at both pH levels (A) and (B). On the contrary, very little formation of metabolites occurred in incubations of [14C]-testosterone with MDA-MB 231 cells (C) and (D), whereas a large bioconversion of [14C]-testosterone to Δ4A was observed in HeLa cells incubations, at both pH levels (E) and (F). Each point represents the mean ± s.e.m. of five experiments in triplicate.

  • View in gallery

    Bioconversion of [14C]-labelled androstenedione (Δ4A) to non-phenolic metabolites in MCF-7, MDA-MB 231 and HeLa cells, as a function of substrate concentration. Incubations were carried out for 2 h at 37 °C, using increasing substrate concentrations, at two different pH levels. Testosterone (T) and 3α,5α- and 3β,5α-androstanediols (diols) were identified as the major metabolic conversion products in MCF-7 cells (A) and (B). A larger formation of Tand 5α-reduced Δ4A metabolites occurred at pH 7.4 (A), as compared with incubations at pH 5.2 (B). The major metabolic product of [14C]-Δ4A in MDA-MB 231 and HeLa cells (C–F) was 5α- dihydroandrostanedione (5α-A) with very little formation of T and DHT. Each point represents the mean ± s.e.m. of five experiments in triplicate.

  • View in gallery

    Formation of 5α-reduced testosterone metabolites in MCF-7, MDA-MB 231 and HeLa cells, as a function of time. Incubations were carried out using 2 μM [14C] testosterone, at 37 °C, pH 7.4, for different time periods. An early (30 min) bioconversion of testosterone to 5α-dihydrotestosterone (DHT) and a subsequent large formation of 3α,5α- and 3β,5α-androstanediols (diols) were observed in MCF-7 cells (A). After 48 h incubation, 48.3% of the radiolabelled substrate was bioconverted to diols. A limited formation of diols was observed in MDA-MB 231 cells incubations (B), while a delayed formation of DHT without further conversion to diols occurred in HeLa cells incubations (C). Each point represents the mean ± s.e.m. in five experiments in triplicate.

  • View in gallery

    Effects of finasteride (F), a 5α-steroid reductases inhibitor, on androgen metabolism in MCF-7 cells. Incubations were carried out with 2 μM [14C] testosterone ([14C]-T) or 2 μM [14C] androstenedione ([14C]-Δ4 A), at 37 °C, pH 7.4, for 48 h, in the presence or absence of 1 mM finasteride. Addition of the enzyme inhibitor diminished the formation of 5α-dihydrotestosterone (DHT) or 5α-androstanedione (5α-A) and precluded the formation of androstanediols (diols). The data represent the mean ± s.e.m. of five experiments in triplicate. Location of radiolabelled steroids in chromatographic plates is shown in the inserts.

  • View in gallery

    5α-Steroid reductases type-1 (SRD5A1) and type-2 (SRD5A2), 3β-hydroxysteroid dehydrogenase (AKR1C1) and 3α-hydroxysteroid dehydrogenase (AKR1C2) mRNA expression levels in MCF-7 and MDA-MB 231 cells. The expression of SRD5A1-mRNA is significantly higher in MCF-7 cells (1.45-fold) as compared with those of MDA-MB 231. No differences were observed in the SRD5A2 expression levels in both cell lines. Interestingly, the mRNA expression of SRD5A1 in MCF-7 and MDA-MB 231 cells were significantly higher than that of SRD5A2 expression (4.4- and 3.4-fold respectively). The AKR1C1 expression levels in MCF-7 and MDA-MB 231 cells did not exhibit significant differences, while the mRNA expression of AKR1C2 was higher in MCF-7 as compared with MDA-MB 231 cells. The expression of AKR1C1 in MCF-7 and MDA-MB 231 cells was significantly higher than that of AKR1C2 (2.4- and 3.6-fold respectively). Values are given as relative density ratios. The data represent the mean ± s.d. of four experiments performed in duplicate. *P < 0.05, P < 0.01, P < 0.001.

