Human neurons express type I GnRH receptor and respond to GnRH I by increasing luteinizing hormone expression

in Journal of Endocrinology

Gonadotropin-releasing hormone receptor I (GnRHR I) has been localized to the limbic system of the rat brain, although the functional consequences of GnRH signaling through these receptors is unknown. In this paper, we characterize the expression of GnRHR I in the human hippocampus and cortex, and the functionality of GnRHR I in human neuroblastoma cells. Robust GnRHR I immunoreactivity was detected in the cell body as well as along the apical dendrites of pyramidal neurons in the CA2, CA1, and end plate, but was clearly lower in the subiculum of the hippocampus. Immunolabeling was also evident in cortical neurons, including those located in the entorhinal cortex and occipitotemporal gyrus but was not observed within the granular layer of the dentate gyrus. No differences in immunohistochemical staining were observed between control and Alzheimer’s disease brain. GnRHR I mRNA and protein (mature, immature, and other variant) expression was detected in human neuroblastoma cells (M17, SH-SY5Y) and rat embryonic primary neurons and varied with differentiation and GnRH treatment. Since GnRHR I was expressed by extrapituitary cells, and hypothalamic GnRH I secretion markedly increases post-menopause/andropause, we treated human M17 neuroblastoma cells cultured in serum-free conditions with GnRH I for 6 h and measured LH expression. M17 neuroblastoma cells express LHβ mRNA, while immunoblot analysis indicated the presence of three LH variants (approximately 30, 47, and 60 kDa) that were upregulated by low concentrations of GnRH I, but down-regulated at higher GnRH I concentrations. LH expression was also found to increase in differentiating embryonic rat primary cortical neurons. Our results demonstrate that neurons expressing GnRHR I are functional, responding to GnRH I by upregulating LH production. Post-reproductive surges in GnRH I secretion may explain the accumulation of LH in pyramidal neurons of the aged human and rat.


Gonadotropin-releasing hormone receptor I (GnRHR I) has been localized to the limbic system of the rat brain, although the functional consequences of GnRH signaling through these receptors is unknown. In this paper, we characterize the expression of GnRHR I in the human hippocampus and cortex, and the functionality of GnRHR I in human neuroblastoma cells. Robust GnRHR I immunoreactivity was detected in the cell body as well as along the apical dendrites of pyramidal neurons in the CA2, CA1, and end plate, but was clearly lower in the subiculum of the hippocampus. Immunolabeling was also evident in cortical neurons, including those located in the entorhinal cortex and occipitotemporal gyrus but was not observed within the granular layer of the dentate gyrus. No differences in immunohistochemical staining were observed between control and Alzheimer’s disease brain. GnRHR I mRNA and protein (mature, immature, and other variant) expression was detected in human neuroblastoma cells (M17, SH-SY5Y) and rat embryonic primary neurons and varied with differentiation and GnRH treatment. Since GnRHR I was expressed by extrapituitary cells, and hypothalamic GnRH I secretion markedly increases post-menopause/andropause, we treated human M17 neuroblastoma cells cultured in serum-free conditions with GnRH I for 6 h and measured LH expression. M17 neuroblastoma cells express LHβ mRNA, while immunoblot analysis indicated the presence of three LH variants (approximately 30, 47, and 60 kDa) that were upregulated by low concentrations of GnRH I, but down-regulated at higher GnRH I concentrations. LH expression was also found to increase in differentiating embryonic rat primary cortical neurons. Our results demonstrate that neurons expressing GnRHR I are functional, responding to GnRH I by upregulating LH production. Post-reproductive surges in GnRH I secretion may explain the accumulation of LH in pyramidal neurons of the aged human and rat.



Luteinizing hormone (LH) is secreted from gonadotropes of the anterior pituitary into the bloodstream following pulsatile stimulation by hypothalamic gonadotropin-releasing hormone I (GnRH I; Larsen et al. 2002). LH has also been immunolocalized to the cytoplasm of neurons of the cerebral cortex and hippocampus of the human and rat brains (Hostetter et al. 1981, Emanuele et al. 1983, Bowen et al. 2002), and is found in the cerebrospinal fluid (Bagshawe et al. 1968).

The exact origin of extrapituitary intracellular LH is unclear. One possible explanation is that pyramidal neurons sequester LH from extracellular sources (e.g. blood). This is supported by the findings that pyramidal neuron LH is elevated approximately twofold in Alzheimer’s disease (AD) compared with age-matched control brains (Bowen et al. 2002), an increase that correlates with a twofold increase in serum LH (Bowen et al. 2000, Hogervorst et al. 2001, Short et al. 2001). Another intriguing possibility is that aging neurons, like fetal and cancer cells, might be capable of synthesizing LH (Whitfield & Kourides 1985, Krichevsky et al. 1995, Yokotani et al. 1997). This latter idea is supported by the findings that (1) mRNA for LH has been localized to pyramidal neurons of the cerebral cortex and hippocampus of the aging rat brain (Lee et al. 2004), (2) GnRH receptor I (GnRHR I) is localized to extrapituitary cells in the rodent brain including the hippocampus, amygdala, entorhinal cortex, and subiculum, with lower levels in the septum, frontal cortex and hypothalamus (Reubi & Maurer 1984, Badr & Pelletier 1987, Haour et al. 1987, Reubi et al. 1987, Jennes et al. 1988, 1995, 1996, 1997, Leblanc et al. 1988, Badr et al. 1989, Ban et al. 1990, Thompson & Moss 1992, Crumeyrolle-Arias et al. 1994, Pierpaoli & Lesnikov 1997, Lu et al. 1999, Granger et al. 2004), and (3) the pulsatile release of GnRH I from the hypothalamus is dramatically elevated following menopause (Gill et al. 2002, Gore et al. 2004). The increased binding of GnRH I to gonadotrope GnRHR I results in dramatic elevations in the synthesis and secretion of gonadotropins following menopause and andropause (Gharib et al. 1990, Couzinet & Schaison 1993, Woller et al. 2002). The presence of GnRHR I on neurons of the brain implies that GnRH I also might signal through these neurons to increase LH synthesis and secretion.

Understanding the source of neuronal LH has implications for our understanding of neoplasia (Whitfield & Kourides 1985, Krichevsky et al. 1995, Yokotani et al. 1997) and AD (Bowen & Atwood 2004). With regards to AD, LH promotes the amyloidogenic processing of the amyloid-β precursor protein to generate amyloid-β, the major component of amyloid plaques that deposit in AD (Bowen et al. 2004). In addition, the GnRH I analog, leuprolide acetate, which suppresses serum LH, has been shown to decrease amyloid load in the brains of normal and aged amyloid-β precursor protein (AβPP)-transgenic mice, and maintain cognitive performance in aged AβPP-transgenic mice (Bowen et al. 2004, Casadesus et al. 2006).

Given the above observations, we examined whether neurons express GnRHR I, and like pituitary gonadotropes, respond to GnRH I by expressing LH. We report that GnRHR I is localized to the cell body and apical dendrites of pyramidal neurons in the human hippocampus, entorhinal cortex, and occipitotemporal gyrus, and that neurons are capable of de novo LH synthesis. GnRH I may therefore play a role in regulating biochemical events associated with post-reproductive neuronal senescence.

Materials and Methods

Antibodies and reagents

The high-affinity LH polyclonal antibody generated against the β-subunit of the LH glycoprotein was from Dr A F Parlow at the National Hormone and Peptide Program, Harbor-UCLA Medical Center, Torrance, CA, USA. The GnRHR I monoclonal antibody, F1G4, directed against the N-terminal amino acid residues 1–29 was from Dr Anjali Karande (Indian Institute of Science, Bangalore, India). The GnRHR I polyclonal antibody, C-18, directed against 18 C-terminal residues, and the GAPDH polyclonal antibody were from Santa Cruz Biotechnologies (Santa Cruz, CA, USA). Neuron specific enolase (NSE) was purchased from Signet Laboratories (Dedham, MA, USA). Horseradish peroxidase linked goat anti-mouse, goat anti-rabbit, and donkey anti-goat IgG were from Santa Cruz Biotechnologies. Goat affinity purified antibody to mouse IgG was from MP Biomedicals (Aurora, OH, USA) and the mouse peroxidase anti peroxidase (PAP) was from Steinberger Monoclonals Inc. (Lutherville, MD, USA). Isotype-matched antibody IgG1 was from Santa Cruz Biotechnologies. The low range pre-stained (approximately 20–120 kDa) molecular weight markers were from Bio-Rad Laboratories.

Primary rat cortical neurons (E18) were purchased from Brain Bits (Springfield, IL, USA). Opti-Mem, Dulbecco’s modified Eagle’s media (DMEM), modified Eagle’s media (MEM), and F12 Nutrient Mixture B27 supplement were from Invitrogen. The media supplement, insulin–transferrin–selenium, was purchased from Sigma Laboratories. GnRH I peptide was from Peninsula Laboratories (San Carlos, CA, USA). Protease inhibitor cocktail (aprotinin, pepstatin, leupeptin, and phenylmethylsulphonyl fluoride) was from Roche Diagnostics. The Luteinizing Hormone Detection Kit was from Hope Laboratories (Belmont, CA, USA).


Human hippocampal tissue was collected at autopsy from clinically and pathologically confirmed cases of AD using National Institute for Aging (NIA) and Consortium to Establish a Registry for Alzheimer’s Disease (CERAD) criteria (Khachaturian 1985, Mirra et al. 1991; Table 1). Tissues were formalin-fixed, embedded in paraffin, sectioned at 4 μm thickness and placed on SP Brand Superfrost Plus slides (Cardinal Health, Dublin, OH, USA).

Tissue sections were deparaffinized with xylene and then hydrated through a series of ethanols. Endogenous peroxidase activity was eliminated with a 30-min incubation in 3% H2O2 in methanol. Following placement of the sections in citrate buffer (1 mM, pH 6.0), slides were autoclaved at 121 °C for 30 min and then rinsed well. Non-specific binding sites were blocked with 10% normal goat serum in tris buffered saline (TBS; 20 mM Tris, 150 mM NaCl, pH 7.6) for 30 min before application of GnRHR I monoclonal antibody F1G4 (1:250 dilution) overnight at 4 °C. After a series of washes, tissue sections were incubated with both the goat affinity purified antibody to mouse IgG (1:50 dilution, 30 min) and the mouse PAP (1:250 dilution, 60 min). Immunostaining was then developed using diaminobenzidine (DAKO Corporation, Carpinterie, CA, USA) for 10 min, slides mounted using Permount (Fisher Chemicals, Fair Lawn, NJ, USA) and staining analyzed under an inverted microscope (Zeiss Axiophot, Thornwood, NY, USA). To control for non-specific primary or secondary antibody binding, control tissue sections were treated with isotype-matched IgG1 primary antibody or secondary antibody respectively. Sections were scored by three investigators for hippocampal (CA2, CA1, end plate, and subiculum) labeling. An Olympus Optical BX40F microscope at objective 10× magnification was used to capture images using Image Pro software.

Human brain tissue homogenization and immunoblot analysis

Human frontal area 9 (frontal cortical) brain tissues were kindly provided by the Sanders-Brown Center on Aging at the University of Kentucky, Lexington, KY, and pituitary was provided by the University of Wisconsin/Veteran’s Administration Brain Bank. Age, gender, and post-mortem interval (PMI) matched samples (approximately 150 mg) of seven AD cases (ages 84–93) and seven control cases (ages 83–92) were homogenized in 300 μl PBS, containing 10 μg/ml aprotinin and leupeptin, 1 μg/ml pepstatin A, 1 mM phenylmethanesulfonyl fluoride, 1% Triton-X100, 0.2% NP40, and 0.1% SDS) over ice. Samples were centrifuged at 9000 g for 10 min and the supernatant removed and stored at −80 °C for future analysis.

