Molecular cloning and expression analysis of rainbow trout (Oncorhynchus mykiss) CCAAT/enhancer binding protein genes and their responses to induction by GH in vitro and in vivo

in Journal of Endocrinology
View More View Less
  • Department of Molecular and Cell Biology, University of Connecticut, 91 N. Eagleville Road, U-3125, Storrs, Connecticut 06269, USA

CCAAT/enhancer-binding proteins (C/EBPs) are transcription factors consisting of six isoforms and play diverse physiological roles in vertebrates. In rainbow trout (Oncorhynchus mykiss), in addition to the reported C/EBPβ1, we have isolated cDNA of four other isoforms, C/EBPα, C/EBPβ2, C/EBPδ1, C/EBPδ2, from the liver. Comparison of the deduced amino acid sequence of rainbow trout C/EBPs with those of other vertebrates revealed that C/EBP isoforms are highly conserved. The profiles of tissue-specific expression of individual C/EBP isoform mRNA, determined by quantitative real-time (RT)-PCR showed distinct patterns. Furthermore, injection of bovine GH into yearling rainbow trout resulted in a significant increase of mRNA levels of C/EBPβ1, C/EBPβ2, and C/EBPδ2 but not C/EBPα and C/EBPδ1 in the liver. GH-dependent increase of mRNA levels of C/EBPβ1, C/EBPβ2, C/EBPδ2, and IGF-II were also confirmed by treating rainbow trout hepatoma cells expressing a goldfish GH receptor with bGH. Together with our previous findings, the results presented in this paper strengthen our previous hypothesis that GH may regulate the expression of the IGF-II gene via mediating the expression of C/EBPβ1, C/EBPβ2, and C/EBPδ2 mRNA.

Abstract

CCAAT/enhancer-binding proteins (C/EBPs) are transcription factors consisting of six isoforms and play diverse physiological roles in vertebrates. In rainbow trout (Oncorhynchus mykiss), in addition to the reported C/EBPβ1, we have isolated cDNA of four other isoforms, C/EBPα, C/EBPβ2, C/EBPδ1, C/EBPδ2, from the liver. Comparison of the deduced amino acid sequence of rainbow trout C/EBPs with those of other vertebrates revealed that C/EBP isoforms are highly conserved. The profiles of tissue-specific expression of individual C/EBP isoform mRNA, determined by quantitative real-time (RT)-PCR showed distinct patterns. Furthermore, injection of bovine GH into yearling rainbow trout resulted in a significant increase of mRNA levels of C/EBPβ1, C/EBPβ2, and C/EBPδ2 but not C/EBPα and C/EBPδ1 in the liver. GH-dependent increase of mRNA levels of C/EBPβ1, C/EBPβ2, C/EBPδ2, and IGF-II were also confirmed by treating rainbow trout hepatoma cells expressing a goldfish GH receptor with bGH. Together with our previous findings, the results presented in this paper strengthen our previous hypothesis that GH may regulate the expression of the IGF-II gene via mediating the expression of C/EBPβ1, C/EBPβ2, and C/EBPδ2 mRNA.

Introduction

Growth hormone (GH) is a pleiotropic hormone that mediates cellular metabolism, growth, and differentiation by regulating the expression of specific genes ( Schwartz et al. 2002). In mammals, several end target genes controlled by GH have been identified, including serine protease inhibitor 2.1, insulin like growth factors (IGF-I and IGF-II), cytochrome P450 (CYP), alcohol dehydrogenase, and many others ( Huo et al. 2006). GH is known to exert its effect by first binding to the GH receptor (GHR) and then triggering signal transduction cascades resulting in physiological responses ( Argetsinger & Carter-Su 1996). Although several transcription factors were believed to be involved in GH signaling, only a few of them, such as signal transducer and activator of transcription (STAT) or serum response factor are known to act directly as mediators to control the expression of GH-regulated end target genes ( Argetsinger & Carter-Su 1996, Schwartz et al. 2002).

CCAAT/enhancer-binding proteins (C/EBPs) are a family of leucine zipper transcription factors that consists of six members (α,β,γ,δ,ε,ζ), and have been isolated from several animal species since they were first identified ( Landschulz et al. 1988, Ramji & Foka 2002). In teleost fish, five isoforms of C/ EBPs were identified in zebrafish ( Lyons et al. 2001a, b), two in Japanese flounder ( Tucker et al. 2002), and one in rainbow trout ( Fujiki et al. 2003). The C/EBP family proteins share highly conserved C-terminal basic DNA-binding domains and leucine zipper regions among different animal species, and the N-terminal regions have various functional domains among all of the isoforms that account for their distinct functions ( Lekstrom-Himes & Xanthopoulos 1998, Takiguchi 1998, Ramji & Foka 2002, Schrem et al. 2004). C/EBP isoforms are known to play numerous biological functions including cellular differentiation, inflammatory response, liver regeneration, and energy metabolism ( Lekstrom-Himes & Xanthopoulos 1998, Takiguchi 1998, Ramji & Foka 2002, Schrem et al. 2004). A well-studied gene, phosphoenolpyruvate carboxykinase (PEPCK), involved in gluconeogenesis is activated by thyroid hormone, glucocorticoid, and cyclic AMP through the mediation of C/EBPs ( Croniger et al. 1998, Roesler 2001). In 3T3-F442A fibroblast cells, C/EBPβ and C/EBPδ contribute to the GH-regulated transcription of c-fos gene ( Clarkson et al. 1995, Liao et al. 1999).

We previously reported that IGF-I and IGF-II are the target genes regulated by GH, and that C/EBPs could act as mediators for the induction of IGF-II gene expression by GH in rainbow trout ( Shamblott et al. 1995, 1998). To dissect this system further, we report here the isolation and characterization of the cDNA of another four C/EBP isoforms, namely C/EBPα, C/EBPβ2, C/EBPδ1, and C/EBPδ2 from rainbow trout liver RNA. Distinct patterns of tissue-specific expression of C/EBP isoform mRNAs were observed when compared with those of other vertebrates. Results of in vitro studies conducted in rainbow trout hepatoma (RTH) cells ( Chen et al. 2004) expressing the goldfish GHR, together with results of in vivo studies conducted in yearling rainbow trout revealed that levels of C/EBPβ1, C/ EBPβ2, and C/EBPδ2 mRNAs are readily induced by treatment with bovine GH (bGH). These results lend additional evidence that C/EBPs may act as mediators in regulating the expression of the IGF-II gene in rainbow trout by GH. Furthermore, the RTH cells ( Chen et al. 2004) could serve as experimental models for examining the molecular mechanism of GH regulation of the IGF-II gene in teleost fish.

Materials and Methods

Animals

Rainbow trout were obtained from the Salmon Disease Laboratory of Oregon State University, Corvallis, OR, USA. The fish used in this study were 6–12 months old with uniform body weights of 60–180 g and comprise both sexes. They were maintained in the fish facility at the University of Connecticut in tanks with a flow through of fresh water (12–15 °C) under a photoperiod of 12 h light:12 h darkness for a minimum of 2 weeks before use. The fish were fed to satiety, once a day, with commercial trout feed (Melick Aqua Feeds, Catawissa, PA, USA).

Cloning of rainbow trout C/EBP cDNA isoforms and sequence analysis

Sequence information of zebrafish C/EBP isoforms was used to search the rainbow trout expressed sequence tag (EST) database ( Rexroad et al. 2003; http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/gimain.pl?gudb=r_trout). All of the EST sequences under the assigned tentative consensus sequence number with a high degree of similarity to individual C/EBP isoforms were retrieved from Genbank and analyzed by Vector NTI (InforMax, Fredrick, MD, USA) Advance 9.0 suite software (Invitrogen) to determine the open reading frame.

To verify sequence authenticity and acquire the complete coding sequence, total RNA was isolated from rainbow trout liver tissue with TRIzol reagent (Invitrogen) following the protocol provided by the supplier. First strand cDNA was synthesized as described below. For C/EBPα, a 810 bp fragment was amplified by PCR in a total volume of 25 μl using standard buffer conditions as described by the manufacturer (Promega), supplemented with 1.5 mM MgCl2, 120 μM dNTP, 0.4 μM primers, 0.625 units Taq polymerase (Promega), and 1 μl diluted first strand cDNA (Table 1 ). The amplification cycle profile consisted of an initial denaturation step of 1 min at 94 °C, followed by 35 cycles of 10 s each at the denaturation temperature of 94 °C, 10 s at the annealing temperature of 55 °C, and 1 min at 72 °C for synthesis. The PCR fragment was cleaned up by QIAquick PCR Purification Kit (Qiagen) followed by restriction enzyme digestion and cloned into pBluescriptII SK(−) (Stratagene, La Jolla, CA, USA) at HindIII and SalI sites. The nucleotide sequences were determined by using the BigDye terminator cycling sequencing method (Applied Biosystems, Foster City, CA, USA). Based on the partial sequence information, two internal gene specific primers (GSP; Table 1 ) were designed for 3′ rapid amplification of the cDNA ends (RACE). The first strand cDNA used for 3′ RACE was synthesized under the same conditions except using a T17 adaptor primer. GSP1 and T17 adaptor primers were used for first round PCR amplification under conditions described above. The amplification cycle of 1 min at 94 °C, followed by 35 cycles of 10 s each at 94 °C, 10 s at the annealing temperature ranging from 50–60 °C, and 1.5 min at 72 °C was used to determine optimal conditions. The PCR mixture from the first round of PCR at different annealing temperatures was used as the template for the second round of PCR using a second GSP and adaptor primer under identical conditions as described above. The amplification cycle profile consisted of 1 min at 94 °C, followed by 35 cycles of 10 s each at 94 °C, 10 s at 59 °C, and 1.5 min at 72 °C. The PCR products revealed three major bands on an agarose gel and individual fragments were cloned into pBluescriptII SK(−) at ClaI and SalI sites. The longest clone identified was 640 bp with a 190 bp overlap to the 5′ partial sequence. For the cloning of complete coding sequences of individual C/EBP isoforms, high fidelity Deep Vent DNA polymerase (New-England BioLabs, Woburn, MA, USA) was used for PCR in a total volume of 25 μl containing 1X thermal polymerase buffer (NewEngland BioLabs), 120 μM dNTP, 0.4 μM primers (Table 1 ), 0.25 unit of Deep Vent, and 1 μl diluted first strand cDNA. The PCR fragments were cloned into pCDNA 3.1 (+) (Invitrogen), and at least three positive clones for individual C/EBP isoforms were selected for plasmid isolation and sequenced using the BigDye terminator cycling sequencing method.

