Abstract
The xenoestrogen bisphenol A (BPA) is commonly ingested by humans. We examined the effects of neonatal exposure to low versus high doses of BPA over the control of estrogen receptor α (ERα) expression in the preoptic area (POA) of prepubertal female rats. Pups received s.c. injections every 48 h of BPA (high dose, 20 mg/kg and low dose, 0.05 mg/kg) or diethylstilbestrol (DES, 0.02 mg/kg) from postnatal day (PND) 1 to PND7 and were killed at PND8 or PND21. Relative expression of ERα transcripts containing alternative 5′-untranslated regions OS, ON, O, OT, and E1 in POA were evaluated by RT-PCR. Methylation status of ERα promoters was determined by bisulfited DNA restriction analysis and ERα protein by immunohistochemistry. In PND8, the high dose of BPA and DES diminished total ERα mRNA levels, mediated by the decreased expression of ERα-O and ERα-OT variants. In contrast, the low dose of BPA augmented total ERα mRNA by increasing the expression of the ERα-E1 variant. In PND21, both BPA doses increased total ERα mRNA by means of the augmented expression of ERα-O and ERα-OT variants. In PND21, the methylation status of the ERα promoters and the circulating levels of estradiol were similar in all experimental groups. At PND8 and PND21, DES and the high dose of BPA decreased, while the low dose of BPA increased ERα protein in the POA. These findings show that neonatal BPA exposure alters the abundance of hypothalamic ERα transcript variants and protein in a dose-dependent manner.
Introduction
Bisphenol A (BPA), one of the most common environmental endocrine disruptors with estrogenic properties, is widely employed in the manufacture of plastics used in food packaging, dental composites, and sealants (Olea et al. 1996, Suzuki et al. 2000). BPA is not only widespread in the environment but also commonly ingested by humans. A recent study detected measurable BPA levels in 95% of the urinary samples analyzed from people in the United States (Calafat et al. 2005). A significant exposure of human fetuses has been reported due to BPA accumulation in maternal blood and in the amniotic fluid (Takahashi & Oishi 2000, Ikezuki et al. 2002, Schonfelder et al. 2002). Although actual BPA lowest observed adverse effects level (LOAEL) established by the National Toxicology Program’s report (US Environmental Protection Agency 1993) is 50 mg/kg per day, there are several reports indicating that perinatal exposure to BPA in doses below LOAEL affects reproductive parameters in adult animals, such as neuroendocrine axis development (Khurana et al. 2000, Ramos et al. 2003), mammary gland and prostate morphology (Ramos et al. 2001, Durando et al. 2006), estrous cyclicity patterns (Rubin et al. 2001), and sexual behavior (Carr et al. 2003, Kubo et al. 2003, Negishi et al. 2004, Porrini et al. 2005, Fujimoto et al. 2006). This apparent controversy could be explained by the fact that BPA shows an inverted-U-shaped dose–response curve (Nishizawa et al. 2005, Wetherill et al. 2005, Zsarnovszky et al. 2005), where much of the effects observed with low-dose treatments are absent in traditional high-dose toxicological studies.
During perinatal brain development, estrogens are crucial for sexual differentiation of the central nervous system (Arnold & Gorski 1984). In mammals, α-fetoprotein protects the embryonic female brain from estrogenic action (Bakker et al. 2006) by strongly binding circulating estrogens. In contrast, the perinatal male brain is exposed to high levels of estrogen, synthesized locally through the aromatization of testicular testosterone (Weisz & Ward 1980, Corbier et al. 1992). These sex differences in hormone synthesis and exposure during this critical period result in the development of distinct male and female neuroendocrine circuits characterized by a differential expression of hypothalamic estrogen receptors (ERs; Simerly et al. 1990, Karolczak & Beyer 1998). In particular, the hypothalamic preoptic area (POA) contains the anteroventral periventricular nucleus (AvPv) which is critical in the regulation of the phasic secretion of luteinizing hormone-releasing hormone in adult female rats (Polston & Simerly 2006, Wintermantel et al. 2006).
Akin to endogenous testosterone, the synthetic estrogen diethylstilbestrol (DES) and BPA show a very weak binding affinity to α-fetoprotein (Savu et al. 1979, Milligan et al. 1998, Nagel et al. 1999) and are therefore potential disruptors of hypothalamus development.
For many genes, it has been demonstrated that untranslated regions (UTRs) can differentially determine protein expression by influencing mRNA stability (Sharp & Bechhofer 2005, Wang et al. 2005) and translational efficiency (Gauss et al. 2006). These UTRs can determine tissue-specific expression through the regulatory action of multiple cis-acting motifs (Contractor et al. 2004). Some of the more frequent regulatory cis-acting motifs that are present close to the transcription start sites are the repetitive CG-rich elements called CpG islands. These regions act as molecular switches that activate or deactivate transcription initiation through differential methylation mechanisms (Sasaki et al. 2003, Champagne et al. 2006). In the rat, it has been described that a system of untranslated first exons is associated with the promoter selection for ERα transcription initiation, and to date five active promoters called OS, ON, O, OT, and E1 (Koike et al. 1987, Hirata et al. 1996a,b, Donaghue et al. 1999, Osada et al. 2001) have been identified. Little is known about the precise function of each ERα promoter; however, it has been reported that a mechanism of promoter selection is involved in the complex stage- and region-specific regulation of ERα gene expression in many organs, including the rat brain (Kato et al. 1998, Hamada et al. 2005).
Since ERα mRNA transcription and maturation could be differentially regulated by estrogens (Varayoud et al. 2005), it is very interesting to know whether high and low doses of xenoestrogens can modify the differential usage of ERα gene promoters in the rat hypothalamus. Using rats exposed early in life, we examined the effects of DES and BPA over the control of ERα transcription and translation in the hypothalamic POA of prepubertal female rats. Furthermore, we studied the relative abundance of ERα transcripts with alternative 5′UTR exons and the methylation status of ERα gene promoters in prepubertal female rats in response to xenoestrogen exposure.
Material and Methods
Animals and experimental design
Pups were obtained from timed-pregnant Wistar rats housed under a controlled environment (22 ± 2 °C; lights on from 0600 to 2000 h) with free access to pellet laboratory chow (Cooperación, Buenos Aires, Argentina) and tap water supplied from glass bottles. All rats were handled in accordance with the principles and procedures outlined in the Guide for the Care and Use of Laboratory Animals issued by the US National Academy of Sciences.