  • View in gallery

    Binding affinities of 3α,5α- and 3β,5α- androstanediols (diols) to human oestrogen receptors (hER). Cytosol aliquots of HeLa cells transfected with either hERα or hERβ gene expression vectors were incubated with 1 nM [3H] oestradiol at 4 °C, for 48 h, in the absence or presence of increasing concentrations of radioinert 3α,5α-diol, 3β,5α-diol and oestradiol (E2). Bound and free steroid fractions were separated by the addition of dextran-coated charcoal. The 3β,5α-diol efficiently bound to both subtypes of hER, though with higher affinity for hERα. The 3α,5α-diol also bound to hERα and hERβ, but only at the highest concentration used. E2, used as the control, was the most potent competitor for α and β subtypes of hER. Results represent the mean ± s.d. of five experiments in triplicate.

  • View in gallery

    Oestrogen-like transactivation effects of androstanediols. Increasing concentrations of 3α,5α-androstanediol (3α,5α-diol), 3β,5α-androstanediol (3β,5α-diol) and oestradiol (E2) were incubated with HeLa cells transiently co-transfected with expression vectors for hERα or hERβ and an ERE-E1b-CAT reporter gene, for 24 h, at 37 °C. Results are expressed as percentage of CAT activity. Concentrations of 1 × 10−8 M onwards of 3β,5α-Diol efficiently induced hERα- and hERβ-mediated transactivation, in a similar manner to that of E2 (A) and (C). 3α,5α-diol also induced hERα-and hERβ-mediated transactivation, yet with lower potency (B) and (D). Values are the mean ± s.d. of five experiments performed in triplicate. For details see text.

  • View in gallery

    Effect of the antioestrogen ICI-182 780 on hER-mediated transactivation induced by androstanediols. HeLa cells transiently co-transfected with expression vectors for hERα or hERβ and an ERE-E1b-CAT reporter gene were incubated with 1 × 10−7 M 3β,5α-androstanediol (3β,5α-diol), 3α,5α-androstanediol (3 ,5α-diol) and 1 × 10−8 M oestradiol (E2), in the presence or absence of 1 × 10−7 M ICI-182 780 (ICI). Incubations with ICI alone and with steroid vehicle (DMSO) served as controls. Results are expressed as percentage of CAT activity. Addition of the antioestrogen significantly inhibited (P < 0.001) the transactivation induced by androstanediols and E2. Values are the mean ± s.d. of five experiments performed in triplicate. *P < 0.001 vs DMSO. For details see text.

  • Adams JB 1998 Adrenal androgens and human breast cancer: a new appraisal. Breast Cancer Research and Treatment 51 183–188.

  • Ariga N, Moriya T, Suzuki T, Kimura M, Ohuchi N, Satomi S & Sasano H 2000 17β-Hydroxysteroid dehydrogenase type 1 and type 2 in ductal carcinoma in situ and intraductal proliferative lesions of the human breast. Anticancer Research 20 1101–1108.

    • Search Google Scholar
    • Export Citation
  • Aspinall SR, Stamp S, Davison A, Shenton BK & Lennard TWJ 2004 The proliferative effects of 5-androstene-3β, 17β-diol and 5α-dihydrotestos-terone on cell cycle analysis and cell proliferation in MCF7, T47D and MDAMB231 breast cancer cell lines. Journal of Steroid Biochemistry and Molecular Biology 88 37–51.

    • Search Google Scholar
    • Export Citation
  • Bonney RC, Reed MJ, Davidson K, Beranek PA & James VH 1983 The relationship between 17 beta-hydroxysteroid dehydrogenase activity and oestrogen concentrations in human breast tumours and in normal breast tissue. Clinical Endocrinology 19 727–739.

    • Search Google Scholar
    • Export Citation
  • Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72 248–254.

    • Search Google Scholar
    • Export Citation
  • Brodie AM & Longcope C 1980 Inhibition of peripheral aromatization by aromatase inhibitors, 4-hydroxy- and 4-acetoxy-androstene-3,17-dione. Endocrinology 106 19–21.