Multiple amino acid sequence alignments were carried out using ClustalW-based program, AlignX, in Vector NTI Advance 9.0 suite software. The deduced amino acid sequences were subjected to an AlignX analysis to derive sequence identity, and phylogenetic distance among isoforms in different animal species using neighbor-joining method ( Saitou & Nei 1987).

In vivo GH treatment and tissue collection

Two groups of fish weighing about 60 and 200 g were deprived of food for at least 5 days prior to injection with bGH (10 μg/g body weight; USDA-bGH-B-1) dissolved in a carrier solution (10 mM NaHCO3, pH 8.0, and 0.15 M NaCl) or with the carrier solution as controls. Each treatment and time point was done in triplicate. Liver tissues were collected from fish 3 and 6 h after GH treatment, and the samples were snap frozen at −80 °C until further analysis. Tissues samples for a C/EBP tissue distribution study were isolated from juvenile male fish under normal physiological conditions without any treatment.

Cell culture and GH treatment

RTH-1B1A ( Chen et al. 2004) was transfected with a goldfish GHR ( Lee et al. 2001) expression vector by electroporation using gene pulser II (Bio-Rad) under the following conditions: 250 μl of 3 × 106 cells/ml suspension in 0.4 cm cuvette, 725 V/cm field strength, 1000 μF capacitance, low Ω, 60 ms burst duration, 20% modulation, 50 KHz frequency, 6 bursts with 0.5 s burst interval. Permanent transfectants were selected by G418 and single cell cloned. Cells were cultured at 20 °C in L-15 medium (GibcoBRL Invitrogen) supplemented with 10% fetal bovine serum. Prior to hormone treatment, cells were seeded onto a 6-well plate at about 80–90% confluency, the culture medium was changed to serum free L-15 medium after cell attachment, and the cells were starved for 24 h before treatment with various concentrations (50–800 ng/ml) of bGH (USDA-bGH-B-1). Cells were harvested at 6 h after GH treatment.

Measurement of levels of C/EBP mRNA

RNA extraction and reverse transcription

Tissue and cell samples were homogenized in TRIzol reagent (Invitrogen) and total RNA was extracted following manufacturer’s protocol. RNA was dissolved in diethylpyro carbonate (DEPC)-treated water following DNase (RQ1 DNase Promega) digestion. DNase treated RNA samples were extracted again by TRIzol reagent. First strand cDNA was synthesized from 4 μg of tissue total RNA and 3 μg of cell total RNA at 42 °C using Superscript III reverse transcriptase (Invitrogen) and oligo(dT)17 following conditions provided by the supplier.

Measurement of mRNA by real-time PCR analysis

The gene expressions analysis was performed by iCycler iQ real-time PCR detection system (Bio-Rad) using SYBR Green I (BMA, Rockland, ME, USA). The reaction was carried out with three repeats in each sample. Amplification efficiencies were determined by serial diluted cloned standard molecules (standard curve), and controlled above 90% for each pair of primers (Table 1 ) by adjusting conditions (1 × reaction buffer, 0.4 μM primers, 0.2 mM dNTP, 3 mM MgCl2, 0.4 × SYBR Green I, 0.01 μM fluorescence (Bio-Rad) in 25 μl reaction volume) and amplification cycles (95 °C 2 min followed with 50 cycles of 95 °C 10 s; 59 °C 10 s for IGF-II, C/EBPα, C/EBPβ1, C/EBPδ1, 18S rRNA, β-actin or 54 °C for C/EBPβ2, C/EBPδ2; 72 °C 20 s). A melting curve, from 55 °C to 95 °C with 0.5 °C increments at every 10 s, was added after each amplification run to control the possible contamination and primer dimer formation (quality control). Primer specificities between C/EBPβ1and C/EBPβ2 and between C/EBPδ1 and C/EBPδ2 were examined by including reciprocal standard molecules. No cross reaction was detected.

In an assay for the expression of C/EBP genes in different tissues, serial diluted standard molecules were used to determine the absolute cDNA copy number. To account for the differences in cDNA template amount or quality, β-actin expression level was used as control, and a similar level of β-actin mRNA was observed. In GH induction assay, threshold cycles were further analyzed by Q-Gene ( Muller et al. 2002), using equation 3 (The mean normalized gene expression is calculated by averaging the three concomitant threshold cycle values of the target gene and of the reference gene respectively.) and assuming 100% amplification efficiency for both the target genes and housekeeping genes.

Statistical analysis

Data were analyzed by Statistica 7.0 software (Statsoft, Tulsa, OK, USA). The tissue expression data were analyzed by one-way ANOVA followed by Fisher least significant difference test. Data of the in vivo GH induction assay were analyzed by factorial ANOVA followed by Newman–Keuls test. Results of the in vitro GH induction assay were analyzed by a nonparametric sign test. The in vitro GH responsiveness trend line was determined by polynomial regression analysis using Microsoft Excel. P values lower than 0.05 were considered to be significant.

Results

Isolation and sequence analysis of trout C/EBP isoforms

The coding regions of rainbow trout C/EBPα, β2, δ1, and δ2 cDNA were isolated by RT-PCR amplification of the liver RNA and the nucleotide sequences of each C/EBP isoform were determined. The nucleotide sequences of the C/EBP isoforms were submitted to the gene bank with the GenBank numbers: DQ423469 (C/EBPα), DQ423470 (C/EBPβ2), DQ423472 (CEBPδ1), and DQ423471 (C/EBPδ2). Since the nucleotide sequence of the C/EBPβ1 cDNA isolated in this study was identical to that reported earlier ( Fujiki et al. 2003), we did not submit this sequence to the gene bank. A comparison of sequence similarity and identity of the deduced amino acid sequence revealed that all of the rainbow trout C/EBP isoforms shared high degrees of sequence identity (C/EBPα, 69.5%; C/ EBPβ1, 63.1%; C/EBPβ2, 65.8%; C/EBPδ1, 57.1%; C/EBPδ2, 55.7%) with the C/EBP isoforms of zebrafish but lower degrees with those of frog, chicken, rat, and human (Table 2 ). In rainbow trout, the sequence identity between C/ EBPβ1 and C/EBPβ2 is 86.1% and between C/EBPδ1 and C/EBPcδ2 is 83.5%. Since C/EBPβ1, C/EBPβ2, C/EBPδ1, and C/EBPδ2 cDNAs were isolated from the liver RNA sample prepared from an individual fish and the differences in nucleotide sequences among C/EBPβ1 and C/EBPβ2 or C/ EBPδ1 and C/EBPδ2 disperse through the entire molecule, it is unlikely that C/EBPβ and C/EBPδ isoforms are derived from single C/EBPβ and C/EBPδ genes.

Figure 1A–C depicts the alignment of the deduced amino acid sequence of C/EBP isoforms of rainbow trout, zebrafish, frog, chicken, rat, and human. Data of the alignment showed that trout C/EBP isoforms shared a high degree of sequence conservation in the basic DNA-binding regions (BR-A, BR-B) and the leucine zipper domain with C/EBPs of zebrafish, frog, chicken, rat, and human (Fig. 1A–C ). While the last leucine in the leucine zipper was replaced by a threonine in rainbow trout C/EBPβ1 and C/EBPβ2, the last leucine in the leucine zipper in trout C/EBPδ1 and C/EBPδ2 remained conserved. The consensus sequence of boxA and boxB, the transactivator regions ( Nerlov & Ziff 1995), was also identified in the N-termini of the trout C/EBPα, C/EBPδ1, and C/EBPδ2. Similar to zebrafish, the boxB of trout C/EBPβ1 and C/EBPβ2 have deviated from the conserved consensus sequence. Like in many animal species studied to date, regions including the PT region (proline–threonine rich), PS region (proline–serine rich), and PR region (proline rich) are also identified in trout C/ EBPα, C/EBPβ, and C/EBPδ isoforms.

The ATG codon of the trout C/EBPβ1 and C/EBPβ2 corresponds to a shorter isoform of the mammalian homolog termed liver-enriched transcriptional activator protein (LAP). However, there is no start codon corresponding to the longer isoform of the mammalian homolog LAP* (long form LAP) in trout C/EBPβ isoforms. It is interesting to note that trout C/EBPβ1 and C/EBPβ2 isoforms also contain an internal translation initiation codon corresponding to the mammalian homolog LIP ( Descombes & Schibler 1991, Xiong et al. 2001). Two major protein products (p42 and p30) were shown to be translated from a single C/EBPα mRNA in rat ( Lin et al. 1993, Ossipow et al. 1993), however, the internal translation site for p30 is not in a relevant position in rainbow trout C/EBPα (Fig. 1A ). Furthermore, a synergy control (SC) motif was found in C/EBPα, and a consensus sequence of the small ubiquitin-related modifier (SUMO) was found in C/EBPα and C/EBPδ (Fig. 1A and C ). Although the functions of SC and SUMO in rainbow trout remain to be determined, SUMO is known to control the interaction among transcription factors ( Subramanian et al. 2003) and SC limits the transcriptional synergy with other DNA-binding regulators in mammals ( Iniguez-Lluhi & Pearce 2000). A unique histidine–glutamine variable region (HQV) was identified in trout C/EBPα (Fig. 1A ). This HQV region has various lengths and compositions of histidine and glutamine in the clones that we isolated (Fig. 1A inset), and its functional significance remains to be determined. Of the serine and threonine phosphorylation consensus sites (i.e. Ser248, Ser277, Ser299, Ser230, Thr222, and Thr226) found in rat C/ EBPα ( Mahoney et al. 1992), only Ser299, Ser230, Thr222, and Thr226 were identified in trout C/EBPα. Furthermore, three phosphorylation sites in C/EBPβ (i.e. mouse Ser184 ( Piwien-Pilipuk et al. 2001), human Thr235 ( Nakajima et al. 1993), and Rat Ser240 ( Trautwein et al. 1994)) known to be phosphorylated by glycogen synthase kinase 3β (GSK3β), mitogen activated protein kinase (MAPK), and protein kinase A plus protein kinase C, were identified in both isoforms of rainbow trout C/EBPβ, but mouse Thr217 and rat Ser105 sites ( Buck et al. 1999; Fig. 1B ) were absent in trout C/EBPβ. A calmodulin-dependent protein kinase II phosphorylation site originally identified in mammalian C/EBPβ ( Wegner et al. 1992) was found to exist in rainbow trout C/EBPδ1 but not in rainbow trout C/EBPδ2 (Fig. 1C ).