DES and BPA were purchased from Sigma–Aldrich. At least eight, and up to ten, timed-pregnant dams were used to collect offspring for each treatment (see below). At delivery (postnatal day 0, PND0), pups were sexed according to anogenital distance and cross-fostered, distributing pups of each litter between different mothers. These actions allowed us to minimize the use of siblings to avoid potential litter effects. The cross-fostered litters were adjusted to ten pups (five females and five males whenever possible) and assigned to one out offour experimental groups: corn oil vehicle-treated pups (control females and control males), DES (female pups injected with DES 0.02 mg/kg), BPA05 (female pups injected with a low dose of BPA 0.05 mg/kg), and BPA20 (female pups injected with a high dose of BPA 20 mg/kg). All pups received s.c. injections every 48 h from PND1 to PND7, with either 40 μl corn oil alone or 40 μl corn oil containing the appropriate amount of DES or BPA. Control males were used as a reference of natural masculinization of the POA and were treated as another experimental group. Based on the US Environmental Protection Agency (US EPA) estimate, the LOAEL for oral exposure to BPA in rats is 50 mg/kg per day (US Environmental Protection Agency 1993). Experts from the National Toxicology Program’s subpanel suggested a cutoff dose of 5 mg/kg per day for low-dose effects, regardless of the administration route, the duration of exposure or the age/life stage at which exposure occurred (National Toxicology Program 2001 http://ntp.niehs.nih.gov/ntp/htdocs/liason/LowDosePeerFinalRpt.pdf). Taking into account the above-mentioned concepts, the high dose of BPA used in our study is four times bigger than the low-dose cutoff suggested by the US EPA experts and 2.5-fold smaller than the LOAEL; meanwhile, the low dose is 100 times smaller than the low-dose cutoff and is similar to the acceptable daily intake level established by the US Environmental Protection Agency (1993 http://www.epa.gov/iris/subst/0536.htm). No signs of acute or chronic toxicity were observed, and no significant differences in weight gain and anogenital distance between treated and control pups were recorded during the experiment (data not shown). Alterations in maternal care were not detected between experimental groups. Pups from a single mother were killed by decapitation on PND8 or PND21, trunk blood collected, and serum stored at −20 °C until used for hormone assay. The number of animals per group at each time point evaluated was ~12–14.
For immunohistochemistry, brains were microdissected and fixed by immersion in 4% paraformaldehyde for 24 h at 4–8 °C. Fixed tissue was dehydrated in an ascending series of ethanol, cleared in xylene, and embedded in paraffin. Serial 5 μm thick frontal sections encompassing the medial POA in the coronal plane (Paxinos & Watson 2005) were mounted on 3-aminopropyl triethoxysilane (Sigma–Aldrich) coated slides and dried for 24 h at 37 °C.
For nucleic acid extraction, brain tissue blocks containing the POA were quickly microdissected under a GZ6 series dissecting microscope (Leica Corp., Buffalo, NY, USA). The POA fragment was encompassed by the anterior portion of the anterior commissure, the beginning of the ascending optical tracts, dorsally by the ventral portion of the anterior commissure, and laterally by a virtual line that is projected from the internal capsule to the external edge of the optical tracts (Paxinos & Watson 2005). After removal, tissue samples were immediately frozen in liquid nitrogen and stored at −80 °C until used for RNA or DNA analysis.
RT and real-time quantitative PCR analysis
An optimized PCR protocol was employed to analyze the relative expression levels of total ERα mRNA and ERα transcripts containing the untranslated first exons OS, ON, O, OT, and E1 (see Fig. 1A and Table 1). Four pools of two PND8 POA brain blocks (n = 4) or four to six individual PND21 blocks (n = 4–6) of each experimental group were homogenized in TRIzol reagent and total RNA was extracted following the manufacturer’s protocol (Invitrogen). The concentration of total RNA was assessed by A260 and the sample was stored at −80 °C until needed. Equal quantities (4 μg) of total RNA were reverse-transcribed for 90 min at 42 °C using 200 pmol random hexamer primers (Promega), 100 nmol deoxy-NTPs, and 300 U Moloney Murine Leukemia Virus reverse transcriptase (MMLV-RT, Promega) in a final volume of 30 μl of 1 × MMLV-RT buffer. A sample without reverse transcriptase was included to detect genomic DNA contamination. Each reverse-transcribed product was diluted with RNAse free water to a final volume of 60 μl and further amplified in triplicate using the Real-Time DNA Engine Opticon System (Bio-Rad Laboratories) and SYBR Green I dye (Cambrex Corp., East Rutherford, NJ, USA). Primer sequences used for amplification of ERα, 18sRNA, and ERα promoters cDNA’s are shown in Table 1.
For amplifications, 5 μl cDNA were combined with a mixture containing 2.5 U Platinum Taq-DNA polymerase (Invitrogen), 2 mM MgCl2 (Invitrogen), 0.2 mM of each of the four dNTPs (Promega), 1 μl of 10 × SYBR Green I, and 10 pmol of each primer (Invitrogen) in a final volume of 25 μl of 1 × PCR buffer. Product purity was confirmed by dissociation curves and random agarose gel electrophoresis. Controls containing no template DNA were included in all assays, yielding no consistent amplification. The cycle threshold (CT) for each sample was calculated using the Opticon Monitor Analysis Software (MJ Research, Bio-Rad Laboratories) with an automatic fluorescence threshold setting. Calculation of relative expression levels of each target was conducted based on the 2−ΔΔCT method (Higuchi et al. 1993). The efficiency of PCRs was assessed for each target by amplification of serial dilutions (over five orders of magnitude) of cDNA fragments of the transcripts under analysis. No significant differences in CT values were observed for 18sRNA between the different experimental groups. All PCR products were cloned using the TA cloning kit (Invitrogen) and specificity was confirmed by DNA sequencing (data not shown).
DNA extraction and bisulfite modification
DNA was isolated from pools of three POA tissue blocks of each PND21 group using the Wizard Genomic DNA Purification Kit (Promega). DNA (2 μg) in a volume of 50 μl was denatured with NaOH for 20 min at 37 °C. Thirty microliters of 10 mM hydroquinone (Sigma–Aldrich) and 520 μl of 3 M sodium bisulfite (Sigma–Aldrich) at pH 5, both freshly prepared, were added and mixed, and samples were incubated in the dark under a mineral oil layer at 55 °C for 16 h. Modified DNA was purified using Wizard DNA purification resin according to the manufacturer (Promega) and eluted into 50 μl preheated water (65 °C). Modification was completed by NaOH treatment for 15 min at 37 °C and followed by overnight ethanol precipitation. DNA was dissolved in 20 μl DNAse free water and used immediately or stored at −20 °C.