    • Search Google Scholar
    • Export Citation
  • Brodie AM, Schwarzel WC, Shaikh AA & Brodie HJ 1977 The effect of an aromatase inhibitor, 4-hydroxy-4-androstene-3,17-dione, on estrogen-dependent processes in reproduction and breast cancer. Endocrinology 100 1684–1695.

    • Search Google Scholar
    • Export Citation
  • Brueggemeier RW, Hackett JC & Diaz-Cruz ES 2005 Aromatase inhibitors in the treatment of breast cancer. Endocrine Reviews 26 331–345.

  • Buzdar AU 2002 New generation aromatase inhibitors – from the advanced to the adjuvant setting. Breast Cancer Research and Treatment 75 S13–S17.

    • Search Google Scholar
    • Export Citation
  • Catherino WH, Jeng MH & Jordan VC 1993 Norgestrel and gestodene stimulate breast cancer cell growth through an oestrogen receptor mediated mechanism. British Journal of Cancer 67 945–952.

    • Search Google Scholar
    • Export Citation
  • Cheng YC & Prusoff WH 1973 Relationship between the inhibition constant (K i) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochemical Pharmacology 22 3099–3108.

    • Search Google Scholar
    • Export Citation
  • Coombes RC, Goss P, Dowsett M, Gazet JC & Brodie A 1984 4-Hydroxy androstenedione in treatment of postmenopausal patients with advanced breast cancer. Lancet 2 1237–1239.

    • Search Google Scholar
    • Export Citation
  • Coombes RC, Goss PE, Dowsett M, Hutchinson G, Cunningham D, Jarman M & Brodie AMH 1987 4-Hydroxyandrostenedione treatment for postmenopausal patients with advanced breast cancer. Steroids 50 245–252.

    • Search Google Scholar
    • Export Citation
  • Costlow ME, Buschow RA & McGuire WL 1976 Prolactin receptors and androgen-induced regression of 7,12-dimethylbenz(a)anthracene induced mammary carcinoma. Cancer Research 36 3324–3329.

    • Search Google Scholar
    • Export Citation
  • Demers LM 1994 Effects of fadrozole (CGS 16949A) and letrozole (CGS20267) on the inhibition of aromatase activity in breast cancer patients. Breast Cancer Research and Treatment 30 95–102.

    • Search Google Scholar
    • Export Citation
  • García-Becerra R, Borja-Cacho E, Cooney AJ, Jackson KJ, Lemus AE, Pérez-Palacios G & Larrea F 2002 The intrinsic transcriptional estrogenic activity of a non-phenolic derivative of levonorgestrel is mediated via the estrogen receptor-α. Journal of Steroid Biochemistry and Molecular Biology 82 333–341.

    • Search Google Scholar
    • Export Citation
  • Gingras S, Moriggl R, Groner B & Simard J 1999 Induction of 3β-hydroxysteroid dehydrogenase/Δ54 isomerase type 1 gene transcription in human breast cancer cell lines and in normal mammary epithelial cells by interleukin-4 and interleukin-13. Molecular Endocrinology 13 66–81.

    • Search Google Scholar
    • Export Citation
  • Girdler F & Brotherick I 2000 The oestrogen receptors (ERα and ERβ) and their role in breast cancer: a review. Breast 9 194–200.

  • Goss PE 1999 Risks versus benefits in the clinical application of aromatase inhibitors. Endocrine-Related Cancer 6 325–332.

  • Greeve MA, Allan RK, Harvey JM & Bentel JM 2004 Inhibition of MCF-7 breast cancer cell proliferation by 5alpha-dihydrotestosterone; a role for p21 (Cip1/Waf1). Journal of Molecular Endocrinology 32 793–810.

    • Search Google Scholar
    • Export Citation
  • Hackenberg R, Turgetto I, Filmer A & Schulz KD 1993 Estrogen and androgen receptor mediated stimulation and inhibition of proliferation by androst-5-ene-3β,17β-diol in human mammary cancer cells. Journal of Steroid Biochemistry and Molecular Biology 46 597–603.