A small upstream open reading frame (uORF) was identified in rainbow trout C/EBPα, C/EBPβ1 ( Fujiki et al. 2003), and C/EBPβ2, upstream of the initiation codon ATG of P42 and LAP (Fig. 2 ). While the uORP of C/EBPα, encoding a small peptide of five amino acid residues, stops at seven nucleotides preceding the translational start site, the uORF of C/EBPβ, encoding a peptide of eight amino acid residues, stops at five nucleotides preceding the translational start site.

Levels of C/EBP isoform mRNA in different tissues

The levels of C/EBP isoform mRNA in 13 different tissues of male rainbow trout were determined by quantitative real-time PCR analysis and the results were expressed as the number of copies of mRNA per 1 μg total RNA. As shown in Fig. 3A , high levels of C/EBPα mRNA were detected in the kidney, spleen, gill, and pancreas, and low levels were detected in the liver, pyloric ceca, heart, and testis. While high levels of C/EBPβ1 and C/EBPβ2 mRNA (Fig. 3B and C ) were detected in the liver, consistent with findings by other investigators ( Fujiki et al. 2003), no C/EBPβ2 mRNA was detected in muscle, blood cells and the pituitary gland. High levels of C/EBPδ1 and C/EBPδ2 mRNA were detected in gill and pancreas, moderate levels in liver, kidney, muscle, heart, pyloric ceca, spleen, and testis, and low levels in blood cells, brain, and the pituitary gland (Fig. 3D and E ).

In vivo and in vitro induction of mRNA of C/EBP isoforms in the rainbow trout liver and trout hepatoma cells (RTH-1B1A)

Previous studies conducted in our laboratory ( Shamblott et al. 1998) showed that the immunoreactive materials specific to rat C/EBPα and C/EBPβ antibodies were induced in the nuclear fraction of the rainbow trout liver after treatment with bGH. These results suggest that the expression of C/EBP isoforms in the rainbow trout liver may be regulated by GH. To verify these results, the mRNA levels of C/EBP isoforms and IGF-II in the liver were determined following administration with the same dose of bGH used previously ( Shamblott et al. 1995) to yearling juvenile and 2-year adult fish. Levels of IGF-II mRNA increased two- to threefold at 3 and 6 h post bGH administration (data not shown), which confirmed the results of our previous studies ( Shamblott et al. 1995). While 2-year-old fish showed an obvious increase of C/EBPβ2 and C/EBPδ2 mRNA levels at 3 h after bGH treatment, yearling juvenile fish showed an increase of both mRNA levels at 3 and 6 h following hormone treatment (Fig. 4A and B ). Although a significant increase in C/EBPβ1 mRNA levels was observed in 2-year-old fish at 3 and 6 h following GH treatment, the same increase of C/EBPβ1 mRNA was only observed in yearling juvenile fish at 6 h after hormone treatment. It is interesting to note that bGH may suppress the level of C/EBPα mRNA in adult fish 6 h after bGH treatment (Fig. 4A ).

We have shown previously that, although RTH cells expressed GHR2 gene ( Chen et al. 2004, Very et al. 2005), we failed to demonstrate the GH responsiveness in these cells. To restore the ability of the RTH 1B1A cells to GH signaling, a goldfish GHR expression vector was introduced into RTH 1B1A cells by electroporation, and permanent transformants isolated. By treating RTH-1B1A-gfGHR transformants with 50–800 ng/ml bGH for 6 h, a dose-dependent increase of the levels of IGF-II, C/EBPβ1, C/EBPβ2, and C/EBPδ2 mRNA was observed (Fig. 5 ). The maximal level of induction (2- to 2.5-fold) for IGF-II was at 600–800 ng/ml bGH, while maximum levels of induction (2.5- to 3-fold) for C/EBPβ2 and C/EBPδ2 were at 300–600 ng/ml bGH. However, a lower level of induction (about 1.5 -fold) of βC/ EBPβ1 mRNA was observed at 50–300 ng/ml bGH. C/ EBPα and C/EBPδ1 mRNA expression was not responsive to bGH treatment in these studies (results not shown).

Discussion

The family of C/EBPs identified in many animal species consist of six members (α,β,γ,δ,ε,ζ), which contain a basic DNA-binding region and a leucine-zipper domain (bZIP motif) in their C-termini. Both domains have high sequence similarity among the six members ( Ramji & Foka 2002). In this study, we cloned C/EBPα, β1, β2, δ1, and δ2 cDNA by RT-PCR amplification of liver RNA, and phylogenetic analysis showed that these C/EBP isoforms cluster with the corresponding isoforms of other animal species ( Xu & Tata 1992, Antonson & Xanthopoulos 1995, Calkhoven et al. 1997, Lyons et al. 2001a, Tucker et al. 2002), clearly indicating that we have indeed isolated rainbow trout C/EBP orthologs. Data from the amino acid sequence alignment analysis showed that trout C/EBP isoforms shared a high degree of sequence conservation on the basic DNA-binding region (BR-A, BR-B), the leucine zipper domain, and the domains of the proline–threonine rich region (PT rich region), proline–serine rich region (PS rich region), and proline rich region (PR region) with C/EBPs of zebrafish, frog, chicken, rat, and human ( Lyons et al. 2001a). Although the consensus sequence of boxA and boxB, the transactivator regions ( Nerlov & Ziff 1995), was identified in the N-termini of the C/EBPα, C/EBPδ1, and C/EBPδ2 of trout (in the present study) and zebrafish ( Lyons et al. 2001a), boxB of the trout C/EBPβ1 and C/EBPβ2 has deviated from the conserved consensus sequence of the other animal species ( Nerlov & Ziff 1995, Fujiki et al. 2003).

C/EBPs are known to have a variety of functions in immune responses, growth, and development in many organisms ( Schrem et al. 2004). Although the functions of trout C/EBP isoforms await determination, identification of a C/EBP-like sequence and the conserved consensus sequence in rainbow trout indicates that the functions of these transcription factors may be highly conserved in organisms of different phylogenetic positions. The presence of highly conserved basic leucine zipper regions among C/ EBPs of various animal species indicate that these regions recognize cognate DNA sequences and exert similar functions among vertebrates ( Osada et al. 1996). It is known that C/ EBP isoforms form homodimers within each isomer or heterodimers with other isoforms or with other families of leucine zipper proteins ( Vinson et al. 1989, Williams et al. 1991, Osada et al. 1996). Since the essential functional domains are nearly identical between C/EBPβ1 and C/ EBPβ2, and between C/EBPδ1 and C/EBPδ2, it is likely that these C/EBP isomers exhibit similar functions on their targets. It is interesting to note that, although we failed to identify more than one type of C/EBPα mRNA in several rainbow trout individuals, we have identified several cDNA clones of C/EBPα with different lengths and compositions of a short stretch of peptide (12–13 amino acid residues rich in glutamine and histidine) from each individual animal. Although this characteristic is unique in rainbow trout and not found in zebrafish C/EBPα, its functional significance requires further investigation.

C/EBPα and C/EBPβ mRNAs from many species contain a short uORF immediately upstream of the major translation start site ( Morris & Geballe 2000). These uORFs function as cis-acting elements and regulate alternative translational initiation resulting in the production of various lengths of truncated isoforms ( Calkhoven et al. 1994, 2000, Lincoln et al. 1998, Morris & Geballe 2000, Xiong et al. 2001). In our study, an equivalent length uORF is also found in rainbow trout C/EBPα (Fig. 2 ). The highly conserved structure of uORF in C/EBPα across different vertebrate species very likely suggests that C/EBPα protein expression is subjected to the regulation of the uORF in rainbow trout. The uORF of C/EBPβ2 has the same structure as that of C/EBPβ1 (Fig. 2 ; Fujiki et al. 2003). In both zebrafish ( Lyons et al. 2001a) and Japanese flounder ( Tucker et al. 2002), there is no appropriate start codon for the uORF, although a termination codon for a potential uORF can be found in the same position (5 bp upstream of the start codon for LAP) as that of rainbow trout ( Fujiki et al. 2003). Since trout and zebrafish are phylogenetically closer to each other than trout to Japanese flounder, the finding of a uORF in trout that lacks LAP*, together with zebrafish and Japanese flounder that both lack the uORF, suggests that the LAP* has evolved after the formation of the uORF ( Fujiki et al. 2003). The partly conserved feature of the uORF in rainbow trout C/EBPβ with that of other teleost fish and tetrapods may also imply that C/EBPβ protein expression in rainbow trout is under the regulation of the uORF, but differs from that in tetrapods since the distance between the uORF stop codon and the ORF initiating codon (five bases in teleost fish and four bases in other vertebrates) is important for translational regulation ( Lincoln et al. 1998).

In mammals, chicken, frogs, and fish ( Xu & Tata 1992, Antonson & Xanthopoulos 1995, Calkhoven et al. 1997, Lyons et al. 2001a, Tucker et al. 2002), C/EBPα and C/EBPβ isoform mRNAs are expressed in the liver, intestine, adipocyte, and other tissues. We have shown in this study that high levels of C/EBPα, C/EBPβ, and C/EBPδ isoform mRNAs were detected in the liver, kidney, spleen, and gills of rainbow trout. Furthermore, reasonably high levels of C/ EBPδ isoform mRNA were detected in muscle, pyloric ceca, heart, pancreas, and testis. Since the expression of PEPCK and glycogen synthase genes in the liver is known to be regulated mainly by C/EBPα ( Croniger et al. 1998, Roesler 2001, Desvergne et al. 2006), finding high levels of C/EBPβ and C/EBPδ mRNAs suggest that these isoforms may play important roles in the trout liver. It has been reported by many investigators that C/EBPβ plays an important role in the inflammatory response ( Poli 1998), and in mice, the same protein is also involved in regulating acute phase protein genes such as serum amyloid A, serum amyloid P, and complement C3 ( Poli 1998). One would, therefore, expect that C/EBPβ isoform plays an important role in regulating the rainbow trout orthologs of these genes. The finding that high levels of C/EBPβ and C/EBPδ isoforms mRNAs are present in immunologically important organs such as the head kidney, posterior kidney, spleen, and liver in rainbow trout supports this hypothesis.