Combined bisulfite restriction analysis (COBRA)
In COBRA (Xiong & Laird 1997), restriction enzyme digestion is employed to reveal DNA methylation-dependent sequence differences (Fig. 1B) in PCR-amplified bisulfite-treated genomic DNA. Using the MethPrimer software (Li & Dahiya 2002), we identified CpG-rich fragments (CpG islands) on the stage- and region-specific active ERα gene promoters O and OT, and in ERα gene exon 1 (Fig. 1C, see Results) but not on promoter E1 or on the inactive promoters OS and ON. For COBRA purposes, these CpG islands were checked to contain at least one restriction site for Bst UI and/ or Taq I enzymes (Fig. 1C). PCR primers were designed to encompass CpG islands and to complement the bisulfite-converted DNA (Fig. 1C, Table 2). The PCR mixture contained 2 mM MgCl2 (Invitrogen), 0.2 mM of each of the four dNTPs (Promega), 10 pmol of each primer (Invitrogen), and bisulfite-modified DNA (1 μl) in a final volume of 25 μl of 1 × PCR buffer. Reactions were hot-started at 95 °C for 10 min before the addition of 2.5 U Taq-DNA polymerase (Invitrogen). Amplification was carried out for 36 cycles (45 s at 95 °C, 45 s at 59 °C, and 1 min at 72 °C), followed by a final 2 min extension at 72 °C. Controls with unmodified DNA and without DNA were performed for each set of primers. To ensure complete digestion of the PCR products in the subsequent restriction digestion step, each PCR product (20 μl) was loaded onto 2% agarose gel containing ethidium bromide (Sigma–Aldrich), quickly visualized under u.v. illumination and purified using the Wizard SV Gel and clean-up System kit according to the manufacturer’s protocol (Promega). Fifteen microliters of each purified PCR product was then digested separately with Bst UI (recognition site CGCG) and Taq I (recognition site TCGA). Cleavage will occur only if the CG sequence has been retained during the bisulfite conversion by a methylated cytosine residue (Fig. 1B). To ensure that the bisulfite conversion was complete, a control digest was performed with MseI (recognition site TTAA, data not shown). The molecular sizes of PCR and restriction products were determined by comparison with DNA standard size markers (Cien Marker, Biodynamics, Buenos Aires, Argentina).
ERα expression detected by immunohistochemistry
A standard immunohistochemical technique (avidin–biotin–peroxidase) was used to visualize ERα immunostaining intensity and distribution following a previously described protocol (Munoz de Toro et al. 1998, Varayoud et al. 2005). Overnight incubation at 4 °C was performed by applying a diluted mouse monoclonal antibody raised to full-length recombinant human ERα (working dilution 1:200; clone 6F-11, Novocastra, Newcastle upon Tyne, UK), followed by incubation with a biotinylated secondary antibody (working dilution 1:80; Sigma–Aldrich). Negative controls were obtained by replacing the primary antibody with nonimmune mouse serum (Sigma–Aldrich). The reaction was then developed using diaminobenzidine-nickel (Sigma–Aldrich) as a cromogen substrate. Samples were dehydrated and mounted with permanent mounting medium (PMyR, Buenos Aires, Argentina).
Quantitation of ERα expression in the AvPv of POA by image analysis
Image analysis was performed using the Image Pro-Plus 4.1.0.1 system (Media Cybernetics, Silver Spring, MA, USA) as previously described (Ramos et al. 2002). In brief, the images were recorded by a Spot Insight V3.5 color video camera, attached to an Olympus BH2 microscope (illumination, 12 V halogen lamp and 100 W, equipped with a stabilized light source), using a D-plan 10 × objective (NA = 0.25). The microscope was set up properly for Koehler illumination. Correction of unequal illumination (shading correction) and the calibration of the measurement system were done with a reference slide. Four brains from PND8 killed pups (n = 4) and five brains from PND21 prepubertal animals (n = 5) were scored in each experimental group. Typically, six or more sections of a one-in-six series were scored and averaged per animal. The images of immunostained slides were converted to a grey scale, the AvPv nucleus of POAwas delimited according to Paxinos & Watson (2005). The integrated optical density (IOD) was measured as a linear combination between the average grey intensity and the relative area occupied by positive cells. This morphometric approach provides more reproducibility, since relative spatial variables are independent of oversampling errors that would be incurred in calculating the absolute volumes and total cell numbers (Gundersen et al. 1988, Palmer et al. 2000, Ramos et al. 2001).
Hormone assay
17β-estradiol (E2) concentrations were determined by RIA using [2,4,6,7,16,17-3H(N)]E2 (Perkin–Elmer Life and Analytical Sciences, Boston, MA, USA) and a specific antibody provided by Dr G D Niswender. Pools consisting of two individual PND21 serum samples were made, and five pools of each experimental group were used. The sensitivity of the assay was 12.5 pg/ml. Intra- and inter-assay coefficients of variation were 3.38 and 2.12% respectively.
Data analysis
Statistical analyses were performed using two-tailed t tests. Each experimental group was compared against control females only, and differences were considered significant at P < 0.05.
Results
Effects of low and high doses of BPA on the preoptic ERα mRNA expression
In PND8, control females showed higher expression of ERα mRNA in the hypothalamic POA than control males (P < 0.05, Fig. 2A). Females exposed to DES were defeminized and ERα mRNA expression was significantly reduced and similar to male pups (P < 0.01, Fig. 2A). BPA treatment showed opposite and dose-dependent effects: in BPA20-treated females ERα mRNA expression levels decreased about fourfold when compared with control females (P < 0.001). In contrast, females exposed to the low dose of BPA (BPA05) increased 1.4-fold their hypothalamic ERα mRNA content (P < 0.05, Fig. 2A).
To know if the alterations observed in PND8 were of a transient or permanent nature, we assessed ERα mRNA expression 2 weeks after the end of the postnatal treatment. On PND21 – in contrast from the PND8 findings – the hypothalamic ERα mRNA content in control females, control males, and DES-treated females was similar (Fig. 2B). Surprisingly, on PND21 in both BPA-exposed groups, ERα mRNA expression was clearly augmented (P < 0.05, Fig. 2B) in a dose-independent fashion. It is interesting to note that the high levels of ERα mRNA expression observed on PND8 in BPA05-treated females persisted up to PND21, increasing to just about 2.1-fold (P < 0.05, Fig. 2B) when compared with female controls.
BPA changes the relative abundance of ERα transcripts with alternative 5′UTRs
To determine whether total POA ERα mRNA expression changes were associated with changes in transcriptional promoter usage, relative expression levels of all exons encoding 5′UTR of the rat ERα gene were studied using a real-time PCR approach. Specific sense primers for ERα 5′-untranslated exons OS, ON, O, OT, E1 and a common antisense primer specific for ERα exon 1 were designed (Table 1, Fig. 1A). Optimal reaction conditions for all transcript variants were first evaluated in cDNA from an intact adult female uterus and in all reactions, a single band of the expected size was obtained (Fig. 3). We determined that ERα gene transcription in POA is regulated by means of promoters OT, E1, and O (Fig. 3), despite age or treatment group. Expression of transcripts containing the ON or OS exons could not be detected in POA at any time point studied.