    • Search Google Scholar
    • Export Citation
  • Ishikawa T, Glidewell-Kenney C & Jameson JL 2006 Aromatase-independent testosterone conversion into estrogenic steroids is inhibited by a 5α-reductase inhibitor. Journal of Steroid Biochemistry and Molecular Biology 98 133–138.

    • Search Google Scholar
    • Export Citation
  • Jørgensen L, Brünner N, Spang-Thomsen M, James MR, Clarke R, Dombernowsky P & Svenstrup B 1997 Steroid metabolism in the hormone dependent MCF-7 human breast carcinoma cell line and its two hormone resistant subpopulations MCF-7/LCC1 and MCF-7/LCC2. Journal of Steroid Biochemistry and Molecular Biology 63 275–281.

    • Search Google Scholar
    • Export Citation
  • Kirschner MA 1979 The role of hormones in the development of human breast cancer. In Breast Cancer 3: Advances in Research and Treatment, Current Topics., New York: Plenum Press. pp 199–229.

  • Kubli-Garfias C, Vázquez R & Mendieta J 1998 Austin model 1 study of the effect of carbonyl and hydroxyl functional groups on the electronic structure of androstane. Journal of Molecular Structure (Theochem) 428 189–194.

    • Search Google Scholar
    • Export Citation
  • Kubli-Garfias C, Vázquez R, Cooney AJ & Larrea F 2002 Ab initio electronic structure of the progestogen norethisterone and its 5α-derivatives. Journal of Steroid Biochemistry and Molecular Biology 82 385–391.

    • Search Google Scholar
    • Export Citation
  • Labrie F, Simard J, de Launoit Y, Poulin R, Theriault C, Dumont M, Dauvois S, Martel C & Li S-M 1992 Androgens and breast cancer. Cancer Detection and Prevention 16 31–38.

    • Search Google Scholar
    • Export Citation
  • Labrie F, Luu-The V, Lin S-X, Labrie C, Simard J, Breton R & Bélanger A 1997 The key role of 17β-hydroxysteroid dehydrogenases in sex steroid biology. Steroids 62 148–158.

    • Search Google Scholar
    • Export Citation
  • Labrie F, Bélanger A, Luu-The V, Labrie C, Simard J, Cusan L, Gomez J-L & Candas B 1998 DHEA and the intracrine formation of androgens and estrogens in peripheral target tissues: its role during aging. Steroids 63 322–328.

    • Search Google Scholar
    • Export Citation
  • Labrie F, Luu-The V, Lin SX, Simard J, Labrie C, El-Alfy M, Pelletier G & Bélanger A 2000 Intracrinology: role of the family of 17β-hydroxysteroid dehydrogenases in human physiology and disease. Journal of Molecular Endocrinology 25 1–16.

    • Search Google Scholar
    • Export Citation
  • Labrie F, Luu-The V, Labrie C, Bélanger A, Simard J, Lin S-X & Pelletier G 2003 Endocrine and intracrine sources of androgens in women: inhibition of breast cancer and other roles of androgens and their precursor dehydroepiandrosterone. Endocrine Reviews 24 152–182.

    • Search Google Scholar
    • Export Citation
  • Larrea F, García-Becerra R, Lemus AE, García GA, Pérez-Palacios G, Jackson KJ, Coleman KM, Dace R, Smith CL & Cooney AJ 2001 A-ring reduced metabolites of 19-nor synthetic progestins as subtype selective agonists for ERα. Endocrinology 142 3791–3799.

    • Search Google Scholar
    • Export Citation
  • Lemus AE, Zaga V, Santillán R, García GA, Grillasca I, Damián-Matsumura P, Jackson KJ, Cooney AJ, Larrea F & Pérez-Palacios G 2000 The oestrogenic effects of gestodene, a potent contraceptive progestin, are mediated by its A-ring reduced metabolites. Journal of Endocrinology 165 693–702.

    • Search Google Scholar
    • Export Citation
  • Lemus AE, Santillán R, Damián-Matsumura P, García GA, Grillasca I & Pérez-Palacios G 2001 In vitro metabolism of gestodene in target organs: formation of A-ring reduced derivatives with oestrogenic activity. European Journal of Pharmacology 417 249–256.