Following protein assay (BCA assay Pierce, Rockford, IL, USA), equal amounts of protein were loaded onto 10–20% Tricine precast gels (Novex, San Diego, CA, USA). Samples then underwent immunoblot analysis as described previously using GnRHR I monoclonal antibody, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primary antibody, and GnRHR I polyclonal (C-18) antibody.

M17 neuroblastoma cell culture, treatment, and immunoblotting

Human M17 neuroblastoma cells were maintained at 37 °C in OPTI-MEM media containing 0.5% FBS and 1% penicillin/streptomycin (P/S; 100 U/ml penicillin, 100 mg/ml streptomycin). Human SH-SY5Y neuroblastoma cells were maintained in MEM and F12 medias (1:1 ratio) containing 10% FBS and 1% P/S. For experiments, cells were plated 48 h prior to treatment at a density of approximately 5.0×105 cells/well in six-well plates. The following day, cultures were placed in serum-free media (DMEM supplemented with 1% insulin/transferrin/sodium selenite supplement) for 24 h prior to treatment with 0–10 μM GnRH I peptide. Cells were then collected using lysis buffer (Tris 20 mM, NaCl 150 mM, 1% SDS, 1 mM EDTA, 1 mM EGTA, and protease inhibitors; pH 7.6), the protein concentration determined using the BCA Assay and equal amounts of protein loaded onto 10–20% tricine gels (Novex). Samples were then transferred onto polyvinylidene fluoride (PVDF) membranes (Bio-Rad Laboratories), fixed with 4% glutaraldehyde in TBS Tween-20 (TBST), blocked with 10% milk in TBST for 2 h and probed with a rabbit polyclonal antibody against human LH (dilution 1:1000). Following a series of TBST washes on the second day, the blot was incubated with the appropriate secondary antibody for 2 h at room temperature, washed again and developed with ECL reagent (Amersham). The chemiluminescent signal was captured on autoradiographs (Eastman Kodak Company, Aurora, IL, USA). The blot was then stripped using Restore stripping buffer (Pierce) and subsequently reprobed with the GnRHR I monoclonal antibody and finally a GAPDH antibody as a loading control for quantification. Images were captured, scanned, and the intensity of the autoradiograph signals (including a blank region) was determined using the NIH Image J software ( Control and treatment values were corrected for blank values, normalized to their respective GAPDH band intensity and the results then expressed as a fold change over control levels.

Primary rat cortical neuron culture

Neuronal cultures were taken from frontal cortices of Sprague–Dawley rat embryonic (E18) pups. The cells were dissociated by tituration in Hibernate E media (Brain Bits), undispersed tissue allowed to settle for 1 min, and the supernatant transferred to a new tube prior to centrifugation for 1 min at 200 g. The supernatant was then removed and the cells resuspended in serum-free Neurobasal medium (without phenol red) with B-27 supplement (Invitrogen), 25 μM l-glutamate, 1% P/S and 0.5 mM l-glutamine, counted using a hemocytometer and then equal volumes of mixed cells were plated into six-well (1×106 cells/well; Fisher) poly-l-lysine-coated plates (Sigma). Cortical cultures were allowed to differentiate in 5% CO2, 85% humidity in the above media for up to 12 days and then collected for immunoblot analysis. Following protein assay, gels were loaded with equal amounts of protein. A loading control (such as tubulin and actin) was not assessed since the expression of these proteins increase with differentiation (Drubin et al. 1988).

LH secretion assay

Human M17 neuroblastoma cells were cultured in OPTI-MEM media (Invitrogen) containing 0.5% FBS and 1% P/S for 72 h or until confluence was reached. Cells were then treated in serum-free conditions with 0–10 μM GnRH I for 48 h. Media were collected and stored at −80 °C prior to enzyme immunoassay (Hope Laboratories) to quantitate media LH concentration. Two human serum samples containing low and high concentrations of LH were included as controls for the assay.

Detection of GnRHR I and LH mRNA

Total RNA was isolated from cultured M17 cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. GnRHR I and LHβ cDNA were synthesized and amplified using the SuperScript III One-Step RT-PCR system (Invitrogen). Both cDNA synthesis and PCR amplification were carried out using gene-specific primers: GnRHR I forward 5′ AGCAGACAGCTCTGGACAGACAAA 3′, reverse 5′ ACATAGTAGGGAGTCCAGCAGACA 3′. LHβ forward 5′ GCTACTGCCCCACCATGATG 3′, reverse 5′ ATGGACTCGAAGCGCACATC 3′. The PCR product was run on 4% Metaphor agarose gel (Cambrex Bio Science, Rockland, ME, USA) or 20% polyacrylamide gel (Invitrogen), and amplified DNA extracted using a QIA quick gel extraction kit (Qiagen). Extracted PCR product was cycle sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Madison, WI, USA) and automated sequencing was performed at the University of Wisconsin Biotechnology Center (Madison, WI, USA). To confirm that the sequenced PCR products were in fact human GnRHR I or LHβ cDNA and not the result of amplification of residual genomic DNA in the RNA sample, sequenced PCR products were aligned with the known GnRHR I mRNA sequence (Accession number AY392011), or the LHβ mRNA sequence (Accession number NM_000894) and checked for the absence of an intronic sequence.

Statistical analysis

For immunohistochemical labeling of AD and control tissues, scores from three investigators for hippocampal (CA2, CA1, end plate, and subiculum) labeling of GnRHR I were averaged. Statistical analysis of the expression of GnRHR I variants between AD and age-matched control samples was conducted using a two-sample t-test (between groups) (Statview 5.0; SAS Institute, Inc Cary, NC, USA).


Immunolocalization of GnRHR I to human pyramidal and cerebrocortical neurons

To determine whether GnRHR I is expressed by neurons of the human brain, hippocampal and neocortical tissue sections were immunostained using the F1G4 monoclonal GnRHR I antibody that detects the N-terminal 29 amino acids (Karande et al. 1995). Immunoreactivity was clearly present throughout the hippocampus and neocortex in the cell body of large pyramidal neurons and extended along the apical dendrites of these neurons (Figs 1 and 2). GnRHR I immunostaining in the hippocampus compared favorably with GnRHR I immunostaining in gonadotropes of the human pituitary (Fig. 1).

To determine if GnRHR I expression varied throughout the hippocampus, immunolabeling was scored in four main regions of the hippocampus: CA2, CA1, end plate, and subiculum (Fig. 2; Table 1). Labeling was most prominent in the CA2 sector (Fig. 2; Table 1), was noted in the end plate and CA1 sector, but was clearly less in the subiculum when compared with the other hippocampal sectors (Table 1). Labeling was also evident in neocortical neurons, including those located in the entorhinal cortex and occipitotemporal gyrus (Fig. 2). Staining was not observed within the granular layer of the dentate gyrus or in other neuronal cell types.

To determine if there were differences in the expression of GnRHR I between control tissues and tissue from the AD brain, age-matched AD brain tissues were stained for GnRHR I. Immunolabeling of AD tissues was clearly evident in the regions described above for control tissues (Fig. 2). No significant differences in labeling intensity were observed between control and AD tissues (Table 1). However, labeling was clearly decreased on apical dendrites of pyramidal neurons in the AD compared with control brains (Fig. 2; upper versus lower panels). Tissues incubated with an isotype-matched primary antibody or with the secondary antibody alone were not labeled (not shown). These results demonstrate that like the rat, GnRHR I is present on neurons of the human hippocampus and neocortex and is not solely located within the anterior pituitary.

AD and age-matched control human cortices express GnRHR I

To examine if there were differences in GnRHR I expression between age-matched controls and AD, immunoblot analyses of total homogenate from the frontal cortex were performed using the F1G4 antibody (Karande et al. 1995). Three main GnRHR I variants were present, including a 30 kDa GnRHR I variant, the mature 64 kDa variant (Wormald et al. 1985, Karande et al. 1995), a 136 kDa variant, and two minor variants migrating at approximately 77 and 94 kDa that might represent differentially post-translated proteins or receptor complex components (Fig. 3a; Conn & Venter 1985, Wormald et al. 1985, Stojilkovic & Catt 1995, Keller et al. 2005b). These same variants were also expressed in the pituitary, where the 94 kDa variant predominated (Fig. 3c). Quantification of the major variant bands indicated a 41, 28, and 86% decrease in the relative intensities of the 30, 64, and 136 kDa variants between control and AD brain respectively that reached significance with the 30 and 136 kDa variants when normalized to the GAPDH loading control (Fig. 3b). To determine whether the decrease in GnRHR I expression was a result of neuron loss in the AD brains, we reprobed the blot with NSE. As expected, the level of NSE was lower in the AD compared with control cortex. Normalization of the GnRHR I expression against NSE indicated that only the 136 kDa variant was significantly decreased in the AD brain (Fig. 3b).

To confirm that there were no changes in the mature 64 kDa variant, we reprobed the blot using the C18 polyclonal GnRHR I antibody that has been shown to recognize only the mature uncomplexed form of the receptor (Bajo et al. 2003, Keller et al. 2005b). We detected one band migrating at 64 kDa, the mature form of the receptor (Wormald et al. 1985, Karande et al. 1995, Keller et al. 2005a; Fig. 4a). This band also was detected in homogenized pituitary tissue (Fig. 4b; Hazum et al. 1987). As noted above for the monoclonal antibody, GnRHR I (64 kDa) expression was not different between control and AD tissues (quantitation not shown). These results indicate that mature GnRHR I variant expression is similar in both AD and control cortical tissue, but that there is a differential expression of the 136 kDa variant between AD and age-matched control cortex. Together, these results demonstrate the localization of GnRHR I on both human hippocampal and cortical tissues.

GnRH I induces the expression of LH in neuroblastoma cells and primary cortical neurons

Given that GnRHR I mediates signaling for the synthesis and secretion of LH by pituitary gonadotropes, we examined the functionality of neuronally expressed GnRHR I in terms of LH expression in human M17 and SH-SY5Y neuroblastoma cells cultured in serum-free media. Immunoblot analysis under reducing conditions and using the well-characterized polyclonal antibody anti-human-LHβ (Parlow 2004) indicated that neuroblastoma cells express three LH variants, including the mature 30/31 kDa full-length protein (Nureddin & Johnson 1977) and two minor variants migrating at approximately 43 and 47 kDa that might represent differentially post-translated proteins (Fig. 5a, lane 1 and d). A 60 kDa band also was detected that might represent a dimer. Since the anti-human LHβ antibody was generated against the entire β-subunit of the LH glycoprotein, the increase in expression of the mature 30 kDa protein suggests that GnRH promotes the expression of both LHβ and glycoprotein hormone alpha subunit (α-GSU). To confirm LH expression, isolated RNA was reverse transcribed and LHβ cDNA amplified using two gene-specific primers. The expected 95 bp cDNA fragment encompassing portions of exons 2 and 3 was detected (Fig. 5c). The sequence of the amplified cDNA matched the genomic sequence (minus the intronic sequences) demonstrating that the amplified cDNA was from LHβ mRNA template.