At PND8, ERα 5′UTR variant expression in the POA showed a great sexual dimorphism, since control females showed higher levels of ERα-OT, ERα-O, and ERα-E1 transcripts than male pups (P < 0.05, Fig. 4A–C). DES-treated females presented diminished ERα-OT and ERα-O transcription rates when compared with female controls (P < 0.05, Fig. 4A and B), together with a significant 1.6-fold increase in the ERα-E1 transcript variant expression (P < 0.05, Fig. 4C). BPA exposure showed a dose-dependent perturbation of ERα 5′UTR variant expression. When compared with female control pups and like DES-treated rats, the high dose of BPA (BPA20) clearly diminished ERα-OT and ERα-O transcript content (P < 0.01, Fig. 4A and B) and augmented the ERα-E1 variant expression (P < 0.05, Fig. 4C). Females exposed to the low dose of BPA (BPA05) showed no changes in the ERα-OT and ERα-O transcript content and only a 1.6-fold significant rise in the ERα-E1 transcript variant (P < 0.05, Fig. 4A–C).
In prepubertal PND21 females, a different pattern of ERα transcript variants was detected following xenoestrogen exposure. ERα-O and ERα-OT transcripts were significantly increased in DES- (P < 0.01), BPA20- (P < 0.01), and BPA05-(P < 0.005, Fig. 4D and E) treated females. Regarding the exon-E1 mRNA variant, a twofold decrease in BPA20- (P < 0.01) and BPA05- (P < 0.05) treated animals were found (Fig. 4F). It is important to note that at this time point, no differences between male and female controls were observed in ERα 5′UTR variant transcription rates (Fig. 4D–F).
Methylation status of ERα transcriptional promoters in prepubertal female rats
To find out if DES- and BPA-induced changes in alternative 5′UTR ERα transcript levels are being caused through a DNA methylation mechanism, we used a COBRA approach to determine the methylation status of transcriptionally active promoters in prepubertal PND21 animals. In all experimental groups, exon 1 and promoter ERα-O were completely unmethylated, while the ERα-OT promoter presented a constitutive, treatment-independent, low level of methylation in the CpG island, as evaluated by Bst UI restriction analysis (Fig. 5). We could not find differences in the CpG methylation status of active ERα promoters between experimental groups.
Differential ERα protein expression in the AvPv
To determine if alterations prompted by postnatal xenoestrogen exposure in ERα mRNA expression were extensive in the ERα protein, we determined the relative ERα protein levels in PND8 and PND21 rats in neurons from the AvPv nucleus (Fig. 6A–J). On PND8, ERα protein levels were significantly reduced in the AvPv (P < 0.005, Fig. 6K) of male pups and in DES- and BPA20-treated females when compared with female controls. In contrast, the AvPv of females exposed to the low dose of BPA showed a clear increase in ERα protein expression (P < 0.001). Two weeks after exposure, ERα expression levels remained significantly reduced in male controls, as well as DES- and BPA20-treated females (P < 0.001, Fig. 6L), whereas in BPA05-treated rats, ERα IOD levels were still significantly increased with respect to female controls (P < 0.05).
Discussion
To our knowledge, this is the first study showing that neonatal BPA exposure affects the relative abundance of alternative 5′UTRs ERα transcripts in the female rat POA. Furthermore, female rats exposed to the high dose of BPA downregulated the expression of total ERα mRNA, while females exposed to a dose of 400 times smaller presented the opposite effect. Two weeks after the end of the xenoestrogen exposure, the ERα mRNA hypothalamic expression remained significantly high in both BPA-treated groups, suggesting a long-term effect. Alterations caused by early postnatal BPA exposure are not restricted to ERα transcription, but are extensive in ERα translation in the sexually dimorphic AvPv nucleus of POA. When female rats were analyzed immediately after the end of the high-dose BPA exposure (PND8), an abrupt decrease in ERα protein levels was observed. Surprisingly, the low-dose BPA exposed animals showed a significant upregulation of the ERα protein, clearly showing an opposite dose-dependent effect of BPA on the transcription and translation control of the ERα gene in the female POA. Taken together, the above-mentioned findings suggest that the high dose of BPA, like DES treatment, provoke defeminization of ERα expression in the POA of female offspring, which is consistent with the estrogenic nature of BPA (Olea et al. 1996). Remarkably, the opposite effect was seen in the low dose-exposed females, suggesting that the estrogenic action of BPA is an emergent property that depends on the experimental context complexity. In lower complexity contexts, like in vitro experimental conditions, the estrogenic or antiestrogenic qualities of a substance are robustly determined; however, in in vivo conditions, the estrogenic or antiestrogenic action is an emergent phenomena dependent on multiple variables like doses, end-points evaluated, animal genomic background, etc. (vom Saal & Hughes 2005). Specifically, the results obtained in the high-dose BPA group on PND21 could indicate an over compensation mechanism that take place in response to the initial ERα reduction observed on PND8. In a previous work (Ramos et al. 2007), we found a similar over-compensation mechanism in the control of estrogen-dependent genes in the hippocampus of rat neonatally exposed to xenoestrogens. These results suggest the existence of an internal regulatory mechanism to compensate an initial xenoestrogen-induced declination of estrogen-dependent gene transcription.
A possible mechanism involved in the xenoestrogen-mediated ERα disruption could include differential promoter usage, as evidenced by changes in the relative abundance of alternative spliced 5′UTR transcripts (Kato et al. 1998, Hughes 2006). Our results show that the reduction in ERα mRNA expression observed in newborn females exposed to the high dose of BPA is correlated with low levels of ERα-O and ERα-OT transcripts. Otherwise, in newborn females exposed to the lower dose of BPA, the increase observed on ERα transcription could be explained by the increment in transcripts from promoter ERα-E1 and the unaltered transcription levels from promoters ERα-O and ERα-OT. It is interesting to note that even though newborn females exposed to the high dose of BPA also presented an increment in transcripts from promoter ERα-E1, which does not seem to be enough to balance the low levels of promoters O and OT activity. On PND21-treated females, both doses of BPA induced an approximately twofold upregulation in total ERα mRNA levels, which was mediated by means of the increased expression of ERα-O and ERα-OT variants. These results strongly suggest that the ERα-OTand ERα-O promoters are very important in ERα transcription control during the early postnatal period in hypothalamic structures.