    • Search Google Scholar
    • Export Citation
  • Liao DJ & Dickson RB 2002 Roles of androgens in the development, growth, and carcinogenesis of the mammary gland. Journal of Steroid Biochemistry and Molecular Biology 80 175–189.

    • Search Google Scholar
    • Export Citation
  • Liao D-ZJ, Cooley GP, Pantazis CG, Hou X & Li SA 1998 Promotion of estrogen-induced mammary gland carcinogenesis by androgen in the male Noble rat: probable mediation by steroid receptors. Carcinogenesis 19 2173–2180.

    • Search Google Scholar
    • Export Citation
  • Lippman M 1998 Endocrine-responsive cancer. In Williams Textbook of Endocrinology, pp 1675–1692. Eds JD Wilson, DW Foster, HM Kronenberg & PR Larsen. Philadelphia, PA: W.B. Saunders Company.

  • Lippman M, Bolan G & Huff K 1976 The effects of androgens and antiandrogens on hormone responsive human breast cancer in long-term tissue culture. Cancer Research 36 4610–4618.

    • Search Google Scholar
    • Export Citation
  • Lønning PE 2004 Aromatase inhibitors in breast cancer. Endocrine-Related Cancer 11 179–189.

  • Lopez-Diazguerrero NE, Lopez-Araiza H, Conde-Perezprina JC, Bucio L, Cardenas-Aguayo MC, Ventura JL, Covarrubias L, Gutierrez-Ruiz MC, Zentella A & Konigsberg M 2006 Bcl-2 protects against oxidative stress while inducing premature senescence. Free Radical Biology and Medicine 40 1161–1169.

    • Search Google Scholar
    • Export Citation
  • Maggiolini M, Donzé O, Jeannin E, Andò S & Picard D 1999 Adrenal androgens stimulate the proliferation of breast cancer cells as direct activators of estrogen receptor α. Cancer Research 59 4864–4869.

    • Search Google Scholar
    • Export Citation
  • Musgrove EA & Sutherland RL 1994 Cell cycle control by steroid hormones. Seminars in Cancer Biology 5 381–389.

  • Nicholson RI, Gotting KE, Gee J & Walker KJ 1988 Actions of oestrogens and antioestrogens on rat mammary gland development: relevance to breast cancer prevention. Journal of Steroid Biochemistry 30 95–103.

    • Search Google Scholar
    • Export Citation
  • Pasqualini JR & Chetrite G 1996 Activity, regulation and expression of sulfatase, sulfotransferase, and 17β-hydroxysteroid dehydrogenase in breast cancer. In Hormone-Dependent Cancer, pp 25–80. Eds JR Pasqualini & BS Katzenellenbogen. New York, NY, USA: Marcel Dekker, Inc.

  • Pike MC & Spicer DV 1991 Endogenous estrogen and progesterone as the major determinants of breast cancer risk: prospects for control by “natural” and “technological” means. In Hormonal Carcinogenesis, pp 209–216. Eds JJ Li, S Nandi & SA Li. New York, NY, USA: Springer-Verlag.

  • Pike MC, Spicer DV, Dahmoush L & Press MF 1993 Estrogens, progestogens, normal breast cell proliferation, and breast cancer risk. Epidemiologic Reviews 15 17–35.

    • Search Google Scholar
    • Export Citation
  • Poulin R, Baker D & Labrie F 1988 Androgens inhibit basal and estrogen-induced cell proliferation in the ZR-75-1 human breast cancer cell line. Breast Cancer Research and Treatment 12 213–225.

    • Search Google Scholar
    • Export Citation
  • Ragaz J 1999 Status of aromatase inhibitors in relation to other breast cancer treatment modalities. Endocrine-Related Cancer 6 277–291.

  • Reel JR, Humphrey RR, Shih Y-H, Windsor BL, Sakowski R, Creger PL & Edgren RA 1979 Competitive progesterone antagonists: receptor binding and biological activity of testosterone and 19-nortestosterone derivatives. Fertility and Sterility 31 552–561.