We next tested whether neuroblastoma cells respond to GnRH I by increasing LH expression. Treatment of M17 cells with increasing concentrations of human GnRH I (0–10 μM) for 6 h initially increased the expression of all LH variants. Quantitation of the immunoblots indicated that the expression of the 30 and 47 kDa variants were approximately two- to threefold elevated between 1 and 10 nM, but at high GnRH I concentrations (≥1000 nM), the expression of both LH variants was suppressed (Fig. 5b). To examine whether primary neurons also express LH, cortical neurons from day 18 rat embryos were differentiated over 12 days. An increase in the expression of the 30 kDa full-length LH was apparent with differentiation (Fig. 5e). These results indicate that LH mRNA and protein are normally expressed by neurons.

To determine whether changes in LH expression following GnRH I treatment was a result of GnRHR I activation, we examined GnRHR I expression in the neuroblastoma samples, using the monoclonal antibody F1G4 described above. Immunoblot analysis indicated that M17 neuroblastoma cells express a numberof GnRHR I variants, including the immature 37.7 kDa full-length protein (deduced from the amino acid sequence), a 30 kDa variant which may represent a truncated variant, and a 136 kDa variant that represents the functional form of the receptor (Conn & Venter 1985; Fig. 6a). Similar variants were observed in SH-SY5Y neuroblastoma cells (data not shown). To confirm GnRHR I expression, isolated RNA was reverse transcribed and GnRHR I cDNA amplified using two gene-specific primers. The expected 308 bp cDNA fragment encompassing parts of exons 2 and 3 was detected (Fig. 6c). The sequence of the amplified cDNA matched the genomic sequence (minus the intronic sequences) demonstrating that the amplified cDNA was from the GnRHR I mRNA template. These results indicate that GnRHR I mRNA and protein is normally expressed by neurons. Expression of the 37.7 kDa immature form of the receptor did not alter with increasing concentrations of GnRH I. However, the levels of the 30 and 136 kDa variants initially decreased with increasing GnRH I concentration before increasing at higher GnRH concentrations (Fig. 6b). Immunoblot analysis of these samples using the GnRHR I polyclonal antibody against a C-terminal stretch of 18 amino acids revealed only one band that was representative of the immature 37.7 kDa variant (data not shown). Overall, these results indicate that transcription of the immature form of the receptor is not affected by GnRH I, but that receptor complex formation and/or post-translational modification of the GnRHR I is modulated by GnRH I.

Immunoblot analysis of differentiating rat cortical primary neurons for GnRHR I indicated that the same variants were expressed (approximately 30, 37, and 136 kDa; Fig. 6d) as for the human neuroblastoma cell lines (Fig. 6a). GnRHR I expression increased with neuron differentiation (i.e. neuritic outgrowth), and since equal amounts of protein were loaded at each time point, these results suggest that neurites may express proportionally more GnRHR I than the neuronal cell body.

Together, these results indicate that neurons, (1) express mature and post-translationally modified variants of LH, (2) respond to GnRH I by increasing the expression of LH, and (3) possess functional GnRHR I as illustrated by the modulation of LH and GnRHR I expression by GnRH I.


Expression of GnRHR I by neuronal cells

Although GnRHR I has been localized to extrapituitary regions of the rodent brain, we demonstrate for the first time the presence of GnRHR I on pyramidal neurons of the hippocampus and neocortical neurons of the entorhinal cortex and occipitotemporal gyrus of the human brain (Figs 1–4). The presence of GnRHR I throughout the neuron body as well as in the apical dendrites of pyramidal neurons, but not in neurons of the granular cell layer, suggests that GnRH I signaling plays an important role in the function of hippocampal neurons. In this respect, previous studies have shown that leuprolide acetate, a potent GnRHR I agonist, induces a long-lasting enhancement of synaptic transmission mediated by ionotropic glutamate receptors in CA1 pyramidal neurons of rat hippocampal slices (Lu et al. 1999). The use of GnRH analogs in modulating synaptic transmission and neuronal metabolism in these areas of the brain requires further investigation due to its implications in learning and memory.

Immunoblot analysis of human cortical tissue confirmed the presence of three major GnRHR I variants: the mature 64 kDa receptor, a 30 kDa truncated variant and an approximately 136 kDa complex variant (Fig. 3). Although there were considerable individual variations in the expression of GnRHR I variants, the expression of the mature 64 kDa variant (Wormald et al. 1985, Karande et al. 1995, Keller et al. 2005a) was not different between control and AD brains (Fig. 3). Interestingly, radiation inactivation analysis of GnRHR I (a method for determining the functional molecular weight of a receptor while it is still a component of the plasma membrane) indicates that GnRHR I has a molecular mass of 136 346±8120 (Conn & Venter 1985). This estimate is approximately twice of that obtained by immunoblot analyses (Karande et al. 1995, Keller et al. 2005a; Fig. 3) and by photoaffinity labeling with a radioactive GnRH analog followed by electrophoresis under denaturing conditions (Wormald et al. 1985). The high molecular weight band present under our non-reducing conditions in both the brain and neuroblastoma cells may therefore represent a high molecular weight complex of GnRHR I in its native state, coupled to G-proteins and other associated proteins, as has been reported for numerous other G-protein coupled receptors (reviewed by Park et al. 2004). The low expression level of the mature 64 kDa variant in neuroblastoma cells, and of the immature 37.7 kDa variant in the brain, suggests rapid post-translational modification and complexing of GnRHR I to other components of the receptor complex.

GnRHR I expression on transformed cell lines (Fig. 6) has previously been reported for the human olfactory FNC-B4 cell line (Romanelli et al. 2004), as well as numerous other cancer cell lines originating from the prostate, kidney, skin, lymphocytes, liver, larynx, pancreas, colon, and brain (Fekete et al. 1989, Friess et al. 1991, Pati & Habibi 1995, van Groeninghen et al. 1998, Krebs et al. 2002, Moretti et al. 2002, Ben-Yehudah & Lorberboum-Galski 2004). Rat primary cortical neurons express the same GnRHR I variants as neuroblastoma cells (Fig. 5) indicating that neoplastic transformation does not affect GnRHR I expression. The functionality of these receptors is indicated by the GnRH I-induced decrease in the expression of the 136 kDa receptor complex in neuroblastoma cells (Fig. 6b). A similar decrease in the expression of the 136 kDa receptor complex (−86%) was noted in the AD brain (Fig. 3b), a time when LH/ follicle stimulating hormone (FSH) and presumably GnRH I levels are high (Bowen et al. 2000). Since continuous GnRH I stimulation of the GnRHR I is known to ‘desensitize’ receptor signaling, our results suggest that GnRH I may promote the uncoupling of GnRHR I from G-proteins and other proteins of the receptor complex (Fig. 6; Park et al. 2004). Alternatively, GnRH I may promote the internalization and degradation of the receptor complex (Adams et al. 1986).

Expression of LH by neurons

We report that primary neurons and neuroblastoma cells express the gonadotropin LH, and that LH expression is modulated in a dose-dependent manner by GnRH I (Fig. 5). The expression of LH in neurons grown in serum-free media (Fig. 5) indicates that neuronal LH was not sequestered from the serum but synthesized de novo. LH expression increased with differentiation in primary cortical neurons, suggesting that LH expression is a normal function of differentiated neurons. In neuroblastoma cells, GnRH I promoted a similar pattern of expression for all the three major LH variants (30, 47, and 60 kDa); LH expression increased with increasing GnRH I concentrations, but at high GnRH I concentrations the expression of LH decreased. The increase in the expression of LH variants was first detectable at 0.5 nM GnRH I (Fig. 5), which is within the affinity range of GnRH I and GnRH I analogs for GnRHR I (Kd=0.1–1 nM) in the hippocampus of the rat (reviewed by Vadakkadath Meethal & Atwood 2005). GnRH I did not alter the expression of the 37.7 kDa variant of GnRHR I over this short treatment period (6 h) at any concentration (Fig. 6) indicating that a mechanism independent of the regulation of GnRHR I expression mediated the decrease in LH expression (it is unlikely that GnRH I was acting through the 30 and 136 kDa variants, since their expression decreased with increasing GnRH I concentration when LH expression was increasing). The decline in cellular LH at high GnRH I concentrations over this short time (6 h) is unlikely to be explained by GnRH I-induced secretion of LH, since we did not detect LH secretion into media (data not shown), although it cannot be ruled out that neuroblastoma cells secrete low levels of LH. It is therefore likely that desensitization of GnRH I signaling was induced by continuous GnRH I treatment that has previously been shown with other G protein-coupled receptors to involve rapid uncoupling of the receptor from the G-protein and loss of downstream signaling events (and which is followed by subsequent sequestration of the receptor from the plasma membrane, internalization, and proteolytic degradation; Cheng & Leung 2000).

At least 39 isoforms of human LH have been identified (Nureddin & Johnson 1977, Stanton et al. 1993). The LH variants detected in human neuroblastoma cells (30, 47, and 60 kDa) under non-reducing immunoblot analysis have been detected in post-menopausal (30, 35, and 43 kDa; Iles & Chard 1991, Kurowska & Szewczuk 1999) and pre-ovulatory urine (29, 49, 67, 80, and 95 kDa; Kurowska & Szewczuk 1999), and in the human pituitary (29, 49, 60, 67, and 95 kDa; Stanton et al. 1993, Kurowska & Szewczuk 1999).

The expression of LH by neurons is corroborated by the presence of translatable levels of LH mRNA and LH protein in pyramidal neurons of the cerebral cortex and hippocampus of the rat and human (Lee et al. 2004). Levels of neuronal LH were undetectable in adult (3–5-month old) animals but increased with age at 1 and 2 years of age. Previous studies have demonstrated the presence of membrane-associated LH and human chorionic gonadotropin (hCG, which has 83% amino acid sequence homology and shares a common receptor to LH, which they bind with similar affinity) on a number of different human cancer cell lines including retinoblastoma cells cultured in serum-free conditions (Rosen et al. 1980, Acevedo et al. 1992, Krichevsky et al. 1995), (Whitfield & Kourides 1985, Krichevsky et al. 1995, Yokotani et al. 1997).

Functional consequences of GnRH I induction of LH expression by neurons

The presence of GnRHR I on reproductive and non-reproductive tissues suggests GnRH I has physiological affects on tissues of the body other than the pituitary, including the hippocampus (Kakar & Jennes 1995, Cheng & Leung 2000, Harrison et al. 2004). The high binding affinity of GnRH I for its neuronal receptor and the activation by GnRH I of neuronal signal transduction pathways in the rat brain (Jennes et al. 1995, 1997) supports the functionality of extrapituitary GnRHR I. It is not clear whether GnRH I produced by the hypothalamus or by other tissues binds to and signals through these receptors throughout the body. At least for the brain, GnRHR I signaling is likely mediated through GnRH I produced by GnRH I neurons that extend throughout different regions of the brain (Tobet et al. 1996, Quanbeck et al. 1997, Kim et al. 1999, Reed et al. 2002). The short serum half-life of GnRH I (approximately 2–3 min; Redding et al. 1973, Fauconnier et al. 1978) would support autocrine release of GnRH I within the brain, although it has been shown in rats that GnRH I can cross the blood brain barrier (BBB) (Dvorska et al. 1992).

The increased secretion of GnRH I by GnRH I neurons following menopause (Hall et al. 2000, Gore et al. 2004) may explain the increased expression of LH in aging pyramidal neurons of the cerebral cortex and hippocampus of the rat (Lee et al. 2004). In addition, the elevation in gonadotropins (Bowen et al. 2000, Hogervorst et al. 2001, Short et al. 2001) and presumably GnRH I secretion would explain the accumulation of LH detected in pyramidal neurons of the AD compared with age-matched control brain (Bowen et al. 2002). LH released by pituitary gonadotropes could also transfer through perivascular pathways into the brain. The identification of LH/hCG receptors on both endothelial and smooth muscle cells suggests a route by which LH might cross from the vasculature into the brain (Toth et al. 2001). The contribution of de novo synthesized and extracellular LH to total intracellular LH remains to be determined.