The selective promoter usage in estrogen-mediated ERα transcriptional regulation has been demonstrated in several breast cancer cell lines (Donaghue et al. 1999) and in rat brain (Hamada et al. 2005). Moreover, differential promoter activity has been shown to be a key regulator of tissue-specific ERα expression (Kato et al. 1998, Donaghue et al. 1999). Here, we suggest that the alternative promoter usage of the ERα gene is regulated by BPA exposure in a dose-sensitive manner and therefore this mechanism could be, at least in part, responsible for the different and sometimes contradictory effects observed in BPA action on gene transcription (Khurana et al. 2000, Kwon et al. 2000, Aloisi et al. 2001, Ramos et al. 2003, Patisaul et al. 2006). Since sexual differentiation of the hypothalamus is estrogen-dependent and mediated at least partly through ERα (Simerly et al. 1997), BPA deregulation of this receptor could affect the natural estrogen-directed dimorphisms of POA circuits. In a previous work performed in our laboratory, it has been demonstrated that low and high doses of estrogen can differentially regulate the splicing of the rat ERα mRNA coding region (Varayoud et al. 2005). Selective promoter usage and alternative mRNA splicing events are estrogen-dependent mechanisms of ERα gene variation, arising as sources of complexity in the endocrine disruptor’s toxicology. In every particular experimental paradigm, it is very difficult to predict if BPA-mediated disruptions would be similar to those observed in natural or synthetic estrogen exposure experiments (vom Saal & Hughes 2005, vom Saal & Welshons 2006). The results obtained here clearly show that BPA acts as a classical estrogen (like DES), defeminizing the ERα protein expression of females’ POA only in the high-dose experiment, whereas the low-dose effect is exactly the opposite. These events could be associated with the BPA property to modulate different promoter regions of regulatory genes (like ERα) in a dose-dependent manner. The molecular mechanism underlying this promoter selection is not known and is under study in our laboratory. The sequences of the ERα-O and ERα-OT promoters possess a small 5′-upstream open reading frame (5′upORF). Several regulatory roles have been assigned to these 5′upORF, such as limiting the protein expression by a translation reinitiation mechanism (Kos et al. 2002, Blaschke et al. 2003). Further research will help to elucidate if any of these mechanisms are involved in the xenoestrogen regulation of ERs in the rat hypothalamus.
Early developmental perturbations due to xenoestrogen exposure have been linked to the adult-onset of reproductive pathologies, including cancer (Munoz-de-Toro et al. 2005, Durando et al. 2006); however, the molecular basis for this imprinting event is not known. A recent report showed that neonatal estradiol or BPA exposure causes early and prolonged hypomethylation of the 5′-flanking region of the phosphodiesterase type 4 gene (PDE4D4) in the rat prostate gland, resulting in continued and elevated PDE4D4 expression (Ho et al. 2006). Using COBRA, we could not find any differences in the methylation status of the active ERα promoters between xenoestrogen-treated and control groups, suggesting that DES and BPA alter the hypothalamic ERα gene transcription control using a methylation-independent mechanism.
The results presented here are in accordance with a recently published report where it was evidenced that exposing female rats during the first PNDs to a high dose of BPA (100 mg/kg per day) causes a significant decrease in tyrosine-hydroxylase (TH) and ERα double-labeled neurons in the AvPv (Patisaul et al. 2006). In another work, CD-1 mice treated with low doses of BPA (25 and 250 ng/kg per day) from day 8 of gestation through day 16 of lactation clearly decreased the number of TH neurons in the AVPV (Rubin et al. 2006). Moreover, the fact that E2 serum levels in prepubertal females are not affected by postnatal BPA exposure suggests that the disruptions observed 2 weeks after the end of xenoestrogen treatment could be attributed to an organizational disruption in the transcription control of estrogen-sensitive genes like TH and ERα rather than disturbances in the endogenous estradiol.
Our findings are consistent with an inverted-U-shaped dose–response curve previously reported for BPA hormone action (Nishizawa et al. 2005, vom Saal & Hughes 2005, Wetherill et al. 2005, Zsarnovszky et al. 2005). Alarmingly, the lower BPA concentration used in this study (50 μg/kg) falls in the expected human exposure range, as microgram quantities of BPA were detected in urinary samples of a reference human population (Calafat et al. 2005) and in early pregnancy amniotic fluid (Ikezuki et al. 2002, Engel et al. 2006). This is of particular concern to fetus health, where subtle alterations will probably remain undiscovered until the onset of sexual maturity. It was clearly shown that in utero exposure to environmental doses of BPA affects the hypothalamic–pituitary axis, increasing POA ERβ mRNA expression and prolactin levels in male offspring as well as LH secretion and estrous cyclicity in females (Rubin et al. 2001, Ramos et al. 2003). Moreover, xenoestrogen exposition in newborns is expected to continue as BPA is released from polycarbonate baby bottles (Brede et al. 2003) and is also present in regular powdered infant and follow-up formulas (Kuo & Ding 2004).
Our results show that BPA exposure during the early postnatal period alters the abundance of hypothalamic ERα transcript variants and protein in a dose-dependent manner. Based on present data and previous reports, we could suggest that xenoestrogen exposure during critical periods of development disrupt hypothalamic gene expression, interfering with the normal maturation of sexually dimorphic areas of the forebrain. Actually, we are evaluating the consequences of the xenoestrogen-induced ERα disruption on the gonadotropin-releasing hormone neurocircuitry In summary, a comprehensive analysis is needed to evaluate the potential hazards to humans and wildlife from exposure to BPA at doses below the prior LOAEL dose of 50 mg/kg per day.
Primers and PCR products for real-time RT-PCR experiments
| Primer sequence (5′ –3′ ) | Product size (bp) | Genbank accession no. | |
|---|---|---|---|
| Gene | |||
| ERα | Forward: AATTCTGACAATCGACGCCAG Reverse: GTGCTTCAACATTCTCCCTCCTC | 345 | NM_012689 |
| 18sRNA | Forward: CAACTTTCGATGGTAGTCGC Reverse: CGCTATTGGAGCTGGAATTAC | 285 | M11188 |
| ERα-OS | Forward: CCGAAAACACAAGGCTCCATGCT | 336 | NW_047550 |
| ERα-ON | Forward: CTGGGGCATCTCCTTCAATATG | 304 | NW_047550 |
| ERα-O | Forward: GACTTCTACAAACCCATGGA | 272 | NM_012689 |
| ERα-OT | Forward: CAGCAGGTTTGCGATGTCTAA | 275 | X98236 |
| ERα-E1 | Forward: TTTAACCTCGGGCTCTACTC | 247 | X98236 |
| Exon 1 | Reverse: GGGCTTGCTGTTGTCCACGTAC | – | NM_012689 |
Primers and PCR product for combined bisulfite restriction analysis experiments
| Primer sequence (5′ –3′ ) | Product size (bp) | |
|---|---|---|
| Gene | ||
| ERα-O | Forward: ATGTTGATTTTAGTGGTGTTATTGT Reverse: TCCAAAAATATTCCATAAATTTATAAAAAT | 296 |
| ERα-OT | Forward: AAAAAGAAAGAAAAGAAATTAGTTTGTG Reverse: CTAATCTCCCCTATTCTTAAACATC | 281 |
| Exon 1 | Forward: TTTTGTTGTATTAGATTTAAGGGAA Reverse: AAAAAAAACCCCCAAACTATTAAC | 272 |
Outline of ERα promoter-specific real-time PCR and combined bisulfite restriction analysis (COBRA) procedures. (A) Genomic organization of the promoter region of the rat ERα gene. Relative positions and orientations of promoter-specific real-time PCR primers are indicated by black arrows. The common region to all the alternative 5′ UTRs of ERα is indicated by a solid grey box. (B) In the COBRA procedure, bisulfite converts nonmethylated cytosines (C) to uracil leaving 5-methylcytosine (5mC) unaltered. Predicted changes in restriction enzyme sites following reaction of genomic DNA with bisulfite are illustrated. (C) Positions and orientations of PCR primers used for COBRA are indicated by black arrows. CpG islands are depicted by lollipop signs, Bst UI, and Taq I restricition sites are indicated by white and grey arrows respectively.