It has been shown with conflicting results that the expression of C/EBPα mRNA in mammals is regulated by GH ( Vidal et al. 1997, Rastegar et al. 2000a, b, Strand et al. 2000, Eleswarapu & Jiang 2005). In our study, we showed that, although the expressions of C/EBPα in the rainbow trout liver and in RTH cells are not responsive to induction by GH, the level of C/EBPα mRNA decreased in adult fish at 6 h post GH injection. Thus, it is possible that GH regulation on C/EBPα mRNA in the rainbow trout liver could be time dependent and under subtle control of other factors as in mammalian systems ( Vidal et al. 1997, Rastegar et al. 2000a, b). It is known that hepatocytes need to be cultured on extracellular matrix for the expression of many liver-specific genes and maintenance of a normal hepatic phenotype ( Schuetz et al.1988, DiPersio et al. 1991, Rana et al. 1994). Our initial studies failed to demonstrate that the RTH cell lines established in our laboratory responded to GH treatment, although these cells expressed the GHR2 gene ( Chen et al. 2004). However, after transfecting a gene construct containing a goldfish GHR cDNA driven by a CMV promoter into RTH cells, the permanent transformants (RTH-1B1A-gfGHR cells) responded to GH treatment by expressing IGF-II, C/EBPβ1, C/EBPβ2, and C/EBPδ2 genes. To our knowledge, this is the first report of GH induction of C/EBPβ1, C/EBPβ2, and C/EBPδ2 gene expression in teleost fish. GH is known to transmit its signal to target genes by at least four pathways, namely phosphoinositide-3 kinase (PI3K), STAT, phosphatidylinositol bisphosphate (PIP2)-Ca2+, and MAPK in mammalian systems ( Argetsinger & Carter-Su 1996). These pathways are implicated by other growth factors and cytokines. It has been demonstrated that GH can regulate C/EBPβ through the PI3K pathway by activating serine–threonine kinase (Akt) and inhibiting GSK-3 phosphorylation leading to the dephosphorylation of C/EBPβ and increase of DNA-binding activity ( Piwien-Pilipuk et al. 2001). GH-mediated phosphorylation of C/EBPβ through MAPK is required for C/EBPβ transcriptional activity ( Piwien-Pilipuk et al. 2002). Furthermore, it has been shown that GH-dependent MAPK activation plays a role in the regulation of nuclear relocalization of C/EBPβ ( Pilipuk et al. 2003). Since information about GH signaling in fish is scarce, the RTH cell lines will serve as a good comparative model.

Following GH treatment, Shamblott et al.(1998) detected the increase of C/EBPα and C/EBPβ proteins in the nuclei of rainbow trout liver cells using antibodies raised against rat C/EBPα and C/EBPβ as probes. However, in our study, we showed that the mRNAs of C/EBPβ1, C/EBPβ2, and C/EBPδ2 were readily induced in the trout liver or RTH cells after treatment with GH, but not the mRNA of C/EBPα. Since the rat anti-CEBPα antiserum used by Shamblott et al.(1998) was raised with a fragment of rat CEBPα (14 amino acid residues) as an antigen, of which only two amino acid residues are identical to the corresponding region of the trout C/EBPα, the observed discrepancy could be the consequence of low specificity of the rat C/EBPα antiserum to the trout C/EBPα polypeptide. In the electro phoretic mobility shift assay (EMSA) assay, Shamblott et al.(1998) showed that treatment of fish with GH resulted in an increase of C/EBP proteins bound to the rainbow trout C/EBP-binding sites residing on the proximal promoter region of the IGF-II gene. This increase of binding activity could be the consequence of upregulation of C/EBP isoform mRNA induced by GH, dephosphorylation of C/EBP isoform or the combination of both. Nevertheless, GH is known to regulate C/EBP at multiple levels including the increase of mRNA levels, and synthesis and phosphorylation of C/EBP proteins ( Liao et al. 1999, Strand et al. 2000, Piwien-Pilipuk et al. 2001, 2002, Schwartz et al. 2002). It has been shown that GH regulates the expression of CYP2C12 via the mediation of C/EBPs ( Tollet et al. 1995), and C/EBP trans-activates the IGF-II promoter in human and chum salmon ( Rodenburg et al. 1995, Palamarchuk et al. 2001). It is conceivable that the expression of the IGF-II gene in rainbow trout could be mediated via GH induction of C/EBPs. However, the molecular mechanism which underlies the regulation of IGF-II gene expression via the mediation of C/EBP proteins remains to be investigated.

In summary, we have isolated the cDNA of C/EBPα, C/EBPβ, and C/EBPδ isoforms from rainbow trout, and showed tissue-specific expression of these mRNAs. Furthermore, studies conducted in the whole animal as well as in trout hepatoma cells (RTH) confirmed that the expression of C/EBPβ1, C/EBPβ2, and C/EBPδ2 mRNAs were regulated by GH. The results presented in this paper, together with those reported by Shamblott et al.(1998) suggest that the RTH cells may serve as an ideal system for elucidating the relationships of GH regulation of C/EBP isoform and IGF-II genes at the molecular level in teleost fish.

Table 1

List of primers used in this study

Sequence (5′–3′)Function
F, forward primer; R, reverse primer; RACE, rapid amplification of cDNA ends; 18 S rRNA, 18 S ribosomal RNA GenBank number: C/EBPα, DQ423469; C/EBPβ1, AY144611; C/EBPβ2, DQ423470; C/EBPδ1, DQ423472; C/EBPδ2, DQ423471; IGF-II, M95184; β-actin, AJ438158; 18S rRNA, AF308735.
Gene
C/EBPαF: AGCTAAGCTTCCGCAGCTCCTCACCInitial partial cDNA sequence cloning and complete coding sequence cloning
R: GTTCCTCTCCCGCCTCAACCGInitial partial cDNA sequence cloning
F: ACGACCGAGACCGAGACCGAGACGene specific primer 2 for 3′ RACE
R: GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTTT17 adaptor primer for 3′ RACE
R: GACTCGAGTCGACATCGAdaptor primer for 3′ RACE
R: TCCACTCGAGGTGTACAAGTAAGTGComplete coding sequence cloning
F: TGTGGCGATAAAGCAAGAGCGene specific primer 1 for 3′ RACE and real-time PCR
R: CTGGTGGGAATGGTGGTAGGReal-time PCR
C/EBPβ1F: AGAATGGACAACGGTTCAACReal-time PCR
R: CGTGCATTTACCTGACAGTGReal-time PCR
C/EBPβ2F: GGTGTTAAGCTTCATGGAAGTGGComplete coding sequence cloning
R: TGAGCTCGAGGTTGGCATTCTGTAGComplete coding sequence cloning
F: AAAGAATGGACAACAACGReal-time PCR
R: CCTTTACCTGGCGTGGCAReal-time PCR
C/EBPδ1F: CCCAGGATCCCAGAAAGCAGAGTTCComplete coding sequence cloning
R: GCCTCTCGAGTCCAGTACATTTCCAGTGComplete coding sequence cloning
F: CACAGATAGAAACCTGCGACReal-time PCR
R: GCTGACACTGGAGTGGCTTGReal-time PCR
C/EBPδ2F: CCCAGGATCCCAGAAAGCAGAGTTCComplete coding sequence cloning
R: GCCTCTCGAGTCCAGTACATTTCCAGTGComplete coding sequence cloning
F: CCAGATCAAAAACTGCGReal-time PCR
R: AGGAGTGGGCTGATTGGCTTReal-time PCR
IGF-IIF: CGGCAGAAACGCTATGTGGAReal-time PCR
R: TGCTGGTTGGCCTACTGAAAReal-time PCR
β-ActinF: GGCTTCTCTCTCCACCTTCCReal-time PCR
R: AGGGACCAGACTCGTCGTACReal-time PCR
18S rRNAF: CGGAGGTTCGAAGACGATCAReal-time PCR
R: TCGCTAGTTGGCATCGTTTATReal-time PCR
Table 2

Amino acid identities (%) among CCAAT/enhancer-binding proteins (C/EBPs) of rainbow trout and other representative vertebrates

C/EBPαC/EBPβ1C/EBPβ2C/EBPδ1C/EBPδ2Accession number
RT, rainbow trout; Ze, zebrafish; JF, Japanese flounder; X, African clawed frog; Ch, chicken; Hu, human.
Organism
RT C/EBPαABD84406
RT C/EBPβ126.5AAN41660
RT C/EBPβ226.886.1ABD84407
RT C/EBPδ129.625.226.9ABD84409
RT C/EBPδ226.725.921.683.5ABD84408
Ze C/EBPα69.528.127.829.428.1AAL54864
Ze C/EBPβ2863.165.826.225.8AAL54865
Ze C/EBPδ29.721.621.257.155.7AAL54866
JP C/EBPβ2436.236.723.624.2AB40971
X C/EBPα532929.730.830.4AAB23276
X C/EBPβ27.737.738.12726.4CAA76309
X C/EBPδ128.825.223.947.547.5BAC92757
X C/EBPδ228.122.523.247.347BAC92758
Ch C/EBPα56.525.326.729.629CAA47320
Ch C/EBPβ31.837.738.129.128.8AAO39751
Hu C/EBPα49.926.828.525.524.9CAA72289
Hu C/EBPβ2831.931.625.624.5AAN86350
Hu C/EBPδ26.924.521.24341.2NP_005186
Figure 1
Figure 1Figure 1

Comparison of the deduced amino acid sequences of rainbow trout C/EBPs with those of other vertebrate species. Gaps were introduced to maximize the homology among C/EBP sequences. Identical residues at a given position were coded with white letters on the black background; consensus residues derived from the occurrence of 50% of a single residue at a given position were coded with white letters on the gray background. Consensus residues derived from a block of similar residues at a given position were coded with black letters on gray background. Boxed sequences indicate conserved functional domains, Box A and Box B, transactivation domains; BR-A and BR-B, basic DNA-binding domains; leucine zipper, conserved leucine residues indicated by black triangles pointing downward; potential phosphorylation sites, marked by asterisks with species names and positions; NLS, nuclear localization signal; and SUMO, small ubiquitin-related modifier consensus site. (A) C/EBPα alignment. PT, proline–threonine rich region; SC, synergy conserved motif; and HQV, histidine–glutamine variable region. Arrows marked with p42 and p30 indicate different translation start sites in human and rat, and the inset (HQV) presents various clones isolated from an individual fish in this study. (B) C/EBPβ alignment. PS, proline–serine rich region; Arrows marked with LAP*, LAP, and LIP indicating different translation start sites. (C) C/EBPδ alignment. PR, praline rich region; CaMKII, potential calmodulin-dependent protein kinase II phosphorylation site.