The functional consequences of intracellular neuronal LH production are unclear. If neuronal LH was secreted or bound to its receptor intracellularly during its processing through the estrogen receptor (ER) and/or transport to the cell membrane, then a number of scenarios are possible. First, the expression of membrane-associated glycoproteins LH/hCG is a phenotypic characteristic of human cancer cells; hCG is a common serum marker used to determine the progression of cancer and its regression following chemotherapy (Stenman et al. 2004). Thus, the elevation in LH expression in pyramidal neurons in the AD brain (Bowen et al. 2002) is suggestive of a cellular transformation from a differentiated to a mitotic phenotype. In this respect, it is becoming increasingly apparent that pyramidal neurons of the AD brain, those most vulnerable to AD neuropathology, are also those which display numerous markers of cell cycle re-entry (Raina et al. 2000, Herrup et al. 2004). Since both GnRH I and LH/hCG have mitogenic properties, it is plausible that these mitogens may drive differentiated neurons back into the cell cycle. Secondly, in this connection we have shown that LH promotes the amyloidogenic processing of AβPP (Bowen et al. 2004), a cell cycle-related protein that releases Aβ when neurons are driven into the cell cycle (McPhie et al. 2003). Likewise, LH dose-dependently increases tau phosphorylation and the activity of glycogen synthase kinase-3β (GSK-3β) (Casadesus et al. 2006), a key regulator of tau phosphorylation and neurofibrillary tangle formation. In this context, leuprolide acetate (a GnRH I analog), which suppresses serum LH levels, decreases amyloid plaque load in normal and aged AβPP-transgenic mice and maintains the cognitive performance of AβPP-transgenic mice (Bowen et al. 2004, Casadesus et al. 2006). It is unclear at this stage whether leuprolide acetate is acting through the suppression of LH to alter amyloid production and cognition (Bowen et al. 2004, Casadesus et al. 2006), or directly through GnRHRs (Figs 1–4 and 6) to modulate synaptic transmission (Lu et al. 1999). Irrespective, these data support the use of leuprolide acetate in the treatment of AD; leuprolide acetate has been shown in clinical trials to stabilize cognition in women with mild-to-moderate AD over a 1 year period (LaPlante et al. 2006). Thirdly, neuronal LH might impact neurosteroid production, since we have recently demonstrated that LH promotes neurosteroid production in human neuroblastoma cells and in differentiated rat primary neurons (Liu et al. 2006). Future studies will therefore be important in determining the exact role of neuronal LH.

In summary, this paper has demonstrated the presence of GnRHR I on hippocampal and cortical neurons of the human brain, differentiated rat embryonic primary neurons and human neuroblastoma cells. Our findings implicate GnRH I in the normal functioning of the brain, although the physiological significance of our unexpected finding that GnRH can induce neuronal LH synthesis remains to be fully investigated. Therefore GnRH I surges associated with the dysregulation of the hypothalamic-pituitary-gonadal (HPG) axis with menopause and andropause may mediate neurodegenerative events either directly or indirectly via LH production.

Table 1

Immunohistochemical labeling of human hippocampal (CA2, CA1, end plate, subiculum) tissue for GnRHR I in Alzheimer’s disease (AD) and age-matched control subjects

Age (years)GenderDiagnosisBrain weightPost-mortem delayEnd plateCA2CA1Subiculum
Neuronal staining: −, +, ++, +++, or ++++; where − represents no cellular staining and ++++ represents staining equivalent to the strongest signal observed in pituitary gonadotropes. N/A, not available; area of subiculum was infarcted and a score could not be determined.
272MControl1375 gN/A++++
571MControlN/A21 h 20 min++++
1174FControl1223 g7 h 15 min+++++++
1468MControl1200 g3 h 30 min++++++
1771FControlN/A2 h 5 min++++++++
2465MControl1370 g5 h 54 min+++++++++
170MAD1300 g21 h 50 min++++
390MAD1300 gN/A+++++
488FAD1100 g3 h 45 min++++N/A
2376FAD1060 g7 h 25 min++++++
2586FAD1040 g20 h 55 min+++++
2982FAD1100 g2 h 5 min++++
Figure 1
Figure 1

Immunolabeling of GnRHR I in the human hippocampus and pituitary. Human hippocampal and pituitary tissue (positive control) were immunolabeled with the GnRHR I monoclonal antibody, F1G4. Upper panels illustrate GnRHR I immunolabeling throughout the hippocampus and pituitary (objective magnification 2×). Lower panels illustrate labeling of hippocampal pyramidal neurons and pituitary gonadotropes (objective magnification of 10×).

Citation: Journal of Endocrinology 191, 3; 10.1677/joe.1.07047

Figure 2
Figure 2

Immunolocalization of GnRHR I in human control and AD hippocampal and cortical neurons. Immunolabeling of control hippocampus (upper left) and neocortex (upper right) with the GnRHR I monoclonal antibody F1G4 demonstrates GnRHR I localization to the cell body and apical dendrites (case #24). Immunolabeling of AD hippocampus (lower left) and neocortex (lower right) demonstrates GnRHR I localization predominantly to the cell body (case #1). Insets are representative neurons from the 10× pictures, taken at 40× objective magnification to illustrate membrane labeling.

Citation: Journal of Endocrinology 191, 3; 10.1677/joe.1.07047

Figure 3
Figure 3

GnRHR I expression in the cortex of age-matched control and AD subjects. (a) GnRHR I expression was examined in homogenized age-matched AD and control cortical tissue by immunoblot analysis using the GnRHR I monoclonal antibody, F1G4. The blot was reprobed for tissue (GAPDH) and neuron-specific (NSE) loading controls. (b) Quantification of the three prominent GnRHR I variants revealed significant decreases in the 30 and 136 kDa in AD compared with age-matched control tissue when normalized to the GAPDH loading control (mean±s.d., n=6–7, *P<0.01). A significant decrease was maintained only for the approximately 136 kDa receptor complex in AD tissue after normalization against the NSE loading control (mean±s.d., n=6–7, *P<0.01). (c) Immunoblot analysis of pituitary and representative control and AD cortex revealed similar GnRHR I variants. Molecular weight markers are illustrated on the left of figures.

Citation: Journal of Endocrinology 191, 3; 10.1677/joe.1.07047

Figure 4
Figure 4

GnRHR I expression in the cortex of age-matched control and AD subjects. (a) The immunoblot in (Fig. 3a) was reprobed with a polyclonal antibody against the C-terminus of GnRHR I (C-18). One distinct band at approximately 64 kDa, representative of the functional GnRHR I variant, was detected. (b) The samples in (Fig. 3c) were immunoprobed with the polyclonal antibody against the C-terminus of GnRHR I (C-18). A single approximately 64 kDa band is present in both pituitary and brain. Molecular weight markers are illustrated on the left of figures.

Citation: Journal of Endocrinology 191, 3; 10.1677/joe.1.07047

Figure 5
Figure 5

LH expression on neuronal cell types and its modulation by GnRH. (a) Human M17 neuroblastoma cells cultured in defined, serum-free media were treated with increasing concentrations of GnRH I (0–10 μM) for 6 h and then collected for immunoblot analysis of LH expression using the polyclonal anti-human β-LH antibody. (b) Relative intensities of the 30, 47, and 60 kDa bands were normalized to the loading control, GAPDH. Data are representative of three experiments. (c) LHβ cDNA was detected in human M17 neuroblastoma cells. (d) Human SH-SY5Y neuroblastoma cells express similar LH variants as described above for M17 cells. (e) Primary cortical neurons from embryonic day 18 rats cultured in serum-free conditions demonstrate increased LH (30 kDa) expression with differentiation. Molecular weight markers are illustrated on the left of figures.

Citation: Journal of Endocrinology 191, 3; 10.1677/joe.1.07047

Figure 6
Figure 6

GnRHR I expression on neuronal cell types and its modulation by GnRH. (a) The immunoblot from Fig. 4a was stripped and reprobed with the F1G4 monoclonal GnRH I receptor antibody. Three major GnRHR I variants were detected: approximately, 30, 37, and 136 kDa. (b) Relative intensities of GnRH I receptor variants were normalized to GAPDH. Decreases in the levels of the approximately 30 and 136 kDa GnRHR I variants were observed with increasing GnRH I concentrations. The data are representative of three experiments. (c) GnRHR I cDNA was detected in human M17 neuroblastoma cells. (d) The immunoblot from Fig. 5e was stripped and reprobed with the F1G4 monoclonal GnRH I receptor antibody. The expression of approximately 30, 37, and 136 kDa GnRHR I variants increased with neuron differentiation. Equal protein was loaded at each time point. Molecular weight markers are illustrated on the left of figures.

Citation: Journal of Endocrinology 191, 3; 10.1677/joe.1.07047

We would like to acknowledge Kela Galletti, from the Department of Surgical Pathology, for her helpful assistance in the processing and sectioning of brain tissue used for the immunohistochemistry. This work is supported by funds from the National Institute of Health (RO1 AG19356), the University of Wisconsin and the Alzheimer’s Association. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


  • AcevedoHF Krichevsky A Campbell-Acevedo EA Galyon JC Buffo MJ & Hartsock RJ 1992 Expression of membrane-associated human chorionic gonadotropin its subunits and fragments by cultured human cancer cells. Cancer691829–1842.

    • Search Google Scholar
    • Export Citation
  • AdamsTE Cumming S & Adams BM 1986 Gonadotropin-releasing hormone (GnRH) receptor dynamics and gonadotrope responsiveness during and after continuous GnRH stimulation. Biology of Reproduction35881–889.

    • Search Google Scholar
    • Export Citation
  • BadrM & Pelletier G 1987 Characterization and autoradiographic localization of LHRH receptors in the rat brain. Synapse1567–571.

  • BadrM Marchetti B & Pelletier G 1989 Changes in hippocampal LH-RH receptor density during maturation and aging in the rat. Brain Research. Developmental Brain Research45179–184.

    • Search Google Scholar
    • Export Citation
  • BagshaweKD Orr AH & Rushworth AG 1968 Relationship between concentrations of human chorionic gonadotrophin in plasma and cerebrospinal fluid. Nature217950–951.

    • Search Google Scholar
    • Export Citation
  • BajoAM Schally AV Halmos G & Nagy A 2003 Targeted doxorubicin-containing luteinizing hormone-releasing hormone analogue AN-152 inhibits the growth of doxorubicin-resistant MX-1 human breast cancers. Clinical Cancer Research93742–3748.

    • Search Google Scholar
    • Export Citation
  • BanE Crumeyrolle-Arias M Latouche J Leblanc P Heurtier JF Drieu K Fillion G & Haour F 1990 GnRH receptors in rat brain pituitary and testis; modulation following surgical and gonadotropin-releasing hormone agonist-induced castration. Molecular and Cellular Endocrinology7099–107.

    • Search Google Scholar
    • Export Citation
  • Ben-YehudahA & Lorberboum-Galski H 2004 Targeted cancer therapy with gonadotropin-releasing hormone chimeric proteins. Expert Review of Anticancer Therapy4151–161.

    • Search Google Scholar
    • Export Citation
  • BowenRL & Atwood CS 2004 Living and dying for sex. A theory of aging based on the modulation of cell cycle signaling by reproductive hormones. Gerontology50265–290.