Citation: Journal of Endocrinology 194, 1; 10.1677/JOE-07-0014
Effect of neonatal xenoestrogen exposure on ERα mRNA expression levels in the female rat preoptic area on PND8 (A) and PND21 (B). Relative mRNA levels were measured by real-time RT-PCR and fold expression from control values were calculated for each target by equation 2−ΔΔCT. Control values were assigned to a reference level of 1 and values are given as mean ± s.e.m. of at least three independent determinations (*P < 0.05 versus control females).
Citation: Journal of Endocrinology 194, 1; 10.1677/JOE-07-0014
Promoter usage of ERα gene on the rat preoptic area (POA). Representative ethidium bromide-stained gel electrophoresis of ERα mRNA species containing alternative 5′ UTRs in PND8 and PND21 rats’ POA. No transcripts from the OS and ON promoters were detected in any experimental group. Uterine cDNA from an intact adult female rat was used as a positive control of promoter-specific PCRs.
Citation: Journal of Endocrinology 194, 1; 10.1677/JOE-07-0014
Effect of neonatal xenoestrogen exposure on the relative abundance of ERα transcripts with alternative 5′ UTRs in the female rat preoptic area on PND8 (A–C) and PND21 (D–F). Relative mRNA levels of the stage- and region-specific promoters ERα-O (A and D), ERα-OT (B and E), and ERα-E1 (C and F) were measured by real-time RT-PCR and fold expression from control values were calculated for each target by equation 2−ΔΔCT. Control values were assigned to a reference level of 1 and values are given as mean ± s.e.m. of at least three independent determinations (*P < 0.05 versus control females).
Citation: Journal of Endocrinology 194, 1; 10.1677/JOE-07-0014
Determination of the methylation status of promoter’s ERα-OT CpG island. (A) Representative ethidium bromide-stained gel electrophoresis of a COBRA assay with the restriction enzyme Bst UI; no differences could be observed in the methylation pattern of the ERα-OT region between experimental groups. (B) Map of the PCR product with the sizes of the predicted digestion products. There are two consecutive methylation sensitive Bst UI sites in the 281 bp PCR product.
Citation: Journal of Endocrinology 194, 1; 10.1677/JOE-07-0014
Effects of neonatal xenoestrogen exposure on ERαtranslation in the AvPv nucleus of the POA. (A–J) Representative photomicrographs of immunohistochemical detection of ERα in the AvPv nucleus of PND8 (A–E) and PND21 (F–J) in female rats. The AvPv nucleus was delineated in accordance with Paxinos & Watson (2005). Scale bar, 300 μm; 3V, third ventricule; ac, anterior commissure; oc, optic chiasm. (K and L) Quantification of the results obtained by immunohistochemistry in the AvPv of PND8 (K) and PND21 (L) animals. Data are expressed as IOD, which is measured as a linear combination between the average immunostained intensity and the relative area occupied by positive cells in the AvPv. Each column represents the mean ± s.e.m. of at least six semi-serial sections per animal offour (PND8) or five (PND21) animals per group (*P < 0.05 versus control females).
Citation: Journal of Endocrinology 194, 1; 10.1677/JOE-07-0014
Estradiol serum levels in prepubertal animals. Blood was collected on PND21 and analyzed for 17β-estradiol. Each value is the mean ± s.e.m. of five serum samples per treatment group.
Citation: Journal of Endocrinology 194, 1; 10.1677/JOE-07-0014
The authors thank Mr Juan C Villarreal and Mr Juan Grant for their technical assistance and animal care. This study was supported by grants from the Argentine National Council for Science and Technology (CONICET, CIC Grant 652/04), the Argentine National Agency for the Promotion of Science and Technology (ANPCyT; PICT 2003, No. 13-4737), and the Universidad Nacional del Litoral (CAI+D 2005 019/118). L M is a fellow and J V, J G R, and E H L are career investigators of the CONICET. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work
References
Aloisi AM, Della SD, Ceccarelli I & Farabollini F 2001 Bisphenol-A differently affects estrogen receptors-alpha in estrous-cycling and lactating female rats. Neuroscience Letters 310 49–52.
Arnold AP & Gorski RA 1984 Gonadal steroid induction of structural sex differences in the central nervous system. Annual Review of Neuroscience 7 413–442.
Bakker J, De Mees C, Douhard Q, Balthazart J, Gabant P, Szpirer J & Szpirer C 2006 Alpha-fetoprotein protects the developing female mouse brain from masculinization and defeminization by estrogens. Nature Neuroscience 9 220–226.
Blaschke RJ, Topfer C, Marchini A, Steinbeisser H, Janssen JW & Rappold GA 2003 Transcriptional and translational regulation of the Leri-Weill and Turner syndrome homeobox gene SHOX. Journal of Biological Chemistry 278 47820–47826.
Brede C, Fjeldal P, Skjevrak I & Herikstad H 2003 Increased migration levels of bisphenol A from polycarbonate baby bottles after dishwashing, boiling and brushing. Food Additives and Contaminants 20 684–689.
Calafat AM, Kuklenyik Z, Reidy JA, Caudill SP, Ekong J & Needham LL 2005 Urinary concentrations of bisphenol A and 4-nonylphenol in a human reference population. Environmental Health Perspectives 113 391–395.
Carr R, Bertasi F, Betancourt A, Bowers S, Gandy BS, Ryan P & Willard S 2003 Effect of neonatal rat bisphenol a exposure on performance in the Morris water maze. Journal of Toxicology and Environmental Health. Part A 66 2077–2088.
Champagne FA, Weaver IC, Diorio J, Dymov S, Szyf M & Meaney MJ 2006 Maternal care associated with methylation of the estrogen receptor alpha 1b promoter and estrogen receptor alpha expression in the medial preoptic area of female offspring. Endocrinology 147 2909–2915.
Contractor RG, Foran CM, Li S & Willett KL 2004 Evidence of gender-and tissue-specific promoter methylation and the potential for ethinylestradiol-induced changes in Japanese medaka (Oryzias latipes) estrogen receptor and aromatase genes. Journal of Toxicology and Environmental Health. Part A 67 1–22.