Citation: Journal of Endocrinology 194, 2; 10.1677/JOE-07-0085

Figure 2
Figure 2

Alignment of the deduced amino acid sequence encoded by the open reading frame residing in the 5′-untranslated region of various C/EBP mRNAs. The conserved upstream open reading frames (uORF) were boxed and the major translational start site was shadowed gray. (A) C/EBPα, (B) C/EBPβ1, and C/EBPβ2. The putative stop codons in teleost fish located at five nucleotides upstream of the major translational start site or a relevant position in the case of Japanese flounder were coded with white letters on the black background. The translational start site of Japanese flounder C/EBPβ is located further upstream and not shown here.

Citation: Journal of Endocrinology 194, 2; 10.1677/JOE-07-0085

Figure 3
Figure 3

PCR analysis. Real-time RT-PCR analysis was used to determine the absolute copy numbers for individual C/EBP isoform mRNA in the liver (Liv), head kidney (HK), posterior kidney (PK), spleen (Spl), gill (Gi), muscle (Mu), pyloric ceca (PyC), blood (Bld), brain (Brn), pituitary (Pit), heart (Hrt), pancreas (Pan), and testis (Tes). (A) C/EBPα, (B) C/EBPβ1, (C) C/EBPβ2, (D) C/EBPδ1, (E) C/EBPδ2. ND, non-detected. Each data point is presented as mean ± s.d. (n = 2). Different lowercase letters indicate significant differences among different tissues (P < 0.05).

Citation: Journal of Endocrinology 194, 2; 10.1677/JOE-07-0085

Figure 4
Figure 4

Expression of C/EBP isoform mRNA in rainbow trout treated with bovine growth hormone in vivo. Fishes were starved for 5 days and injected with 10 μg bGH/g body weight or carrier solution for 3 and 6 h. Livers were collected from hormone treated and control fish and immediately frozen on dry ice. The levels of C/EBP mRNA expression were determined by real-time RT-PCR and normalized to β-actin. The expression level of 3 h control was arbitrarily set to 1. (A) Adult fish (average weight 200 g); (B) Juvenile fish (average weight 60 g). Each data point is expressed as mean ± s.d. (n = 3). Different letters indicate significant differences among different treatments and different time points (P < 0.05).

Citation: Journal of Endocrinology 194, 2; 10.1677/JOE-07-0085

Figure 5
Figure 5

Expression of C/EBP isoform mRNA in trout hepatoma cells in response to GH treatment. RTH cells were starved for 24 h in serum-free medium and treated with various doses of bGH for 6 h. Each treatment was performed in triplicate and individual experiments were repeated thrice. Relative expression levels of C/EBP mRNA were normalized to 18 S rRNA. The expression level of the control sample (i.e. without bGH treatment) was arbitrarily set to 1. (A) IGF-II, (B) C/EBPβ1, (C) C/EBPβ2, (D) C/EBPδ2. Each data point is expressed as mean ± s.d. (n = 3). Asterisks indicate mRNA levels at different bGH doses that are significantly different from control (P < 0.05).

Citation: Journal of Endocrinology 194, 2; 10.1677/JOE-07-0085

This work was supported by grants from the National Science Foundation (IBN-0078067) and US Department of Agriculture (CONS-9803641) to T T Chen. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.

References

  • Antonson P & Xanthopoulos KG 1995 Molecular cloning, sequence, and expression patterns of the human gene encoding CCAAT/enhancer binding protein α (C/EBPα). Biochemical and Biophysical Research Communications 215 106–113.

    • Search Google Scholar
    • Export Citation
  • Argetsinger LS & Carter-Su C 1996 Mechanism of signaling by growth hormone receptor. Physiological Reviews 76 1089–1107.

  • Buck M, Poli V, van der Geer P, Chojkier M & Hunter T 1999 Phosphorylation of rat serine 105 or mouse threonine 217 in C/EBP β is required for hepatocyte proliferation induced by TGF α. Molecular Cell 4 1087–1092.

    • Search Google Scholar
    • Export Citation
  • Calkhoven CF, Bouwman PRJ, Snippe L & Ab G 1994 Translation start site multiplicity of the CCAAT/enhancer binding protein alpha mRNA is dictated by a small 5′ open reading frame. Nucleic Acids Reserach 22 5540–5547.

    • Search Google Scholar
    • Export Citation
  • Calkhoven CF, Gringhuis SI & Ab G 1997 The chicken CCAAT/enhancer binding protein α gene. Cloning, characterisation and tissue distribution. Gene 196 219–229.

    • Search Google Scholar
    • Export Citation
  • Calkhoven CF, Muller C & Leutz A 2000 Translational control of C/EBPα and C/EBPβ isoform expression. Genes and Development 14 1920–1932.

    • Search Google Scholar
    • Export Citation
  • Chen MJ, Chiou PP, Yang B-Y, Lo HC, Son J-K, Hendricks J, Bailey G & Chen TT 2004 Development of rainbow trout hepatoma cell lines: effect of pro-IGF-I EA4-peptide on morphological changes and anchorage-independent growth. In Vitro Cellular and Developmental Biology. Animal 40 118–128.

    • Search Google Scholar
    • Export Citation
  • Clarkson RW, Chen CM, Harrison S, Wells C, Muscat GE & Waters MJ 1995 Early responses of trans-activating factors to growth hormone in preadipocytes: differential regulation of CCAAT enhancer-binding protein-β (C/EBP β) and C/EBP δ. Molecular Endocrinology 9 108–120.

    • Search Google Scholar
    • Export Citation
  • Croniger C, Leahy P, Reshef L & Hanson RW 1998 C/EBP, and the control of phosphoenolpyruvate carboxykinase gene transcription in the liver. Journal of Biological Chemistry 273 31629–31632.

    • Search Google Scholar
    • Export Citation
  • Descombes P & Schibler U 1991 A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67 569–579.

    • Search Google Scholar
    • Export Citation
  • Desvergne B, Michalik L & Wahli W 2006 Transcriptional regulation of metabolism. Physiological Reviews 86 465–514.

  • DiPersio CM, Jackson DA & Zaret KS 1991 The extracellular matrix coordinately modulates liver transcription factors and hepatocyte morphology. Molecular and Cellular Biology 11 4405–4414.

    • Search Google Scholar
    • Export Citation
  • Eleswarapu S & Jiang H 2005 Growth hormone regulates the expression of hepatocyte nuclear factor-3 γ and other liver-enriched transcription factors in the bovine liver. Journal of Endocrinology 184 95–105.

    • Search Google Scholar
    • Export Citation
  • Fujiki K, Gerwick L, Bayne CJ, Mitchell L, Gauley J, Bols N & Dixon B 2003 Molecular cloning and characterization of rainbow trout (Oncorhynchus mykiss) CCAAT/enhancer binding protein β. Immunogenetics 55 253–261.

    • Search Google Scholar
    • Export Citation
  • Huo JS, McEachin RC, Cui TX, Duggal NK, Hai T, States DJ & Schwartz J 2006 Profiles of growth hormone (GH)-regulated genes reveal time-dependent responses and identify a mechanism for regulation of activating transcription factor 3 by GH. Journal of Biological Chemistry 281 4132–4141.

    • Search Google Scholar
    • Export Citation
  • Iniguez-Lluhi JA & Pearce D 2000 A common motif within the negative regulatory regions of multiple factors inhibits their transcriptional synergy. Molecular and Cellular Biology 20 6040–6050.

    • Search Google Scholar
    • Export Citation
  • Landschulz WH, Johnson PF, Adashi EY, Graves BJ & McKnight SL 1988 Isolation of a recombinant copy of the gene encoding C/EBP. Genes and Development 2 786–800.

    • Search Google Scholar
    • Export Citation
  • Lee LTO, Nong G, Chan YH, Tse DLY & Cheng CHK 2001 Molecular cloning of a teleost growth hormone receptor and its functional interaction with human growth hormone. Gene 270 121–129.

    • Search Google Scholar
    • Export Citation
  • Lekstrom-Himes J & Xanthopoulos KG 1998 Biological role of the CCAAT/enhancer-binding protein family of transcription factors. Journal of Biological Chemistry 273 28545–28548.

    • Search Google Scholar
    • Export Citation
  • Liao J, Piwien-Pilipuk G, Ross SE, Hodge CL, Sealy L, MacDougald OA & Schwartz J 1999 CCAAT/enhancer-binding protein β (C/EBPβ) and C/EBPδ contribute to growth hormone-regulated transcription of c-fos. Journal of Biological Chemistry 274 31597–31604.

    • Search Google Scholar
    • Export Citation
  • Lin F, MacDougald OA, Diehl AM & Lane MD 1993 A 30-kDa, alternative translation product of the CCAAT/enhancer binding protein α message: transcriptional activator lacking antimitotic activity. PNAS 90 9606–9610.

    • Search Google Scholar
    • Export Citation
  • Lincoln AJ, Monczak Y, Williams SC & Johnson PF 1998 Inhibition of CCAAT/enhancer-binding protein α and β translation by upstream open reading frames. Journal of Biological Chemistry 273 9552–9560.

    • Search Google Scholar
    • Export Citation
  • Lyons SE, Shue BC, Lei L, Oates AC, Zon LI & Liu PP 2001a Molecular cloning, genetic mapping, and expression analysis of four zebrafish C/EBP genes. Gene 281 43–51.

    • Search Google Scholar
    • Export Citation
  • Lyons SE, Shue BC, Oates AC, Zon LI & Liu PP 2001b A novel myeloid-restricted zebrafish CCAAT/enhancer-binding protein with a potent transcriptional activation domain. Blood 97 2611–2617.