    • Search Google Scholar
    • Export Citation
  • BowenRL Isley JP & Atkinson RL 2000 An association of elevated serum gonadotropin concentrations and Alzheimer disease? Journal of Neuroendocrinology12351–354.

    • Search Google Scholar
    • Export Citation
  • BowenRL Smith MA Harris PL Kubat Z Martins RN Castellani RJ Perry G & Atwood CS 2002 Elevated luteinizing hormone expression colocalizes with neurons vulnerable to Alzheimer’s disease pathology. Journal of Neuroscience Research70514–518.

    • Search Google Scholar
    • Export Citation
  • BowenRL Verdile G Liu T Parlow AF Perry G Smith MA Martins RN & Atwood CS 2004 Luteinizing hormone a reproductive regulator that modulates the processing of amyloid-beta precursor protein and amyloid-beta deposition. Journal of Biological Chemistry27920539–20545.

    • Search Google Scholar
    • Export Citation
  • CasadesusG Webber KM Atwood CS Pappolla MA Perry G Bowen RL & Smith MA 2006 Luteinizing hormone modulates cognition and amyloid-beta deposition in Alzheimer APP transgenic mice. Biochimica et Biophysica Acta1762447–452.

    • Search Google Scholar
    • Export Citation
  • ChengKW & Leung PC 2000 The expression regulation and signal transduction pathways of the mammalian gonadotropin-releasing hormone receptor. Canadian Journal of Physiology and Pharmacology781029–1052.

    • Search Google Scholar
    • Export Citation
  • ConnPM & Venter JC 1985 Radiation inactivation (target size analysis) of the gonadotropin-releasing hormone receptor: evidence for a high molecular weight complex. Endocrinology1161324–1326.

    • Search Google Scholar
    • Export Citation
  • CouzinetB & Schaison G 1993 The control of gonadotrophin secretion by ovarian steroids. Human Reproduction897–101.

  • Crumeyrolle-AriasM Latouche J Laniece P Charon Y Tricoire H Valentin L Roux P Mirambeau G Leblanc P Fillion G et al.1994 ‘In situ’ characterization of GnRH receptors: use of two radioimagers and comparison with quantitative autoradiography. Journal of Receptor Research14251–265.

    • Search Google Scholar
    • Export Citation
  • DrubinD Kobayashi S Kellogg D & Kirschner M 1988 Regulation of microtubule protein levels during cellular morphogenesis in nerve growth factor-treated PC12 cells. Journal of Cell Biology1061583–1591.

    • Search Google Scholar
    • Export Citation
  • DvorskaI Brust P Hrbas P Ruhle HJ Barth T & Ermisch A 1992 On the blood-brain barrier to peptides: effects of immobilization stress on regional blood supply and accumulation of labelled peptides in the rat brain. Endocrine Regulations2677–82.

    • Search Google Scholar
    • Export Citation
  • EmanueleN Anderson J Andersen E Connick E Baker G Kirsteins L & Lawrence A 1983 Extrahypothalamic brain luteinizing hormone: characterization by radioimmunoassay chromatography radioligand assay and bioassay. Neuroendocrinology36254–260.

    • Search Google Scholar
    • Export Citation
  • FauconnierJP Teuwissen B & Thomas K 1978 Rate of disappearance in plasma of synthetic LH-RH intravenously injected in man. Gynecologic and Obstetric Investigation9229–237.

    • Search Google Scholar
    • Export Citation
  • FeketeM Zalatnai A Comaru-Schally AM & Schally AV 1989 Membrane receptors for peptides in experimental and human pancreatic cancers. Pancreas4521–528.

    • Search Google Scholar
    • Export Citation
  • FriessH Buchler M Kiesel L Kruger M & Beger HG 1991 LH-RH receptors in the human pancreas. Basis for antihormonal treatment in ductal carcinoma of the pancreas. International Journal of Pancreatology10151–159.

    • Search Google Scholar
    • Export Citation
  • GharibSD Wierman ME Shupnik MA & Chin WW 1990 Molecular biology of the pituitary gonadotropins. Endocrine Reviews11177–199.

  • GillS Sharpless JL Rado K & Hall JE 2002 Evidence that GnRH decreases with gonadal steroid feedback but increases with age in postmenopausal women. Journal of Clinical Endocrinology and Metabolism872290–2296.

    • Search Google Scholar
    • Export Citation
  • GoreAC Windsor-Engnell BM & Terasawa E 2004 Menopausal increases in pulsatile gonadotropin-releasing hormone release in a nonhuman primate (Macaca mulatta). Endocrinology1454653–4659.

    • Search Google Scholar
    • Export Citation
  • GrangerA Ngo-Muller V Bleux C Guigon C Pincas H Magre S Daegelen D Tixier-Vidal A Counis R & Laverriere JN 2004 The promoter of the rat gonadotropin-releasing hormone receptor gene directs the expression of the human placental alkaline phosphatase reporter gene in gonadotrope cells in the anterior pituitary gland as well as in multiple extrapituitary tissues. Endocrinology145983–993.

    • Search Google Scholar
    • Export Citation
  • HallJE Lavoie HB Marsh EE & Martin KA 2000 Decrease in gonadotropin-releasing hormone (GnRH) pulse frequency with aging in postmenopausal women. Journal of Clinical Endocrinology and Metabolism851794–1800.

    • Search Google Scholar
    • Export Citation
  • HaourF Dussaillant M Leblanc P & Rostene W 1987 [Demonstration and topographical distribution of LHRH receptors in the central nervous system in the normal and castrated male rat]. Comptes Rendus de l’Academie des Sciences. Serie III Sciences de la vie30541–44.

    • Search Google Scholar
    • Export Citation
  • HarrisonGS Wierman ME Nett TM & Glode LM 2004 Gonadotropin-releasing hormone and its receptor in normal and malignant cells. Endocrine-Related Cancer11725–748.

    • Search Google Scholar
    • Export Citation
  • HazumE Schvartz I & Popliker M 1987 Production and characterization of antibodies to gonadotropin-releasing hormone receptor. Journal of Biological Chemistry262531–534.

    • Search Google Scholar
    • Export Citation
  • HerrupK Neve R Ackerman SL & Copani A 2004 Divide and die: cell cycle events as triggers of nerve cell death. Journal of Neuroscience249232–9239.

    • Search Google Scholar
    • Export Citation
  • HogervorstE Williams J Budge M Barnetson L Combrinck M & Smith AD 2001 Serum total testosterone is lower in men with Alzheimer’s disease. Neuroendocrinology Letters22163–168.

    • Search Google Scholar
    • Export Citation
  • HostetterG Gallo R & Brownfield M 1981 Presence of immunoreactive luteinizing hormone in the rat forebrain. Neuroendocrinology33241–245.

    • Search Google Scholar
    • Export Citation
  • IlesRK & Chard T 1991 Human chorionic gonadotropin expression by bladder cancers: biology and clinical potential. Journal of Urology145453–458.

    • Search Google Scholar
    • Export Citation
  • JennesL Dalati B & Conn PM 1988 Distribution of gonadrotropin releasing hormone agonist binding sites in the rat central nervous system. Brain Research452156–164.

    • Search Google Scholar
    • Export Citation
  • JennesL Brame B Centers A Janovick JA & Conn PM 1995 Regulation of hippocampal gonadotropin releasing hormone (GnRH) receptor mRNA and GnRH-stimulated inositol phosphate production by gonadal steroid hormones. Brain Research. Molecular Brain Research33104–110.

    • Search Google Scholar
    • Export Citation
  • JennesL McShane T Brame B & Centers A 1996 Dynamic changes in gonadotropin releasing hormone receptor mRNA content in the mediobasal hypothalamus during the rat estrous cycle. Journal of Neuroendocrinology8275–281.

    • Search Google Scholar
    • Export Citation
  • JennesL Eyigor O Janovick JA & Conn PM 1997 Brain gonadotropin releasing hormone receptors: localization and regulation. Recent Progress in Hormone Research52475–490 (discussion 490–471).

    • Search Google Scholar
    • Export Citation
  • KakarSS & Jennes L 1995 Expression of gonadotropin-releasing hormone and gonadotropin-releasing hormone receptor mRNAs in various non-reproductive human tissues. Cancer Letters9857–62.

    • Search Google Scholar
    • Export Citation
  • KarandeAA Rajeshwari K Schol DJ & Hilgers JH 1995 Establishment of immunological probes to study human gonadotropin-releasing hormone receptors. Molecular and Cellular Endocrinology11451–56.

    • Search Google Scholar
    • Export Citation
  • KellerG Schally AV Gaiser T Nagy A Baker B Halmos G & Engel JB 2005a Receptors for luteinizing hormone releasing hormone expressed on human renal cell carcinomas can be used for targeted chemotherapy with cytotoxic luteinizing hormone releasing hormone analogues. Clinical Cancer Research115549–5557.

    • Search Google Scholar
    • Export Citation
  • KellerG Schally AV Gaiser T Nagy A Baker B Westphal G Halmos G & Engel JB 2005b Human malignant melanomas express receptors for luteinizing hormone releasing hormone allowing targeted therapy with cytotoxic luteinizing hormone releasing hormone analogue. Cancer Research655857–5863.

    • Search Google Scholar
    • Export Citation
  • KhachaturianZS1985 Diagnosis of Alzheimer’s disease. Archives of Neurology421097–1105.

  • KimKH Patel L Tobet SA King JC Rubin BS & Stopa EG 1999 Gonadotropin-releasing hormone immunoreactivity in the adult and fetal human olfactory system. Brain Research826220–229.

    • Search Google Scholar
    • Export Citation
  • KrebsLJ Wang X Nagy A Schally AV Prasad PN & Liebow C 2002 A conjugate of doxorubicin and an analog of luteinizing hormone-releasing hormone shows increased efficacy against oral and laryngeal cancers. Oral Oncology38657–663.

    • Search Google Scholar
    • Export Citation
  • KrichevskyA Campbell-Acevedo EA Tong JY & Acevedo HF 1995 Immunological detection of membrane-associated human luteinizing hormone correlates with gene expression in cultured human cancer and fetal cells. Endocrinology1361034–1039.

    • Search Google Scholar
    • Export Citation
  • KurowskaE & Szewczuk A 1999 Isolation of human lutropin from woman urine and comparison of its properties with pituitary hormone. Archivum Immunologiae et Therapiae Experimentalis (Warsz)47179–183.

    • Search Google Scholar
    • Export Citation
  • LaPlanteB Powers C Gault J Reynolds B & Gregory C 2006 Stabilization of cognitive decline in Alzheimer’s disease following treatment with leuprolide acetate. In 10th International Conference on Alzheimer’s Disease and Related Disorders Program No. P4 353.

  • LarsenHP Thorup J Skovgaard LT Cortes D & Byskov AG 2002 Long-term cultures of testicular biopsies from boys with cryptorchidism: effect of FSH and LH on the number of germ cells. Human Reproduction17383–389.

    • Search Google Scholar
    • Export Citation
  • LeblancP Crumeyrolle M Latouche J Jordan D Fillion G L’Heritier A Kordon C Dussaillant M Rostene W & Haour F 1988 Characterization and distribution of receptors for gonadotropin-releasing hormone in the rat hippocampus. Neuroendocrinology48482–488.

    • Search Google Scholar
    • Export Citation
  • LeeYW Song J Park D Kang HL Kang J & Lee SE 2004 Expression of luteinizing hormone in the rat brain. Society for Neuroscience Program 756.716.