    • Search Google Scholar
    • Export Citation
  • Roy R, Dauvois S, Labrie F & Bélanger A 1992 Estrogen-stimulated glucuronidation of dihydrotestosterone in MCF-7 human breast cancer cells. Journal of Steroid Biochemistry and Molecular Biology 41 579–582.

    • Search Google Scholar
    • Export Citation
  • Russell DW & Wilson JD 1994 Steroid 5α-reductase: two genes/two enzymes. Annual Review of Biochemistry 63 25–61.

  • Santen RJ, Manni A, Harvey H & Redmond C 1990 Endocrine treatment of breast cancer in women. Endocrine Reviews 11 221–265.

  • Santillán R, Pérez-Palacios G, Reyes M, Damián-Matsumura P, García GA, Grillasca I & Lemus AE 2001 Assessment of the oestrogenic activity of the contraceptive progestin levonorgestrel and its non-phenolic metabolites. European Journal of Pharmacology 427 167–174.

    • Search Google Scholar
    • Export Citation
  • Sasano H, Frost AR, Saitoh R, Harada N, Poutanen M, Vihko R, Bulun SE, Silverberg SG & Nagura H 1996 Aromatase and 17β-hydroxysteroid dehydrogenase type 1 in human breast carcinoma. Journal of Clinical Endocrinology and Metabolism 81 4042–4046.

    • Search Google Scholar
    • Export Citation
  • Sasano H, Sato S, Ito K, Yajima A, Nakamura J, Yoshihama M, Ariga K, Anderson TJ & Miller WR 1999 Effects of aromatase inhibitors on the pathobiology of human breast, endometrial and ovarian carcinoma. Endocrine-Related Cancer 6 197–204.

    • Search Google Scholar
    • Export Citation
  • Schoonen WGEJ, Joosten JWH & Kloosterboer HJ 1995a Effects of two classes of progestagens, pregnane and 19-nortestosterone derivatives, on cell growth of human breast tumor cells: I. MCF-7 cell lines. Journal of Steroid Biochemistry and Molecular Biology 55 423–437.

    • Search Google Scholar
    • Export Citation
  • Schoonen WGEJ, Joosten JWH & Kloosterboer HJ 1995b Effects of two classes of progestagens, pregnane and 19-nortestosterone derivatives, on cell growth of human breast tumor cells: II, T47D cell lines. Journal of Steroid Biochemistry and Molecular Biology 55 439–444.

    • Search Google Scholar
    • Export Citation
  • Smith JA & King RJ 1972 Effects of steroids on growth of an androgen-dependent mouse mammary carcinoma in cell culture. Experimental Cell Research 73 351–359.

    • Search Google Scholar
    • Export Citation
  • Smith CL, Conneely OM & O’Malley BW 1993 Modulation of the ligand-independent activation of the human estrogen receptor by hormone and antihormone. PNAS 90 6120–6124.

    • Search Google Scholar
    • Export Citation
  • Somboonporn W & Davis SR 2004 Testosterone effects on the breast: implications for testosterone therapy for women. Endocrine Reviews 25 374–388.

    • Search Google Scholar
    • Export Citation
  • Sonne-Hansen K & Lykkesfeldt AE 2005 Endogenous aromatization of testosterone results in growth stimulation of the human MCF-7 breast cancer cell line. Journal of Steroid Biochemistry and Molecular Biology 93 25–34.

    • Search Google Scholar
    • Export Citation
  • Steckelbroeck S, Jin Y, Gopishetty S, Oyesanmi B & Penning TM 2004 Human cytosolic 3α-hydroxysteroid dehydrogenases of the aldo–keto reductase superfamily display significant 3β-hydroxysteroid dehydrogenase activity. Journal of Biological Chemistry 279 10784–10795.

    • Search Google Scholar
    • Export Citation
  • Suzuki T, Moriya T, Ariga N, Kaneko C, Kanazawa M & Sasano H 2000 17β-Hydroxysteroid dehydrogenase type 1 and type 2 in human breast carcinoma: a correlation to clinicopathological parameters. British Journal of Cancer 82 518–523.