    • Search Google Scholar
    • Export Citation
  • Mahoney CW, Shuman J, McKnight SL, Chen HC & Huang KP 1992 Phosphorylation of CCAAT-enhancer binding protein by protein kinase C attenuates site-selective DNA binding. Journal of Biological Chemistry 267 19396–19403.

    • Search Google Scholar
    • Export Citation
  • Morris DR & Geballe AP 2000 Upstream open reading frames as regulators of mRNA translation. Molecular and Cellular Biology 20 8635–8642.

  • Muller PY, Janovjak H, Miserez AR & Dobbie Z 2002 Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 32 1372–1379.

    • Search Google Scholar
    • Export Citation
  • Nakajima T, Kinoshita S, Sasagawa T, Sasaki K & Naruto M 1993 Phosphorylation of threonine-235 by a ras-dependent mitogen-activated protein kinase cascade is essential for transcription factor NF-IL6. PNAS 90 2207–2211.

    • Search Google Scholar
    • Export Citation
  • Nerlov C & Ziff EB 1995 CCAAT/enhancer binding protein-α amino acid motifs with dual TBP and TFIIB binding ability co-operate to activate transcription in both yeast andmammalian cells. EMBO Journal 14 4318–4328.

    • Search Google Scholar
    • Export Citation
  • Osada S, Yamamoto H, Nishihara T & Imagawa M 1996 DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family. Journal of Biological Chemistry 271 3891–3896.

    • Search Google Scholar
    • Export Citation
  • Ossipow V, Descombes P & Schibler U 1993 CCAAT/enhancer-binding protein mRNA is translated into multiple proteins with different transcription activation potentials. PNAS 90 8219–8223.

    • Search Google Scholar
    • Export Citation
  • Palamarchuk AY, Kavsan VM, Sussenbach JS & Holthuizen PE 2001 The chum salmon insulin-like growth factor II promoter requires Sp1 for its activation by C/EBPβ. Molecular and Cellular Endocrinology 172 57–67.

    • Search Google Scholar
    • Export Citation
  • Pilipuk GP, Galigniana MD & Schwartz J 2003 Subnuclear localization of C/EBPβ is regulated by growth hormone and dependent on MAPK. Journal of Biological Chemistry 278 35668–35677.

    • Search Google Scholar
    • Export Citation
  • Piwien-Pilipuk G, Van Mater D, Ross SE, MacDougald OA & Schwartz J 2001 Growth hormone regulates phosphorylation and function of CCAAT/enhancer-binding protein β by modulating Akt and glycogen synthase kinase-3. Journal of Biological Chemistry 276 19664–19671.

    • Search Google Scholar
    • Export Citation
  • Piwien-Pilipuk G, MacDougald O & Schwartz J 2002 Dual regulation of phosphorylation and dephosphorylation of C/EBPβ modulate Its transcriptional activation and DNA binding in response to growth hormone. Journal of Biological Chemistry 277 44557–44565.

    • Search Google Scholar
    • Export Citation
  • Poli V 1998 The role of C/EBP isoforms in the control of inflammatory and native immunity functions. Journal of Biological Chemistry 273 29279–29282.

    • Search Google Scholar
    • Export Citation
  • Ramji DP & Foka P 2002 CCAAT/enhancer-binding proteins: structure, function and regulation. Biochemical Journal 365 561–575.

  • Rana B, Mischoulon D, Xie Y, Bucher NL & Farmer SR 1994 Cell-extracellular matrix interactions can regulate the switch between growth and differentiation in rat hepatocytes: reciprocal expression of C/EBP α and immediate-early growth response transcription factors. Molecular and Cellular Biology 14 5858–5869.

    • Search Google Scholar
    • Export Citation
  • Rastegar M, Lemaigre FP & Rousseau GG 2000a Control of gene expression by growth hormone in liver: key role of a network of transcription factors. Molecular and Cellular Endocrinology 164 1–4.

    • Search Google Scholar
    • Export Citation
  • Rastegar M, Rousseau GG & Lemaigre FP 2000b CCAAT/enhancer-binding protein α is a component of the growth hormone-regulated network of liver transcription factors. Endocrinology 141 1686–1692.

    • Search Google Scholar
    • Export Citation
  • Rexroad CE III, Lee Y, Keele JW, Karamycheva S, Brown G, Koop B, Gahr SA, Palti Y & Quackenbush J 2003 Sequence analysis of a rainbow trout cDNA library and creation of a gene index. Cytogenetic and Genome Research 102 347–354.

    • Search Google Scholar
    • Export Citation
  • Rodenburg RJ, Teertstra W, Holthuizen PE & Sussenbach JS 1995 Postnatal liver-specific expression of human insulin-like growth factor-II is highly stimulated by the transcriptional activators liver-enriched activating protein and CCAAT/enhancer binding protein-α. Molecular Endocrinology 9 424–434.

    • Search Google Scholar
    • Export Citation
  • Roesler WJ 2001 The role of C/EBP in nutrient and hormonal regulation of gene expression. Annual Review of Nutrition 21 141–165.

  • Saitou N & Nei M 1987 The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4 406–425.

    • Search Google Scholar
    • Export Citation
  • Schrem H, Klempnauer J & Borlak J 2004 Liver-enriched transcription factors in liver function and development. Part II: the C/EBPs and D site-binding protein in cell cycle control, carcinogenesis, circadian gene regulation, liver regeneration, apoptosis, and liver-specific gene regulation. Pharmacological Reviews 56 291–330.

    • Search Google Scholar
    • Export Citation
  • Schuetz EGLD, Omiecinski CJ, Muller-Eberhard U, Kleinman HK, Elswick B & Guzelian PS 1988 Regulation of gene expression in adult rat hepatocytes cultured on a basement membrane matrix. Journal of Celluar Physiology 134 309–323.

    • Search Google Scholar
    • Export Citation
  • Schwartz J, Huo JS & Piwien-Pilipuk G 2002 Growth hormone regulated gene expression. Minerva Endocrinologica 4 231–241.

  • Shamblott MJ, Cheng CM, Bolt D & Chen TT 1995 Appearances of insulin-like growth factor mRNA in the liver and pyloric ceca of a teleost in response to exogenous growth hormone. PNAS 92 6943–6946.

    • Search Google Scholar
    • Export Citation
  • Shamblott MJ, Leung S, Greene MW & Chen TT 1998 Characterization of a teleost insulin-like growth factor II (IGF-II) gene: evidence for promoter CCAAT/enhancer-binding protein (C/EBP) sites, and the presence of hepatic C/EBP. Molecular Marine Biology and Biotechnology 7 181–190.

    • Search Google Scholar
    • Export Citation
  • Strand P, Carlsson L, Rask K, Skrtic S, Ekberg S, Hedin L, Oscarsson J & Jansson J-O 2000 Growth hormone induces CCAAT/enhancer binding protein alpha (C/EBPα) in cultured rat hepatocytes. Journal of Hepatology 32 618–626.

    • Search Google Scholar
    • Export Citation
  • Subramanian L, Benson MD & Iniguez-Lluhi JA 2003 A synergy control motif within the attenuator domain of CCAAT/enhancer-binding protein alpha inhibits transcriptional synergy through Its PIASy-enhanced modification by SUMO-1 or SUMO-3. Journal of Biological Chemistry 278 9134–9141.

    • Search Google Scholar
    • Export Citation
  • Takiguchi M 1998 The C/EBP family of transcription factors in the liver and other organs. International Journal of Experimental Pathology 79 369–391.

    • Search Google Scholar
    • Export Citation
  • Tollet P, Lahuna O, Ahlgren R, Mode A & Gustafsson JA 1995 CCAAT/enhancer-binding protein-α-dependent transactivation of CYP2C12 in rat hepatocytes. Molecular Endocrinology 9 1771–1781.

    • Search Google Scholar
    • Export Citation
  • Trautwein C, van der Geer P, Karin M, Hunter T & Chojkier P 1994 Protein kinase A and C site-specific phosphorylation of LAP (NF-IL6) modulate its binding affinity to DNA recognition elements. Journal of Clinical Investigation 93 2554–2561.

    • Search Google Scholar
    • Export Citation
  • Tucker CS, Hirono I & Aoki T 2002 Molecular cloning and expression of CCAAT/enhancer binding proteins in Japanese flounder Paralichthys olivaceus. Developmental and Comparative Immunology 26 271–282.

    • Search Google Scholar
    • Export Citation
  • Very NM, Kittilson JD, Norbeck LA & Sheridan MA 2005 Isolation, characterization, and distribution of two cDNAs encoding for growth hormone receptor in rainbow trout (Oncorhynchus mykiss). Comparative Biochemistry and Physiology. Part B, Biochemistry and Molecular Biology 140 615–628.

    • Search Google Scholar
    • Export Citation
  • Vidal NO, Ekberg S, Enerback S, Lindahl A & Ohlsson C 1997 The CCAAT/enhancer-binding protein-α is expressed in the germinal layer of the growth plate: colocalisation with the growth hormone receptor. Journal of Endocrinology 155 433–441.

    • Search Google Scholar
    • Export Citation
  • Vinson CR, Sigler PB & McKnight SL 1989 Scissors-grip model for DNA recognition by a family of leucine zipper proteins. Science 246 911–916.

    • Search Google Scholar
    • Export Citation
  • Wegner M, Cao Z & Rosenfeld MG 1992 Calcium-regulated phosphorylation within the leucine zipper of C/EBP. Science 256 370–373.

  • Williams SC, Cantwell CA & Johnson PF 1991 A family of C/EBP-related proteins capable of forming covalently linked leucine zipper dimers in vitro. Genes and Development 5 1553–1567.

    • Search Google Scholar
    • Export Citation
  • Xiong W, Hsieh C-C, Kurtz AJ, Rabek JP & Papaconstantinou J 2001 Regulation of CCAAT/enhancer-binding protein-β isoform synthesis by alternative translational initiation at multiple AUG start sites. Nucleic Acids Reserach 29 3087–3098.

    • Search Google Scholar
    • Export Citation
  • Xu Q & Tata JR 1992 Characterization and developmental expression of Xenopus C/EBP gene. Mechanisms of Development 38 69–81.