    • Search Google Scholar
    • Export Citation
  • LiuT Wimalasena J Bowen R & Atwood C 2006 Luteinizing hormone receptor mediates neuronal pregnenolone production via upregulation of steroidogenic acute regulatory protein expression. Journal of Neurochemistry In Press.

    • Search Google Scholar
    • Export Citation
  • LuF Yang JM Wu JN Chen YC Kao YH Tung CS & Yang SN 1999 Activation of gonadotropin-releasing hormone receptors produces neuronal excitation in the rat hippocampus. Chinese Journal of Physiology4267–71.

    • Search Google Scholar
    • Export Citation
  • McPhieDL Coopersmith R Hines-Peralta A Chen Y Ivins KJ Manly SP Kozlowski MR Neve KA & Neve RL 2003 DNA synthesis and neuronal apoptosis caused by familial Alzheimer disease mutants of the amyloid precursor protein are mediated by the p21 activated kinase PAK3. Journal of Neuroscience236914–6927.

    • Search Google Scholar
    • Export Citation
  • MirraSS Heyman A McKeel D Sumi SM Crain BJ Brownlee LM Vogel FS Hughes JP van Belle G & Berg L 1991 The consortium to establish a registry for Alzheimer’s disease (CERAD). Part II. Standardization of the neuropathologic assessment of Alzheimer’s disease. Neurology41479–486.

    • Search Google Scholar
    • Export Citation
  • MorettiRM Montagnani Marelli M Van Groeninghen JC & Limonta P 2002 Locally expressed LHRH receptors mediate the oncostatic and antimetastatic activity of LHRH agonists on melanoma cells. Journal of Clinical Endocrinology and Metabolism873791–3797.

    • Search Google Scholar
    • Export Citation
  • NureddinA & Johnson P 1977 Ultracentrifugal studies of human luteinizing hormone and its subunits: dependence on protein concentration and ionic strength. Biochemistry161730–1737.

    • Search Google Scholar
    • Export Citation
  • ParkPS Filipek S Wells JW & Palczewski K 2004 Oligomerization of G protein-coupled receptors: past present and future. Biochemistry4315643–15656.

    • Search Google Scholar
    • Export Citation
  • ParlowAF2004 National Hormone and Peptide Program (NHPP): new recombinant hormones hypothalamic peptides natural hormones new antisera and expanded hormone assay services available. Journal of Clinical Endocrinology and Metabolism893618–3620.

    • Search Google Scholar
    • Export Citation
  • PatiD & Habibi HR 1995 Inhibition of human hepatocarcinoma cell proliferation by mammalian and fish gonadotropin-releasing hormones. Endocrinology13675–84.

    • Search Google Scholar
    • Export Citation
  • PierpaoliW & Lesnikov V 1997 Theoretical considerations on the nature of the pineal ‘ageing clock’. Gerontology4320–25.

  • QuanbeckC Sherwood NM Millar RP & Terasawa E 1997 Two populations of luteinizing hormone-releasing hormone neurons in the forebrain of the rhesus macaque during embryonic development. Journal of Comparative Neurology380293–309.

    • Search Google Scholar
    • Export Citation
  • RainaAK Zhu X Rottkamp CA Monteiro M Takeda A & Smith MA 2000 Cyclin’ toward dementia: cell cycle abnormalities and abortive oncogenesis in Alzheimer disease. Journal of Neuroscience Research61128–133.

    • Search Google Scholar
    • Export Citation
  • ReddingTW Kastin AJ Gonzales-Barcena D Coy DH Coy EJ Schalch DS & Schally AV 1973 The half-life metabolism and excretion of tritiated luteinizing hormone-releasing hormone (LH-RH) in man. Journal of Clinical Endocrinology and Metabolism37626–631.

    • Search Google Scholar
    • Export Citation
  • ReedKL MacIntyre JK Tobet SA Trudeau VL MacEachern L Rubin BS & Sower SA 2002 The spatial relationship of gamma-aminobutyric acid (GABA) neurons and gonadotropin-releasing hormone (GnRH) neurons in larval and adult sea lamprey Petromyzon marinus. Brain Behavior and Evolution601–12.

    • Search Google Scholar
    • Export Citation
  • ReubiJC & Maurer R 1984 Visualization of LHRH receptors in the rat brain. European Journal of Pharmacology106453–454.

  • ReubiJC Palacios JM & Maurer R 1987 Specific luteinizing-hormone-releasing hormone receptor binding sites in hippocampus and pituitary: an autoradiographical study. Neuroscience21847–856.

    • Search Google Scholar
    • Export Citation
  • RomanelliRG Barni T Maggi M Luconi M Failli P Pezzatini A Pelo E Torricelli F Crescioli C Ferruzzi P et al.2004 Expression and function of gonadotropin-releasing hormone (GnRH) receptor in human olfactory GnRH-secreting neurons: an autocrine GnRH loop underlies neuronal migration. Journal of Biological Chemistry279117–126.

    • Search Google Scholar
    • Export Citation
  • RosenSW Weintraub BD & Aaronson SA 1980 Nonrandom ectopic protein production by malignant cells: direct evidence in vitro. Journal of Clinical Endocrinology and Metabolism50834–841.

    • Search Google Scholar
    • Export Citation
  • ShortRA Bowen RL O’Brien PC & Graff-Radford NR 2001 Elevated gonadotropin levels in patients with Alzheimer disease. Mayo Clinic Proceedings76906–909.

    • Search Google Scholar
    • Export Citation
  • StantonPG Pozvek G Burgon PG Robertson DM & Hearn MT 1993 Isolation and characterization of human LH isoforms. Journal of Endocrinology138529–543.

    • Search Google Scholar
    • Export Citation
  • StenmanUH Alfthan H & Hotakainen K 2004 Human chorionic gonadotropin in cancer. Clinical Biochemistry37549–561.

  • StojilkovicSS & Catt KJ 1995 Expression and signal transduction pathways of gonadotropin-releasing hormone receptors. Recent Progress in Hormone Research50161–205.

    • Search Google Scholar
    • Export Citation
  • ThompsonTL & Moss RL 1992 Specific binding of 125I-LHRH agonist to hippocampal membranes: fluctuations during the estrous cycle. Peptides13891–896.

    • Search Google Scholar
    • Export Citation
  • TobetSA Hanna IK & Schwarting GA 1996 Migration of neurons containing gonadotropin releasing hormone (GnRH) in slices from embryonic nasal compartment and forebrain. Brain Research. Developmental Brain Research97287–292.

    • Search Google Scholar
    • Export Citation
  • TothP Lukacs H Gimes G Sebestyen A Pasztor N Paulin F & Rao CV 2001 Clinical importance of vascular LH/hCG receptors – a review. Reproductive Biology15–11.

    • Search Google Scholar
    • Export Citation
  • Vadakkadath MeethalS & Atwood CS 2005 The role of hypothalamic–pituitary–gonadal hormones in the normal structure and functioning of the brain. Cellular and Molecular Life Sciences62257–270.

    • Search Google Scholar
    • Export Citation
  • van GroeninghenJC Kiesel L Winkler D & Zwirner M 1998 Effects of luteinising-hormone-releasing hormone on nervous-system tumours. Lancet352372–373.

    • Search Google Scholar
    • Export Citation
  • WhitfieldGK & Kourides IA 1985 Expression of chorionic gonadotropin alpha- and beta-genes in normal and neoplastic human tissues: relationship to deoxyribonucleic acid structure. Endocrinology117231–236.

    • Search Google Scholar
    • Export Citation
  • WollerMJ Everson-Binotto G Nichols E Acheson A Keen KL Bowers CY & Terasawa E 2002 Aging-related changes in release of growth hormone and luteinizing hormone in female rhesus monkeys. Journal of Clinical Endocrinology and Metabolism875160–5167.

    • Search Google Scholar
    • Export Citation
  • WormaldPJ Eidne KA & Millar RP 1985 Gonadotropin-releasing hormone receptors in human pituitary: ligand structural requirements molecular size and cationic effects. Journal of Clinical Endocrinology and Metabolism611190–1194.

    • Search Google Scholar
    • Export Citation
  • YokotaniT Koizumi T Taniguchi R Nakagawa T Isobe T Yoshimura M Tsubota N Hasegawa K Ohsawa N Baba S et al.1997 Expression of alpha and beta genes of human chorionic gonadotropin in lung cancer. International Journal of Cancer71539–544.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.


      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 638 275 18
PDF Downloads 437 115 6
  • View in gallery

    Immunolabeling of GnRHR I in the human hippocampus and pituitary. Human hippocampal and pituitary tissue (positive control) were immunolabeled with the GnRHR I monoclonal antibody, F1G4. Upper panels illustrate GnRHR I immunolabeling throughout the hippocampus and pituitary (objective magnification 2×). Lower panels illustrate labeling of hippocampal pyramidal neurons and pituitary gonadotropes (objective magnification of 10×).

  • View in gallery

    Immunolocalization of GnRHR I in human control and AD hippocampal and cortical neurons. Immunolabeling of control hippocampus (upper left) and neocortex (upper right) with the GnRHR I monoclonal antibody F1G4 demonstrates GnRHR I localization to the cell body and apical dendrites (case #24). Immunolabeling of AD hippocampus (lower left) and neocortex (lower right) demonstrates GnRHR I localization predominantly to the cell body (case #1). Insets are representative neurons from the 10× pictures, taken at 40× objective magnification to illustrate membrane labeling.

  • View in gallery

    GnRHR I expression in the cortex of age-matched control and AD subjects. (a) GnRHR I expression was examined in homogenized age-matched AD and control cortical tissue by immunoblot analysis using the GnRHR I monoclonal antibody, F1G4. The blot was reprobed for tissue (GAPDH) and neuron-specific (NSE) loading controls. (b) Quantification of the three prominent GnRHR I variants revealed significant decreases in the 30 and 136 kDa in AD compared with age-matched control tissue when normalized to the GAPDH loading control (mean±s.d., n=6–7, *P<0.01). A significant decrease was maintained only for the approximately 136 kDa receptor complex in AD tissue after normalization against the NSE loading control (mean±s.d., n=6–7, *P<0.01). (c) Immunoblot analysis of pituitary and representative control and AD cortex revealed similar GnRHR I variants. Molecular weight markers are illustrated on the left of figures.

  • View in gallery

    GnRHR I expression in the cortex of age-matched control and AD subjects. (a) The immunoblot in (Fig. 3a) was reprobed with a polyclonal antibody against the C-terminus of GnRHR I (C-18). One distinct band at approximately 64 kDa, representative of the functional GnRHR I variant, was detected. (b) The samples in (Fig. 3c) were immunoprobed with the polyclonal antibody against the C-terminus of GnRHR I (C-18). A single approximately 64 kDa band is present in both pituitary and brain. Molecular weight markers are illustrated on the left of figures.

  • View in gallery

    LH expression on neuronal cell types and its modulation by GnRH. (a) Human M17 neuroblastoma cells cultured in defined, serum-free media were treated with increasing concentrations of GnRH I (0–10 μM) for 6 h and then collected for immunoblot analysis of LH expression using the polyclonal anti-human β-LH antibody. (b) Relative intensities of the 30, 47, and 60 kDa bands were normalized to the loading control, GAPDH. Data are representative of three experiments. (c) LHβ cDNA was detected in human M17 neuroblastoma cells. (d) Human SH-SY5Y neuroblastoma cells express similar LH variants as described above for M17 cells. (e) Primary cortical neurons from embryonic day 18 rats cultured in serum-free conditions demonstrate increased LH (30 kDa) expression with differentiation. Molecular weight markers are illustrated on the left of figures.