Corbier P, Allioli N & Roffi J 1992 Variations in the testicular response to HCG during the perinatal period in the rat: influence of estrogens. Archives Internationales de Physiologie, de Biochimie et de Biophysique 100 389–397.
Donaghue C, Westley BR & May FE 1999 Selective promoter usage of the human estrogen receptor-alpha gene and its regulation by estrogen. Molecular Endocrinology 13 1934–1950.
Durando M, Kass L, Piva J, Sonnenschein C, Soto AM, Luque EH & Munoz-De-Toro M 2006 Prenatal bisphenol A exposure induces preneoplastic lesions in the mammary gland in wistar rats. Environmental Health Perspectives 115 80–86.
Engel SM, Levy B, Liu Z, Kaplan D & Wolff MS 2006 Xenobiotic phenols in early pregnancy amniotic fluid. Reproductive Toxicology 21 110–112.
Fujimoto T, Kubo K & Aou S 2006 Prenatal exposure to bisphenol A impairs sexual differentiation of exploratory behavior and increases depression-like behavior in rats. Brain Research 1068 49–55.
Gauss KA, Bunger PL, Crawford MA, McDermott BE, Swearingen R, Nelson-Overton LK, Siemsen DW, Kobayashi SD, Deleo FR & Quinn MT 2006 Variants of the 5′-untranslated region of human NCF2: expression and translational efficiency. Gene 366 169–179.
Gundersen HJ, Bendtsen TF, Korbo L, Marcussen N, Moller A, Nielsen K, Nyengaard JR, Pakkenberg B, Sorensen FB, Vesterby A et al.1988 Some new, simple and efficient stereological methods and their use in pathological research and diagnosis. Acta Pathologica, Microbiologica, et Immunologica Scandinavica 96 379–394.
Hamada T, Wada-Kiyama Y & Sakuma Y 2005 Visualizing forebrain-specific usage of an estrogen receptor alpha promoter for receptor downregulation in the rat. Brain Research. Molecular Brain Research 139 42–51.
Higuchi R, Fockler C, Dollinger G & Watson R 1993 Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology 11 1026–1030.
Hirata S, Koh T, Yamada-Mouri N, Hoshi K & Kato J 1996a The untranslated first exon ‘exon 0S’ of the rat estrogen receptor (ER) gene. FEBS Letters 394 371–373.
Hirata S, Koh T, Yamada-Mouri N & Kato J 1996b The novel untranslated first exon ‘exon 0N’ of the rat estrogen receptor gene. Biochemical and Biophysical Research Communications 225 849–854.
Ho SM, Tang WY, Belmonte DF & Prins GS 2006 Developmental exposure to estradiol and bisphenol A increases susceptibility to prostate carcinogenesis and epigenetically regulates phosphodiesterase type 4 variant 4. Cancer Research 66 5624–5632.
Hughes TA 2006 Regulation of gene expression by alternative untranslated regions. Trends in Genetics 22 119–122.
Ikezuki Y, Tsutsumi O, Takai Y, Kamei Y & Taketani Y 2002 Determination of bisphenol A concentrations in human biological fluids reveals significant early prenatal exposure. Human Reproduction 17 2839–2841.
Karolczak M & Beyer C 1998 Developmental sex differences in estrogen receptor-beta mRNA expression in the mouse hypothalamus/preoptic region. Neuroendocrinology 68 229–234.
Kato J, Hirata S, Koh T, Yamada-Mouri N, Hoshi K & Okinaga S 1998 The multiple untranslated first exons and promoters system of the oestrogen receptor gene in the brain and peripheral tissues of the rat and monkey and the developing rat cerebral cortex. Journal of Steroid Biochemistry and Molecular Biology 65 281–293.
Khurana S, Ranmal S & Ben Jonathan N 2000 Exposure of newborn male and female rats to environmental estrogens: delayed and sustained hyperpro-lactinemia and alterations in estrogen receptor expression. Endocrinology 141 4512–4517.
Koike S, Sakai M & Muramatsu M 1987 Molecular cloning and characterization of rat estrogen receptor cDNA. Nucleic Acids Research 15 2499–2513.
Kos M, Denger S, Reid G & Gannon F 2002 Upstream open reading frames regulate the translation of the multiple mRNA variants of the estrogen receptor alpha. Journal of Biological Chemistry 277 37131–37138.
Kubo K, Arai O, Omura M, Watanabe R & Aou S 2003 Low dose effects of bisphenol A on sexual differentiation of the brain and behavior in rats. Neuroscience Research 45 345–356.
Kuo HW & Ding WH 2004 Trace determination of bisphenol A and phytoestrogens in infant formula powders by gas chromatography-mass spectrometry. Journal of Chromatography. A 1027 67–74.
Kwon S, Stedman DB, Elswick BA, Cattley RC & Welsch F 2000 Pubertal development and reproductive functions of Crl:CD BR Sprague–Dawley rats exposed to bisphenol A during prenatal and postnatal development. Toxicological Sciences 55 399–406.
Li LC & Dahiya R 2002 MethPrimer: designing primers for methylation PCRs. Bioinformatics 18 1427–1431.
Milligan SR, Khan O & Nash M 1998 Competitive binding of xenobiotic oestrogens to rat alpha-fetoprotein and to sex steroid binding proteins in human and rainbow trout (Oncorhynchus mykiss) plasma. General and Comparative Endocrinology 112 89–95.
Munoz de Toro MM, Maffini MV, Kass L & Luque EH 1998 Proliferative activity and steroid hormone receptor status in male breast carcinoma. Journal of Steroid Biochemistry and Molecular Biology 67 333–339.
Munoz-de-Toro M, Markey CM, Wadia PR, Luque EH, Rubin BS, Sonnenschein C & Soto AM 2005 Perinatal exposure to bisphenol-A alters peripubertal mammary gland development in mice. Endocrinology 146 4138–4147.
Nagel SC, vom Saal FS & Welshons WV 1999 Developmental effects of estrogenic chemicals are predicted by an in vitro assay incorporating modification of cell uptake by serum. Journal of Steroid Biochemistry and Molecular Biology 69 343–357.
Negishi T, Kawasaki K, Suzaki S, Maeda H, Ishii Y, Kyuwa S, Kuroda Y & Yoshikawa Y 2004 Behavioral alterations in response to fear-provoking stimuli and tranylcypromine induced by perinatal exposure to bisphenol A and nonylphenol in male rats. Environmental Health Perspectives 112 1159–1164.
Nishizawa H, Morita M, Sugimoto M, Imanishi S & Manabe N 2005 Effects of in utero exposure to bisphenol A on mRNA expression of arylhydrocarbon and retinoid receptors in murine embryos. Journal of Reproduction and Development 51 315–324.
Olea N, Pulgar R, Perez P, Olea-Serrano F, Rivas A, Novillo-Fertrell A, Pedraza V, Soto AM & Sonnenschein C 1996 Estrogenicity of resin-based composites and sealants used in dentistry. Environmental Health Perspectives 104 298–305.