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 340 34 2
PDF Downloads 504 56 2
  • View in gallery View in gallery

    Comparison of the deduced amino acid sequences of rainbow trout C/EBPs with those of other vertebrate species. Gaps were introduced to maximize the homology among C/EBP sequences. Identical residues at a given position were coded with white letters on the black background; consensus residues derived from the occurrence of 50% of a single residue at a given position were coded with white letters on the gray background. Consensus residues derived from a block of similar residues at a given position were coded with black letters on gray background. Boxed sequences indicate conserved functional domains, Box A and Box B, transactivation domains; BR-A and BR-B, basic DNA-binding domains; leucine zipper, conserved leucine residues indicated by black triangles pointing downward; potential phosphorylation sites, marked by asterisks with species names and positions; NLS, nuclear localization signal; and SUMO, small ubiquitin-related modifier consensus site. (A) C/EBPα alignment. PT, proline–threonine rich region; SC, synergy conserved motif; and HQV, histidine–glutamine variable region. Arrows marked with p42 and p30 indicate different translation start sites in human and rat, and the inset (HQV) presents various clones isolated from an individual fish in this study. (B) C/EBPβ alignment. PS, proline–serine rich region; Arrows marked with LAP*, LAP, and LIP indicating different translation start sites. (C) C/EBPδ alignment. PR, praline rich region; CaMKII, potential calmodulin-dependent protein kinase II phosphorylation site.

  • View in gallery

    Alignment of the deduced amino acid sequence encoded by the open reading frame residing in the 5′-untranslated region of various C/EBP mRNAs. The conserved upstream open reading frames (uORF) were boxed and the major translational start site was shadowed gray. (A) C/EBPα, (B) C/EBPβ1, and C/EBPβ2. The putative stop codons in teleost fish located at five nucleotides upstream of the major translational start site or a relevant position in the case of Japanese flounder were coded with white letters on the black background. The translational start site of Japanese flounder C/EBPβ is located further upstream and not shown here.

  • View in gallery

    PCR analysis. Real-time RT-PCR analysis was used to determine the absolute copy numbers for individual C/EBP isoform mRNA in the liver (Liv), head kidney (HK), posterior kidney (PK), spleen (Spl), gill (Gi), muscle (Mu), pyloric ceca (PyC), blood (Bld), brain (Brn), pituitary (Pit), heart (Hrt), pancreas (Pan), and testis (Tes). (A) C/EBPα, (B) C/EBPβ1, (C) C/EBPβ2, (D) C/EBPδ1, (E) C/EBPδ2. ND, non-detected. Each data point is presented as mean ± s.d. (n = 2). Different lowercase letters indicate significant differences among different tissues (P < 0.05).

  • View in gallery

    Expression of C/EBP isoform mRNA in rainbow trout treated with bovine growth hormone in vivo. Fishes were starved for 5 days and injected with 10 μg bGH/g body weight or carrier solution for 3 and 6 h. Livers were collected from hormone treated and control fish and immediately frozen on dry ice. The levels of C/EBP mRNA expression were determined by real-time RT-PCR and normalized to β-actin. The expression level of 3 h control was arbitrarily set to 1. (A) Adult fish (average weight 200 g); (B) Juvenile fish (average weight 60 g). Each data point is expressed as mean ± s.d. (n = 3). Different letters indicate significant differences among different treatments and different time points (P < 0.05).

  • View in gallery

    Expression of C/EBP isoform mRNA in trout hepatoma cells in response to GH treatment. RTH cells were starved for 24 h in serum-free medium and treated with various doses of bGH for 6 h. Each treatment was performed in triplicate and individual experiments were repeated thrice. Relative expression levels of C/EBP mRNA were normalized to 18 S rRNA. The expression level of the control sample (i.e. without bGH treatment) was arbitrarily set to 1. (A) IGF-II, (B) C/EBPβ1, (C) C/EBPβ2, (D) C/EBPδ2. Each data point is expressed as mean ± s.d. (n = 3). Asterisks indicate mRNA levels at different bGH doses that are significantly different from control (P < 0.05).

  • Antonson P & Xanthopoulos KG 1995 Molecular cloning, sequence, and expression patterns of the human gene encoding CCAAT/enhancer binding protein α (C/EBPα). Biochemical and Biophysical Research Communications 215 106–113.

    • Search Google Scholar
    • Export Citation
  • Argetsinger LS & Carter-Su C 1996 Mechanism of signaling by growth hormone receptor. Physiological Reviews 76 1089–1107.

  • Buck M, Poli V, van der Geer P, Chojkier M & Hunter T 1999 Phosphorylation of rat serine 105 or mouse threonine 217 in C/EBP β is required for hepatocyte proliferation induced by TGF α. Molecular Cell 4 1087–1092.

    • Search Google Scholar
    • Export Citation
  • Calkhoven CF, Bouwman PRJ, Snippe L & Ab G 1994 Translation start site multiplicity of the CCAAT/enhancer binding protein alpha mRNA is dictated by a small 5′ open reading frame. Nucleic Acids Reserach 22 5540–5547.

    • Search Google Scholar
    • Export Citation
  • Calkhoven CF, Gringhuis SI & Ab G 1997 The chicken CCAAT/enhancer binding protein α gene. Cloning, characterisation and tissue distribution. Gene 196 219–229.

    • Search Google Scholar
    • Export Citation
  • Calkhoven CF, Muller C & Leutz A 2000 Translational control of C/EBPα and C/EBPβ isoform expression. Genes and Development 14 1920–1932.

    • Search Google Scholar
    • Export Citation
  • Chen MJ, Chiou PP, Yang B-Y, Lo HC, Son J-K, Hendricks J, Bailey G & Chen TT 2004 Development of rainbow trout hepatoma cell lines: effect of pro-IGF-I EA4-peptide on morphological changes and anchorage-independent growth. In Vitro Cellular and Developmental Biology. Animal 40 118–128.

    • Search Google Scholar
    • Export Citation
  • Clarkson RW, Chen CM, Harrison S, Wells C, Muscat GE & Waters MJ 1995 Early responses of trans-activating factors to growth hormone in preadipocytes: differential regulation of CCAAT enhancer-binding protein-β (C/EBP β) and C/EBP δ. Molecular Endocrinology 9 108–120.

    • Search Google Scholar
    • Export Citation
  • Croniger C, Leahy P, Reshef L & Hanson RW 1998 C/EBP, and the control of phosphoenolpyruvate carboxykinase gene transcription in the liver. Journal of Biological Chemistry 273 31629–31632.

    • Search Google Scholar
    • Export Citation
  • Descombes P & Schibler U 1991 A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67 569–579.

    • Search Google Scholar
    • Export Citation
  • Desvergne B, Michalik L & Wahli W 2006 Transcriptional regulation of metabolism. Physiological Reviews 86 465–514.

  • DiPersio CM, Jackson DA & Zaret KS 1991 The extracellular matrix coordinately modulates liver transcription factors and hepatocyte morphology. Molecular and Cellular Biology 11 4405–4414.

    • Search Google Scholar
    • Export Citation
  • Eleswarapu S & Jiang H 2005 Growth hormone regulates the expression of hepatocyte nuclear factor-3 γ and other liver-enriched transcription factors in the bovine liver. Journal of Endocrinology 184 95–105.

    • Search Google Scholar
    • Export Citation
  • Fujiki K, Gerwick L, Bayne CJ, Mitchell L, Gauley J, Bols N & Dixon B 2003 Molecular cloning and characterization of rainbow trout (Oncorhynchus mykiss) CCAAT/enhancer binding protein β. Immunogenetics 55 253–261.

    • Search Google Scholar
    • Export Citation
  • Huo JS, McEachin RC, Cui TX, Duggal NK, Hai T, States DJ & Schwartz J 2006 Profiles of growth hormone (GH)-regulated genes reveal time-dependent responses and identify a mechanism for regulation of activating transcription factor 3 by GH. Journal of Biological Chemistry 281 4132–4141.

    • Search Google Scholar
    • Export Citation
  • Iniguez-Lluhi JA & Pearce D 2000 A common motif within the negative regulatory regions of multiple factors inhibits their transcriptional synergy. Molecular and Cellular Biology 20 6040–6050.

    • Search Google Scholar
    • Export Citation
  • Landschulz WH, Johnson PF, Adashi EY, Graves BJ & McKnight SL 1988 Isolation of a recombinant copy of the gene encoding C/EBP. Genes and Development 2 786–800.

    • Search Google Scholar
    • Export Citation
  • Lee LTO, Nong G, Chan YH, Tse DLY & Cheng CHK 2001 Molecular cloning of a teleost growth hormone receptor and its functional interaction with human growth hormone. Gene 270 121–129.

    • Search Google Scholar
    • Export Citation
  • Lekstrom-Himes J & Xanthopoulos KG 1998 Biological role of the CCAAT/enhancer-binding protein family of transcription factors. Journal of Biological Chemistry 273 28545–28548.

    • Search Google Scholar
    • Export Citation
  • Liao J, Piwien-Pilipuk G, Ross SE, Hodge CL, Sealy L, MacDougald OA & Schwartz J 1999 CCAAT/enhancer-binding protein β (C/EBPβ) and C/EBPδ contribute to growth hormone-regulated transcription of c-fos. Journal of Biological Chemistry 274 31597–31604.

    • Search Google Scholar
    • Export Citation
  • Lin F, MacDougald OA, Diehl AM & Lane MD 1993 A 30-kDa, alternative translation product of the CCAAT/enhancer binding protein α message: transcriptional activator lacking antimitotic activity. PNAS 90 9606–9610.

    • Search Google Scholar
    • Export Citation
  • Lincoln AJ, Monczak Y, Williams SC & Johnson PF 1998 Inhibition of CCAAT/enhancer-binding protein α and β translation by upstream open reading frames. Journal of Biological Chemistry 273 9552–9560.

    • Search Google Scholar
    • Export Citation
  • Lyons SE, Shue BC, Lei L, Oates AC, Zon LI & Liu PP 2001a Molecular cloning, genetic mapping, and expression analysis of four zebrafish C/EBP genes. Gene 281 43–51.

    • Search Google Scholar
    • Export Citation
  • Lyons SE, Shue BC, Oates AC, Zon LI & Liu PP 2001b A novel myeloid-restricted zebrafish CCAAT/enhancer-binding protein with a potent transcriptional activation domain. Blood 97 2611–2617.