    • Search Google Scholar
    • Export Citation
  • Suzuki T, Darnel AD, Akahira J-I, Ariga N, Ogawa S, Kaneko C, Takeyama J, Moriya T & Sasano H 2001 5α-Reductases in human breast carcinoma: possible modulator of in situ androgenic actions. Journal of Clinical Endocrinology and Metabolism 86 2250–2257.

    • Search Google Scholar
    • Export Citation
  • Suzuki T, Miki Y, Nakamura Y, Moriya T, Ito K, Ohuchi N & Sasano H 2005 Sex steroid producing enzymes in human breast cancer. Endocrine-Related Cancer 12 701–720.

    • Search Google Scholar
    • Export Citation
  • Szelei J, Jimenez J, Soto AM, Luizzi MF & Sonnenschein C 1997 Androgen-induced inhibition of proliferation in human breast cancer MCF7 cells transfected with androgen receptor. Endocrinology 138 1406–1412.

    • Search Google Scholar
    • Export Citation
  • Weihua Z, Mäkelä S, Andersson LC, Salmi S, Saji S, Webster JI, Jensen EV, Nilsson S, Warner M & Gustafsson J-Å 2001 A role for estrogen receptor β in the regulation of growth of the ventral prostate. PNAS 98 6330–6335.

    • Search Google Scholar
    • Export Citation
  • Weihua Z, Lathe R, Warner M & Gustafsson J-Å 2002 An endocrine pathway in the prostate, ERβ, AR, 5α-androstane-3β,17β-diol, and CYP7B1, regulates prostate growth. PNAS 99 13589–13594.

    • Search Google Scholar
    • Export Citation
  • Weiler PJ & Wiebe JP 2000 Plasma membrane receptors for the cancer-regulating progesterone metabolites, 5α-pregnane-3,20-dione and 3α-hydroxy-4-pregnen-20-one in MCF-7 breast cancer cells. Biochemical and Biophysical Research Communications 272 731–737.

    • Search Google Scholar
    • Export Citation
  • Wiebe JP & Muzia D 2001 The endogenous progesterone metabolite, 5α-pregnane-3,20-dione, decreases cell-substrate attachment, adhesion plaques, vinculin expression, and polymerized F-actin in MCF-7 breast cancer cells. Endocrine 16 7–14.

    • Search Google Scholar
    • Export Citation
  • Wiebe JP & Lewis MJ 2003 Activityand expression of progesterone metabolizing 5α-reductase, 20α-hydroxysteroid oxidoreductase and 3α(β)-hydroxysteroid oxidoreductases in tumorigenic (MCF-7, MDA-MB-231, T-47D) and nontumorigenic (MCF-10A) human breast cancer cells. BMC Cancer 3 1–15.

    • Search Google Scholar
    • Export Citation
  • Wiebe JP, Muzia D, Hu J, Szwajcer D, Hill SA & Seachrist JL 2000 The 4-pregnene and 5α-pregnane progesterone metabolites formed in nontumorous and tumorous breast tissue have opposite effects on breast cell proliferation and adhesion. Cancer Research 60 936–943.

    • Search Google Scholar
    • Export Citation
  • Wing LY, Garrett WM & Brodie AM 1985 Effects of aromatase inhibitors, aminoglutethimide, and 4-hydroxyandrostenedione on cyclic rats and rats with 7,12-dimethylbenz(a)anthraceneinduced mammary tumors. Cancer Research 45 2425–2428.

    • Search Google Scholar
    • Export Citation
  • Xie B, Tsao SW & Wong YC 1999 Sex hormone-induced mammary carcinogenesis in female Noble rats: the role of androgens. Carcinogenesis 20 1597–1606.

    • Search Google Scholar
    • Export Citation
  • Zhou J, Ng S, Adesanya-Famuiya O, Anderson K & Bondy CA 2000 Testosterone inhibits estrogen-induced mammary epithelial proliferation and suppresses estrogen receptor expression. FASEB Journal 14 1725–1730.

    • Search Google Scholar
    • Export Citation