Osada N, Hirata S, Shoda T & Hoshi K 2001 The novel untranslated exon ‘exon 0T’ encoded between the exon 0 and exon 1 of the rat estrogen receptor alpha (ER alpha) gene. Endocrine Journal 48 465–472.
Palmer TD, Willhoite AR & Gage FH 2000 Vascular niche for adult hippocampal neurogenesis. Journal of Comparative Neurology 425 479–494.
Patisaul HB, Fortino AE & Polston EK 2006 Neonatal genistein or bisphenol-A exposure alters sexual differentiation of the AVPV. Neurotoxicology and Teratology 28 111–118.
Paxinos G & Watson C 2005 The Rat Brain in Stereotaxic Coordinates., Amsterdam: Elsevier Academic Press.
Polston EK & Simerly RB 2006 Ontogeny of the projections from the anteroventral periventricular nucleus of the hypothalamus in the female rat. Journal of Comparative Neurology 495 122–132.
Porrini S, Belloni V, Della SD, Farabollini F, Giannelli G & Dessi-Fulgheri F 2005 Early exposure to a low dose of bisphenol A affects socio-sexual behavior of juvenile female rats. Brain Research Bulletin 65 261–266.
Ramos JG, Varayoud J, Sonnenschein C, Soto AM, Munoz DT & Luque EH 2001 Prenatal exposure to low doses of bisphenol A alters the periductal stroma and glandular cell function in the rat ventral prostate. Biology of Reproduction 65 1271–1277.
Ramos JG, Varayoud J, Bosquiazzo VL, Luque EH & Munoz-de-Toro M 2002 Cellular turnover in the rat uterine cervix and its relationship to estrogen and progesterone receptor dynamics. Biology of Reproduction 67 735–742.
Ramos JG, Varayoud J, Kass L, Rodriguez H, Costabel L, Munoz-de-Toro M & Luque EH 2003 Bisphenol a induces both transient and permanent histofunctional alterations of the hypothalamic–pituitary–gonadal axis in prenatally exposed male rats. Endocrinology 144 3206–3215.
Ramos JG, Varayoud J, Monje L, Moreno-Piovano G, Munoz-De-Toro M & Luque EH 2007 Diethylstilbestrol alters the population dynamic of neural precursor cells in the neonatal male rat dentate gyrus. Brain Research Bulletin 71 619–627.
Rubin BS, Murray MK, Damassa DA, King JC & Soto AM 2001 Perinatal exposure to low doses of bisphenol A affects body weight, patterns of estrous cyclicity, and plasma LH levels. Environmental Health Perspectives 109 675–680.
Rubin BS, Lenkowski JR, Schaeberle CM, Vandenberg LN, Ronsheim PM & Soto AM 2006 Evidence of altered brain sexual differentiation in mice exposed perinatally to low, environmentally relevant levels of bisphenol A. Endocrinology 147 3681–3691.
vom Saal FS & Hughes C 2005 An extensive new literature concerning low-dose effects of bisphenol A shows the need for a new risk assessment. Environmental Health Perspectives 113 926–933.
vom Saal FS & Welshons WV 2006 Large effects from small exposures. II. The importance of positive controls in low-dose research on bisphenol A. Environmental Research 100 50–76.
Sasaki M, Kaneuchi M, Fujimoto S, Tanaka Y & Dahiya R 2003 Hypermethylation can selectively silence multiple promoters of steroid receptors in cancers. Molecular and Cellular Endocrinology 202 201–207.
Savu L, Benassayag C, Vallette G & Nunez EA 1979 Ligand properties of diethylstilbestrol: studies with purified native and fatty acid-free rat alpha 1-fetoprotein and albumin. Steroids 34 737–748.
Schonfelder G, Wittfoht W, Hopp H, Talsness CE, Paul M & Chahoud I 2002 Parent bisphenol A accumulation in the human maternal-fetal-placental unit. Environmental Health Perspectives 110 A703–A707.
Sharp JS & Bechhofer DH 2005 Effect of 5′-proximal elements on decay of a model mRNA in Bacillus subtilis. Molecular Microbiology 57 484–495.
Simerly RB, Chang C, Muramatsu M & Swanson LW 1990 Distribution of androgen and estrogen receptor mRNA-containing cells in the rat brain: an in situ hybridization study. Journal of Comparative Neurology 294 76–95.
Simerly RB, Zee MC, Pendleton JW, Lubahn DB & Korach KS 1997 Estrogen receptor-dependent sexual differentiation of dopaminergic neurons in the preoptic region of the mouse. PNAS 94 14077–14082.
Suzuki K, Ishikawa K, Sugiyama K, Furuta H & Nishimura F 2000 Content and release of bisphenol A from polycarbonate dental products. Dental Materials Journal 19 389–395.
Takahashi O & Oishi S 2000 Disposition of orally administered 2,2-Bis(4-hydroxyphenyl)propane (Bisphenol A) in pregnant rats and the placental transfer to fetuses. Environmental Health Perspectives 108 931–935.
Varayoud J, Ramos JG, Monje L, Bosquiazzo V, Munoz-de-Toro M & Luque EH 2005 The estrogen receptor alpha sigma3 mRNA splicing variant is differentially regulated by estrogen and progesterone in the rat uterus. Journal of Endocrinology 186 51–60.
Wang G, Guo X & Floros J 2005 Differences in the translation efficiency and mRNA stability mediated by 5′-UTR splice variants of human SP-A1 and SP-A2 genes. American Journal of Physiology. Lung Cellular and Molecular Physiology 289 L497–L508.
Weisz J & Ward IL 1980 Plasma testosterone and progesterone titers of pregnant rats, their male and female fetuses, and neonatal off spring. Endocrinology 106 306–316.
Wetherill YB, Fisher NL, Staubach A, Danielsen M, Vere White RW & Knudsen KE 2005 Xenoestrogen action in prostate cancer: pleiotropic effects dependent on androgen receptor status. Cancer Research 65 54–65.
Wintermantel TM, Campbell RE, Porteous R, Bock D, Grone HJ, Todman MG, Korach KS, Greiner E, Perez CA, Schutz G et al.2006 Definition of estrogen receptor pathway critical for estrogen positive feedback to gonadotropin-releasing hormone neurons and fertility. Neuron 52 271–280.
Xiong Z & Laird PW 1997 Cobra: a sensitive and quantitative DNA methylation assay. Nucleic Acids Research 25 2532–2534.
Zsarnovszky A, Le HH, Wang HS & Belcher SM 2005 Ontogeny of rapid estrogen-mediated extracellular signal-regulated kinase signaling in the rat cerebellar cortex: potent nongenomic agonist and endocrine disrupting activity of the xenoestrogen bisphenol A. Endocrinology 146 5388–5396.