  • View in gallery

    GnRHR I expression on neuronal cell types and its modulation by GnRH. (a) The immunoblot from Fig. 4a was stripped and reprobed with the F1G4 monoclonal GnRH I receptor antibody. Three major GnRHR I variants were detected: approximately, 30, 37, and 136 kDa. (b) Relative intensities of GnRH I receptor variants were normalized to GAPDH. Decreases in the levels of the approximately 30 and 136 kDa GnRHR I variants were observed with increasing GnRH I concentrations. The data are representative of three experiments. (c) GnRHR I cDNA was detected in human M17 neuroblastoma cells. (d) The immunoblot from Fig. 5e was stripped and reprobed with the F1G4 monoclonal GnRH I receptor antibody. The expression of approximately 30, 37, and 136 kDa GnRHR I variants increased with neuron differentiation. Equal protein was loaded at each time point. Molecular weight markers are illustrated on the left of figures.

  • AcevedoHF Krichevsky A Campbell-Acevedo EA Galyon JC Buffo MJ & Hartsock RJ 1992 Expression of membrane-associated human chorionic gonadotropin its subunits and fragments by cultured human cancer cells. Cancer691829–1842.

    • Search Google Scholar
    • Export Citation
  • AdamsTE Cumming S & Adams BM 1986 Gonadotropin-releasing hormone (GnRH) receptor dynamics and gonadotrope responsiveness during and after continuous GnRH stimulation. Biology of Reproduction35881–889.

    • Search Google Scholar
    • Export Citation
  • BadrM & Pelletier G 1987 Characterization and autoradiographic localization of LHRH receptors in the rat brain. Synapse1567–571.

  • BadrM Marchetti B & Pelletier G 1989 Changes in hippocampal LH-RH receptor density during maturation and aging in the rat. Brain Research. Developmental Brain Research45179–184.

    • Search Google Scholar
    • Export Citation
  • BagshaweKD Orr AH & Rushworth AG 1968 Relationship between concentrations of human chorionic gonadotrophin in plasma and cerebrospinal fluid. Nature217950–951.

    • Search Google Scholar
    • Export Citation
  • BajoAM Schally AV Halmos G & Nagy A 2003 Targeted doxorubicin-containing luteinizing hormone-releasing hormone analogue AN-152 inhibits the growth of doxorubicin-resistant MX-1 human breast cancers. Clinical Cancer Research93742–3748.

    • Search Google Scholar
    • Export Citation
  • BanE Crumeyrolle-Arias M Latouche J Leblanc P Heurtier JF Drieu K Fillion G & Haour F 1990 GnRH receptors in rat brain pituitary and testis; modulation following surgical and gonadotropin-releasing hormone agonist-induced castration. Molecular and Cellular Endocrinology7099–107.

    • Search Google Scholar
    • Export Citation
  • Ben-YehudahA & Lorberboum-Galski H 2004 Targeted cancer therapy with gonadotropin-releasing hormone chimeric proteins. Expert Review of Anticancer Therapy4151–161.

    • Search Google Scholar
    • Export Citation
  • BowenRL & Atwood CS 2004 Living and dying for sex. A theory of aging based on the modulation of cell cycle signaling by reproductive hormones. Gerontology50265–290.

    • Search Google Scholar
    • Export Citation
  • BowenRL Isley JP & Atkinson RL 2000 An association of elevated serum gonadotropin concentrations and Alzheimer disease? Journal of Neuroendocrinology12351–354.

    • Search Google Scholar
    • Export Citation
  • BowenRL Smith MA Harris PL Kubat Z Martins RN Castellani RJ Perry G & Atwood CS 2002 Elevated luteinizing hormone expression colocalizes with neurons vulnerable to Alzheimer’s disease pathology. Journal of Neuroscience Research70514–518.

    • Search Google Scholar
    • Export Citation
  • BowenRL Verdile G Liu T Parlow AF Perry G Smith MA Martins RN & Atwood CS 2004 Luteinizing hormone a reproductive regulator that modulates the processing of amyloid-beta precursor protein and amyloid-beta deposition. Journal of Biological Chemistry27920539–20545.

    • Search Google Scholar
    • Export Citation
  • CasadesusG Webber KM Atwood CS Pappolla MA Perry G Bowen RL & Smith MA 2006 Luteinizing hormone modulates cognition and amyloid-beta deposition in Alzheimer APP transgenic mice. Biochimica et Biophysica Acta1762447–452.

    • Search Google Scholar
    • Export Citation
  • ChengKW & Leung PC 2000 The expression regulation and signal transduction pathways of the mammalian gonadotropin-releasing hormone receptor. Canadian Journal of Physiology and Pharmacology781029–1052.

    • Search Google Scholar
    • Export Citation
  • ConnPM & Venter JC 1985 Radiation inactivation (target size analysis) of the gonadotropin-releasing hormone receptor: evidence for a high molecular weight complex. Endocrinology1161324–1326.

    • Search Google Scholar
    • Export Citation
  • CouzinetB & Schaison G 1993 The control of gonadotrophin secretion by ovarian steroids. Human Reproduction897–101.

  • Crumeyrolle-AriasM Latouche J Laniece P Charon Y Tricoire H Valentin L Roux P Mirambeau G Leblanc P Fillion G et al.1994 ‘In situ’ characterization of GnRH receptors: use of two radioimagers and comparison with quantitative autoradiography. Journal of Receptor Research14251–265.

    • Search Google Scholar
    • Export Citation
  • DrubinD Kobayashi S Kellogg D & Kirschner M 1988 Regulation of microtubule protein levels during cellular morphogenesis in nerve growth factor-treated PC12 cells. Journal of Cell Biology1061583–1591.

    • Search Google Scholar
    • Export Citation
  • DvorskaI Brust P Hrbas P Ruhle HJ Barth T & Ermisch A 1992 On the blood-brain barrier to peptides: effects of immobilization stress on regional blood supply and accumulation of labelled peptides in the rat brain. Endocrine Regulations2677–82.

    • Search Google Scholar
    • Export Citation
  • EmanueleN Anderson J Andersen E Connick E Baker G Kirsteins L & Lawrence A 1983 Extrahypothalamic brain luteinizing hormone: characterization by radioimmunoassay chromatography radioligand assay and bioassay. Neuroendocrinology36254–260.

    • Search Google Scholar
    • Export Citation
  • FauconnierJP Teuwissen B & Thomas K 1978 Rate of disappearance in plasma of synthetic LH-RH intravenously injected in man. Gynecologic and Obstetric Investigation9229–237.

    • Search Google Scholar
    • Export Citation
  • FeketeM Zalatnai A Comaru-Schally AM & Schally AV 1989 Membrane receptors for peptides in experimental and human pancreatic cancers. Pancreas4521–528.

    • Search Google Scholar
    • Export Citation
  • FriessH Buchler M Kiesel L Kruger M & Beger HG 1991 LH-RH receptors in the human pancreas. Basis for antihormonal treatment in ductal carcinoma of the pancreas. International Journal of Pancreatology10151–159.

    • Search Google Scholar
    • Export Citation
  • GharibSD Wierman ME Shupnik MA & Chin WW 1990 Molecular biology of the pituitary gonadotropins. Endocrine Reviews11177–199.

  • GillS Sharpless JL Rado K & Hall JE 2002 Evidence that GnRH decreases with gonadal steroid feedback but increases with age in postmenopausal women. Journal of Clinical Endocrinology and Metabolism872290–2296.

    • Search Google Scholar
    • Export Citation
  • GoreAC Windsor-Engnell BM & Terasawa E 2004 Menopausal increases in pulsatile gonadotropin-releasing hormone release in a nonhuman primate (Macaca mulatta). Endocrinology1454653–4659.

    • Search Google Scholar
    • Export Citation
  • GrangerA Ngo-Muller V Bleux C Guigon C Pincas H Magre S Daegelen D Tixier-Vidal A Counis R & Laverriere JN 2004 The promoter of the rat gonadotropin-releasing hormone receptor gene directs the expression of the human placental alkaline phosphatase reporter gene in gonadotrope cells in the anterior pituitary gland as well as in multiple extrapituitary tissues. Endocrinology145983–993.

    • Search Google Scholar
    • Export Citation
  • HallJE Lavoie HB Marsh EE & Martin KA 2000 Decrease in gonadotropin-releasing hormone (GnRH) pulse frequency with aging in postmenopausal women. Journal of Clinical Endocrinology and Metabolism851794–1800.

    • Search Google Scholar
    • Export Citation
  • HaourF Dussaillant M Leblanc P & Rostene W 1987 [Demonstration and topographical distribution of LHRH receptors in the central nervous system in the normal and castrated male rat]. Comptes Rendus de l’Academie des Sciences. Serie III Sciences de la vie30541–44.

    • Search Google Scholar
    • Export Citation
  • HarrisonGS Wierman ME Nett TM & Glode LM 2004 Gonadotropin-releasing hormone and its receptor in normal and malignant cells. Endocrine-Related Cancer11725–748.

    • Search Google Scholar
    • Export Citation
  • HazumE Schvartz I & Popliker M 1987 Production and characterization of antibodies to gonadotropin-releasing hormone receptor. Journal of Biological Chemistry262531–534.

    • Search Google Scholar
    • Export Citation
  • HerrupK Neve R Ackerman SL & Copani A 2004 Divide and die: cell cycle events as triggers of nerve cell death. Journal of Neuroscience249232–9239.

    • Search Google Scholar
    • Export Citation
  • HogervorstE Williams J Budge M Barnetson L Combrinck M & Smith AD 2001 Serum total testosterone is lower in men with Alzheimer’s disease. Neuroendocrinology Letters22163–168.

    • Search Google Scholar
    • Export Citation
  • HostetterG Gallo R & Brownfield M 1981 Presence of immunoreactive luteinizing hormone in the rat forebrain. Neuroendocrinology33241–245.

    • Search Google Scholar
    • Export Citation
  • IlesRK & Chard T 1991 Human chorionic gonadotropin expression by bladder cancers: biology and clinical potential. Journal of Urology145453–458.

    • Search Google Scholar
    • Export Citation
  • JennesL Dalati B & Conn PM 1988 Distribution of gonadrotropin releasing hormone agonist binding sites in the rat central nervous system. Brain Research452156–164.

    • Search Google Scholar
    • Export Citation
  • JennesL Brame B Centers A Janovick JA & Conn PM 1995 Regulation of hippocampal gonadotropin releasing hormone (GnRH) receptor mRNA and GnRH-stimulated inositol phosphate production by gonadal steroid hormones. Brain Research. Molecular Brain Research33104–110.

    • Search Google Scholar
    • Export Citation
  • JennesL McShane T Brame B & Centers A 1996 Dynamic changes in gonadotropin releasing hormone receptor mRNA content in the mediobasal hypothalamus during the rat estrous cycle. Journal of Neuroendocrinology8275–281.

    • Search Google Scholar
    • Export Citation
  • JennesL Eyigor O Janovick JA & Conn PM 1997 Brain gonadotropin releasing hormone receptors: localization and regulation. Recent Progress in Hormone Research52475–490 (discussion 490–471).

    • Search Google Scholar
    • Export Citation
  • KakarSS & Jennes L 1995 Expression of gonadotropin-releasing hormone and gonadotropin-releasing hormone receptor mRNAs in various non-reproductive human tissues. Cancer Letters9857–62.

    • Search Google Scholar
    • Export Citation
  • KarandeAA Rajeshwari K Schol DJ & Hilgers JH 1995 Establishment of immunological probes to study human gonadotropin-releasing hormone receptors. Molecular and Cellular Endocrinology11451–56.