    • Search Google Scholar
    • Export Citation
  • Mahoney CW, Shuman J, McKnight SL, Chen HC & Huang KP 1992 Phosphorylation of CCAAT-enhancer binding protein by protein kinase C attenuates site-selective DNA binding. Journal of Biological Chemistry 267 19396–19403.

    • Search Google Scholar
    • Export Citation
  • Morris DR & Geballe AP 2000 Upstream open reading frames as regulators of mRNA translation. Molecular and Cellular Biology 20 8635–8642.

  • Muller PY, Janovjak H, Miserez AR & Dobbie Z 2002 Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 32 1372–1379.

    • Search Google Scholar
    • Export Citation
  • Nakajima T, Kinoshita S, Sasagawa T, Sasaki K & Naruto M 1993 Phosphorylation of threonine-235 by a ras-dependent mitogen-activated protein kinase cascade is essential for transcription factor NF-IL6. PNAS 90 2207–2211.

    • Search Google Scholar
    • Export Citation
  • Nerlov C & Ziff EB 1995 CCAAT/enhancer binding protein-α amino acid motifs with dual TBP and TFIIB binding ability co-operate to activate transcription in both yeast andmammalian cells. EMBO Journal 14 4318–4328.

    • Search Google Scholar
    • Export Citation
  • Osada S, Yamamoto H, Nishihara T & Imagawa M 1996 DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family. Journal of Biological Chemistry 271 3891–3896.

    • Search Google Scholar
    • Export Citation
  • Ossipow V, Descombes P & Schibler U 1993 CCAAT/enhancer-binding protein mRNA is translated into multiple proteins with different transcription activation potentials. PNAS 90 8219–8223.

    • Search Google Scholar
    • Export Citation
  • Palamarchuk AY, Kavsan VM, Sussenbach JS & Holthuizen PE 2001 The chum salmon insulin-like growth factor II promoter requires Sp1 for its activation by C/EBPβ. Molecular and Cellular Endocrinology 172 57–67.

    • Search Google Scholar
    • Export Citation
  • Pilipuk GP, Galigniana MD & Schwartz J 2003 Subnuclear localization of C/EBPβ is regulated by growth hormone and dependent on MAPK. Journal of Biological Chemistry 278 35668–35677.

    • Search Google Scholar
    • Export Citation
  • Piwien-Pilipuk G, Van Mater D, Ross SE, MacDougald OA & Schwartz J 2001 Growth hormone regulates phosphorylation and function of CCAAT/enhancer-binding protein β by modulating Akt and glycogen synthase kinase-3. Journal of Biological Chemistry 276 19664–19671.

    • Search Google Scholar
    • Export Citation
  • Piwien-Pilipuk G, MacDougald O & Schwartz J 2002 Dual regulation of phosphorylation and dephosphorylation of C/EBPβ modulate Its transcriptional activation and DNA binding in response to growth hormone. Journal of Biological Chemistry 277 44557–44565.

    • Search Google Scholar
    • Export Citation
  • Poli V 1998 The role of C/EBP isoforms in the control of inflammatory and native immunity functions. Journal of Biological Chemistry 273 29279–29282.

    • Search Google Scholar
    • Export Citation
  • Ramji DP & Foka P 2002 CCAAT/enhancer-binding proteins: structure, function and regulation. Biochemical Journal 365 561–575.

  • Rana B, Mischoulon D, Xie Y, Bucher NL & Farmer SR 1994 Cell-extracellular matrix interactions can regulate the switch between growth and differentiation in rat hepatocytes: reciprocal expression of C/EBP α and immediate-early growth response transcription factors. Molecular and Cellular Biology 14 5858–5869.

    • Search Google Scholar
    • Export Citation
  • Rastegar M, Lemaigre FP & Rousseau GG 2000a Control of gene expression by growth hormone in liver: key role of a network of transcription factors. Molecular and Cellular Endocrinology 164 1–4.

    • Search Google Scholar
    • Export Citation
  • Rastegar M, Rousseau GG & Lemaigre FP 2000b CCAAT/enhancer-binding protein α is a component of the growth hormone-regulated network of liver transcription factors. Endocrinology 141 1686–1692.

    • Search Google Scholar
    • Export Citation
  • Rexroad CE III, Lee Y, Keele JW, Karamycheva S, Brown G, Koop B, Gahr SA, Palti Y & Quackenbush J 2003 Sequence analysis of a rainbow trout cDNA library and creation of a gene index. Cytogenetic and Genome Research 102 347–354.

    • Search Google Scholar
    • Export Citation
  • Rodenburg RJ, Teertstra W, Holthuizen PE & Sussenbach JS 1995 Postnatal liver-specific expression of human insulin-like growth factor-II is highly stimulated by the transcriptional activators liver-enriched activating protein and CCAAT/enhancer binding protein-α. Molecular Endocrinology 9 424–434.

    • Search Google Scholar
    • Export Citation
  • Roesler WJ 2001 The role of C/EBP in nutrient and hormonal regulation of gene expression. Annual Review of Nutrition 21 141–165.

  • Saitou N & Nei M 1987 The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4 406–425.

    • Search Google Scholar
    • Export Citation
  • Schrem H, Klempnauer J & Borlak J 2004 Liver-enriched transcription factors in liver function and development. Part II: the C/EBPs and D site-binding protein in cell cycle control, carcinogenesis, circadian gene regulation, liver regeneration, apoptosis, and liver-specific gene regulation. Pharmacological Reviews 56 291–330.

    • Search Google Scholar
    • Export Citation
  • Schuetz EGLD, Omiecinski CJ, Muller-Eberhard U, Kleinman HK, Elswick B & Guzelian PS 1988 Regulation of gene expression in adult rat hepatocytes cultured on a basement membrane matrix. Journal of Celluar Physiology 134 309–323.

    • Search Google Scholar
    • Export Citation
  • Schwartz J, Huo JS & Piwien-Pilipuk G 2002 Growth hormone regulated gene expression. Minerva Endocrinologica 4 231–241.

  • Shamblott MJ, Cheng CM, Bolt D & Chen TT 1995 Appearances of insulin-like growth factor mRNA in the liver and pyloric ceca of a teleost in response to exogenous growth hormone. PNAS 92 6943–6946.

    • Search Google Scholar
    • Export Citation
  • Shamblott MJ, Leung S, Greene MW & Chen TT 1998 Characterization of a teleost insulin-like growth factor II (IGF-II) gene: evidence for promoter CCAAT/enhancer-binding protein (C/EBP) sites, and the presence of hepatic C/EBP. Molecular Marine Biology and Biotechnology 7 181–190.

    • Search Google Scholar
    • Export Citation
  • Strand P, Carlsson L, Rask K, Skrtic S, Ekberg S, Hedin L, Oscarsson J & Jansson J-O 2000 Growth hormone induces CCAAT/enhancer binding protein alpha (C/EBPα) in cultured rat hepatocytes. Journal of Hepatology 32 618–626.

    • Search Google Scholar
    • Export Citation
  • Subramanian L, Benson MD & Iniguez-Lluhi JA 2003 A synergy control motif within the attenuator domain of CCAAT/enhancer-binding protein alpha inhibits transcriptional synergy through Its PIASy-enhanced modification by SUMO-1 or SUMO-3. Journal of Biological Chemistry 278 9134–9141.

    • Search Google Scholar
    • Export Citation
  • Takiguchi M 1998 The C/EBP family of transcription factors in the liver and other organs. International Journal of Experimental Pathology 79 369–391.

    • Search Google Scholar
    • Export Citation
  • Tollet P, Lahuna O, Ahlgren R, Mode A & Gustafsson JA 1995 CCAAT/enhancer-binding protein-α-dependent transactivation of CYP2C12 in rat hepatocytes. Molecular Endocrinology 9 1771–1781.

    • Search Google Scholar
    • Export Citation
  • Trautwein C, van der Geer P, Karin M, Hunter T & Chojkier P 1994 Protein kinase A and C site-specific phosphorylation of LAP (NF-IL6) modulate its binding affinity to DNA recognition elements. Journal of Clinical Investigation 93 2554–2561.

    • Search Google Scholar
    • Export Citation
  • Tucker CS, Hirono I & Aoki T 2002 Molecular cloning and expression of CCAAT/enhancer binding proteins in Japanese flounder Paralichthys olivaceus. Developmental and Comparative Immunology 26 271–282.

    • Search Google Scholar
    • Export Citation
  • Very NM, Kittilson JD, Norbeck LA & Sheridan MA 2005 Isolation, characterization, and distribution of two cDNAs encoding for growth hormone receptor in rainbow trout (Oncorhynchus mykiss). Comparative Biochemistry and Physiology. Part B, Biochemistry and Molecular Biology 140 615–628.

    • Search Google Scholar
    • Export Citation
  • Vidal NO, Ekberg S, Enerback S, Lindahl A & Ohlsson C 1997 The CCAAT/enhancer-binding protein-α is expressed in the germinal layer of the growth plate: colocalisation with the growth hormone receptor. Journal of Endocrinology 155 433–441.

    • Search Google Scholar
    • Export Citation
  • Vinson CR, Sigler PB & McKnight SL 1989 Scissors-grip model for DNA recognition by a family of leucine zipper proteins. Science 246 911–916.

    • Search Google Scholar
    • Export Citation
  • Wegner M, Cao Z & Rosenfeld MG 1992 Calcium-regulated phosphorylation within the leucine zipper of C/EBP. Science 256 370–373.

  • Williams SC, Cantwell CA & Johnson PF 1991 A family of C/EBP-related proteins capable of forming covalently linked leucine zipper dimers in vitro. Genes and Development 5 1553–1567.

    • Search Google Scholar
    • Export Citation
  • Xiong W, Hsieh C-C, Kurtz AJ, Rabek JP & Papaconstantinou J 2001 Regulation of CCAAT/enhancer-binding protein-β isoform synthesis by alternative translational initiation at multiple AUG start sites. Nucleic Acids Reserach 29 3087–3098.

    • Search Google Scholar
    • Export Citation
  • Xu Q & Tata JR 1992 Characterization and developmental expression of Xenopus C/EBP gene. Mechanisms of Development 38 69–81.