    • Search Google Scholar
    • Export Citation
  • KellerG Schally AV Gaiser T Nagy A Baker B Halmos G & Engel JB 2005a Receptors for luteinizing hormone releasing hormone expressed on human renal cell carcinomas can be used for targeted chemotherapy with cytotoxic luteinizing hormone releasing hormone analogues. Clinical Cancer Research115549–5557.

    • Search Google Scholar
    • Export Citation
  • KellerG Schally AV Gaiser T Nagy A Baker B Westphal G Halmos G & Engel JB 2005b Human malignant melanomas express receptors for luteinizing hormone releasing hormone allowing targeted therapy with cytotoxic luteinizing hormone releasing hormone analogue. Cancer Research655857–5863.

    • Search Google Scholar
    • Export Citation
  • KhachaturianZS1985 Diagnosis of Alzheimer’s disease. Archives of Neurology421097–1105.

  • KimKH Patel L Tobet SA King JC Rubin BS & Stopa EG 1999 Gonadotropin-releasing hormone immunoreactivity in the adult and fetal human olfactory system. Brain Research826220–229.

    • Search Google Scholar
    • Export Citation
  • KrebsLJ Wang X Nagy A Schally AV Prasad PN & Liebow C 2002 A conjugate of doxorubicin and an analog of luteinizing hormone-releasing hormone shows increased efficacy against oral and laryngeal cancers. Oral Oncology38657–663.

    • Search Google Scholar
    • Export Citation
  • KrichevskyA Campbell-Acevedo EA Tong JY & Acevedo HF 1995 Immunological detection of membrane-associated human luteinizing hormone correlates with gene expression in cultured human cancer and fetal cells. Endocrinology1361034–1039.

    • Search Google Scholar
    • Export Citation
  • KurowskaE & Szewczuk A 1999 Isolation of human lutropin from woman urine and comparison of its properties with pituitary hormone. Archivum Immunologiae et Therapiae Experimentalis (Warsz)47179–183.

    • Search Google Scholar
    • Export Citation
  • LaPlanteB Powers C Gault J Reynolds B & Gregory C 2006 Stabilization of cognitive decline in Alzheimer’s disease following treatment with leuprolide acetate. In 10th International Conference on Alzheimer’s Disease and Related Disorders Program No. P4 353.

  • LarsenHP Thorup J Skovgaard LT Cortes D & Byskov AG 2002 Long-term cultures of testicular biopsies from boys with cryptorchidism: effect of FSH and LH on the number of germ cells. Human Reproduction17383–389.

    • Search Google Scholar
    • Export Citation
  • LeblancP Crumeyrolle M Latouche J Jordan D Fillion G L’Heritier A Kordon C Dussaillant M Rostene W & Haour F 1988 Characterization and distribution of receptors for gonadotropin-releasing hormone in the rat hippocampus. Neuroendocrinology48482–488.

    • Search Google Scholar
    • Export Citation
  • LeeYW Song J Park D Kang HL Kang J & Lee SE 2004 Expression of luteinizing hormone in the rat brain. Society for Neuroscience Program 756.716.

    • Search Google Scholar
    • Export Citation
  • LiuT Wimalasena J Bowen R & Atwood C 2006 Luteinizing hormone receptor mediates neuronal pregnenolone production via upregulation of steroidogenic acute regulatory protein expression. Journal of Neurochemistry In Press.

    • Search Google Scholar
    • Export Citation
  • LuF Yang JM Wu JN Chen YC Kao YH Tung CS & Yang SN 1999 Activation of gonadotropin-releasing hormone receptors produces neuronal excitation in the rat hippocampus. Chinese Journal of Physiology4267–71.

    • Search Google Scholar
    • Export Citation
  • McPhieDL Coopersmith R Hines-Peralta A Chen Y Ivins KJ Manly SP Kozlowski MR Neve KA & Neve RL 2003 DNA synthesis and neuronal apoptosis caused by familial Alzheimer disease mutants of the amyloid precursor protein are mediated by the p21 activated kinase PAK3. Journal of Neuroscience236914–6927.

    • Search Google Scholar
    • Export Citation
  • MirraSS Heyman A McKeel D Sumi SM Crain BJ Brownlee LM Vogel FS Hughes JP van Belle G & Berg L 1991 The consortium to establish a registry for Alzheimer’s disease (CERAD). Part II. Standardization of the neuropathologic assessment of Alzheimer’s disease. Neurology41479–486.

    • Search Google Scholar
    • Export Citation
  • MorettiRM Montagnani Marelli M Van Groeninghen JC & Limonta P 2002 Locally expressed LHRH receptors mediate the oncostatic and antimetastatic activity of LHRH agonists on melanoma cells. Journal of Clinical Endocrinology and Metabolism873791–3797.

    • Search Google Scholar
    • Export Citation
  • NureddinA & Johnson P 1977 Ultracentrifugal studies of human luteinizing hormone and its subunits: dependence on protein concentration and ionic strength. Biochemistry161730–1737.

    • Search Google Scholar
    • Export Citation
  • ParkPS Filipek S Wells JW & Palczewski K 2004 Oligomerization of G protein-coupled receptors: past present and future. Biochemistry4315643–15656.

    • Search Google Scholar
    • Export Citation
  • ParlowAF2004 National Hormone and Peptide Program (NHPP): new recombinant hormones hypothalamic peptides natural hormones new antisera and expanded hormone assay services available. Journal of Clinical Endocrinology and Metabolism893618–3620.

    • Search Google Scholar
    • Export Citation
  • PatiD & Habibi HR 1995 Inhibition of human hepatocarcinoma cell proliferation by mammalian and fish gonadotropin-releasing hormones. Endocrinology13675–84.

    • Search Google Scholar
    • Export Citation
  • PierpaoliW & Lesnikov V 1997 Theoretical considerations on the nature of the pineal ‘ageing clock’. Gerontology4320–25.

  • QuanbeckC Sherwood NM Millar RP & Terasawa E 1997 Two populations of luteinizing hormone-releasing hormone neurons in the forebrain of the rhesus macaque during embryonic development. Journal of Comparative Neurology380293–309.

    • Search Google Scholar
    • Export Citation
  • RainaAK Zhu X Rottkamp CA Monteiro M Takeda A & Smith MA 2000 Cyclin’ toward dementia: cell cycle abnormalities and abortive oncogenesis in Alzheimer disease. Journal of Neuroscience Research61128–133.

    • Search Google Scholar
    • Export Citation
  • ReddingTW Kastin AJ Gonzales-Barcena D Coy DH Coy EJ Schalch DS & Schally AV 1973 The half-life metabolism and excretion of tritiated luteinizing hormone-releasing hormone (LH-RH) in man. Journal of Clinical Endocrinology and Metabolism37626–631.

    • Search Google Scholar
    • Export Citation
  • ReedKL MacIntyre JK Tobet SA Trudeau VL MacEachern L Rubin BS & Sower SA 2002 The spatial relationship of gamma-aminobutyric acid (GABA) neurons and gonadotropin-releasing hormone (GnRH) neurons in larval and adult sea lamprey Petromyzon marinus. Brain Behavior and Evolution601–12.

    • Search Google Scholar
    • Export Citation
  • ReubiJC & Maurer R 1984 Visualization of LHRH receptors in the rat brain. European Journal of Pharmacology106453–454.

  • ReubiJC Palacios JM & Maurer R 1987 Specific luteinizing-hormone-releasing hormone receptor binding sites in hippocampus and pituitary: an autoradiographical study. Neuroscience21847–856.

    • Search Google Scholar
    • Export Citation
  • RomanelliRG Barni T Maggi M Luconi M Failli P Pezzatini A Pelo E Torricelli F Crescioli C Ferruzzi P et al.2004 Expression and function of gonadotropin-releasing hormone (GnRH) receptor in human olfactory GnRH-secreting neurons: an autocrine GnRH loop underlies neuronal migration. Journal of Biological Chemistry279117–126.

    • Search Google Scholar
    • Export Citation
  • RosenSW Weintraub BD & Aaronson SA 1980 Nonrandom ectopic protein production by malignant cells: direct evidence in vitro. Journal of Clinical Endocrinology and Metabolism50834–841.

    • Search Google Scholar
    • Export Citation
  • ShortRA Bowen RL O’Brien PC & Graff-Radford NR 2001 Elevated gonadotropin levels in patients with Alzheimer disease. Mayo Clinic Proceedings76906–909.

    • Search Google Scholar
    • Export Citation
  • StantonPG Pozvek G Burgon PG Robertson DM & Hearn MT 1993 Isolation and characterization of human LH isoforms. Journal of Endocrinology138529–543.

    • Search Google Scholar
    • Export Citation
  • StenmanUH Alfthan H & Hotakainen K 2004 Human chorionic gonadotropin in cancer. Clinical Biochemistry37549–561.

  • StojilkovicSS & Catt KJ 1995 Expression and signal transduction pathways of gonadotropin-releasing hormone receptors. Recent Progress in Hormone Research50161–205.

    • Search Google Scholar
    • Export Citation
  • ThompsonTL & Moss RL 1992 Specific binding of 125I-LHRH agonist to hippocampal membranes: fluctuations during the estrous cycle. Peptides13891–896.

    • Search Google Scholar
    • Export Citation
  • TobetSA Hanna IK & Schwarting GA 1996 Migration of neurons containing gonadotropin releasing hormone (GnRH) in slices from embryonic nasal compartment and forebrain. Brain Research. Developmental Brain Research97287–292.

    • Search Google Scholar
    • Export Citation
  • TothP Lukacs H Gimes G Sebestyen A Pasztor N Paulin F & Rao CV 2001 Clinical importance of vascular LH/hCG receptors – a review. Reproductive Biology15–11.

    • Search Google Scholar
    • Export Citation
  • Vadakkadath MeethalS & Atwood CS 2005 The role of hypothalamic–pituitary–gonadal hormones in the normal structure and functioning of the brain. Cellular and Molecular Life Sciences62257–270.

    • Search Google Scholar
    • Export Citation
  • van GroeninghenJC Kiesel L Winkler D & Zwirner M 1998 Effects of luteinising-hormone-releasing hormone on nervous-system tumours. Lancet352372–373.

    • Search Google Scholar
    • Export Citation
  • WhitfieldGK & Kourides IA 1985 Expression of chorionic gonadotropin alpha- and beta-genes in normal and neoplastic human tissues: relationship to deoxyribonucleic acid structure. Endocrinology117231–236.

    • Search Google Scholar
    • Export Citation
  • WollerMJ Everson-Binotto G Nichols E Acheson A Keen KL Bowers CY & Terasawa E 2002 Aging-related changes in release of growth hormone and luteinizing hormone in female rhesus monkeys. Journal of Clinical Endocrinology and Metabolism875160–5167.

    • Search Google Scholar
    • Export Citation
  • WormaldPJ Eidne KA & Millar RP 1985 Gonadotropin-releasing hormone receptors in human pituitary: ligand structural requirements molecular size and cationic effects. Journal of Clinical Endocrinology and Metabolism611190–1194.

    • Search Google Scholar
    • Export Citation
  • YokotaniT Koizumi T Taniguchi R Nakagawa T Isobe T Yoshimura M Tsubota N Hasegawa K Ohsawa N Baba S et al.1997 Expression of alpha and beta genes of human chorionic gonadotropin in lung cancer. International Journal of Cancer71539–544.

    • Search Google Scholar
    • Export Citation