Abstract
In this study, two novel GHRHR receptor splice variants, named chicken GHRHR-v1 (cGHRHR-v1) and cGHRHR-v2 respectively, were identified from chicken pituitary using RT-PCR assay. cGHRHR-v1 is characterized by an N-terminal deletion of 36 amino acid residues, including an aspartate at position 56 (Asp56) conserved in G protein-coupled receptor B-I subfamily. cGHRHR-v2 is a carboxyl-terminal truncated receptor variant with four putative transmembrane domains, which arose from alternative use of a splice acceptor site on intron 8. Using the pGL3-CRE-luciferase reporter system, the functionality of the two variants was examined in Chinese hamster ovary cells. cGHRHR-v1 was shown to be capable of transmitting signal upon agonist stimulation, but cGHRHR-v2 could not. Both GHRH and pituitary adenylate cyclase-activating peptide (PACAP) could activate cGHRHR-v1 at high dosages (GHRH ≥10−8 M; PACAP ≥10−6 M) and GHRH was much more potent than PACAP, suggesting that cGHRHR-v1 is a functional membrane-spanning receptor with an impairment in high-affinity ligand binding, rather than in receptor activation and ligand-binding specificity. This finding also points out the possibility that Asp56 is not a critical determinant for receptor activation and direct ligand–receptor interaction. To substantiate this hypothesis, using site-directed mutagenesis, two receptor mutants with replacement of Asp56 by Ala or Gly were generated. Expectedly, chicken or human GHRH could still activate both receptor mutants with reduced potencies (about 2- to 14-fold less potent). Taken together, our findings not only suggest that cGHRHR variants may play a role in controlling normal pituitary functions, but also support that Asp56 is nonessential for receptor activation and direct ligand–receptor interaction.
Introduction
It is well documented that hypothalamic growth hormone-releasing hormone (GHRH) stimulates pituitary growth hormone synthesis and secretion, as well as somatotroph proliferation and differentiation in mammals and birds (Leung & Taylor 1983, Scanes & Harvey 1984, Scanes et al. 1986, Giustina & Veldhuis 1998, Harvey 1999, Frohman & Kineman 2002, Wang et al. 2007). All of these biological actions are mediated by GHRH receptor (GHRHR; Mayo 1992, Petersenn & Schulte 2000, Gaylinn 2002, Porter et al. 2006, Toogood et al. 2006, Wang et al. 2007). GHRHR belongs to the G protein-coupled receptor (GPCR) B-I subfamily, which also includes receptors for secretin, vasoactive intestinal peptide (VIP), pituitary adenylate cyclase-activating peptide (PACAP), glucagon, glucagon-like peptide-1, gastric inhibitory peptide, parathyroid hormone (PTH)/PTH-related peptide (PTHrP), and calcitonin (Sherwood et al. 2000, Harmar 2001, Mayo et al. 2003). Like other family members, GHRHR has a large N-terminal extracellular domain, which contains several strictly positioned and conserved amino acid residues including six cysteine residues and an aspartate at position 60 (Asp60 of mouse GHRHR; Harmar 2001, Mayo et al. 2003). In mammals, GHRH binds to GHRHR expressed in pituitary somatotroph, leading to intracellular cAMP production, calcium influx, and subsequent growth hormone synthesis and release (Giustina & Veldhuis 1998, Frohman & Kineman 2002, Gaylinn 2002, Lin-Su & Wajnrajch 2002). Mutated GHRHR with Asp60 substitution could not bind GHRH nor signal through cAMP pathway (Godfrey et al. 1993, Lin et al. 1993, Gaylinn et al. 1999), leading to growth hormone deficiency and pituitary hypoplasia in mice. These findings further emphasize the critical role of GHRHR in mediating GHRH actions in the pituitary (Frohman & Kineman 2002, Gaylinn 2002).
In mammals, GHRHR splice variants with altered signaling properties and ligand-binding affinity have been reported (Mayo 1992, Hashimoto et al. 1995, Zeitler et al. 1998, Hassan 2001). In rats, a GHRHR variant with an insertion of 41 amino acids in the third intracellular loop (IL3) could bind GHRH with high affinity, but fails to increase the intracellular cAMP levels (Mayo 1992, Miller et al. 1999). In contrast, another rat GHRHR variant with a substitution of the last five amino acids in the carboxyl terminus retains the ability to promote cAMP accumulation when tested in non-GHRHR expressing cells (Zeitler et al. 1998). In humans, the retention of the intronic sequence generates a variant encoding a C-terminally truncated GHRHR with five transmembrane domains (Hashimoto et al. 1995, McElvaine & Mayo 2006). Interestingly, though this receptor variant could not bind GHRH, it could form a complex with the full-length receptor and inhibit GHRH binding, thereby altering the signaling activity of GHRHR (McElvaine & Mayo 2006). It has become increasingly clear that mRNA alternative splicing of GHRHR gene may generate multiple functional GHRHR variants and represent an additional level to control the actions of GHRH under different physiological conditions (Minneman 2001). However, the presence of GHRHR variants and their potential roles in the pituitary of nonmammalian vertebrate species have not been reported.
In our previous study, we amplified a chicken GHRHR (cGHRHR) cDNA fragment without exon 3 by RT-PCR assay (Wang et al. 2006), suggesting that GHRHR variants may be present and function in the chicken pituitary. Therefore, the present study aims at the identification and characterization of these splice variants. As a result, two novel GHRHR variants, named cGHRHR-v1 and cGHRHR-v2 respectively, have been identified. cGHRHR-v2 is a C-terminal truncated receptor variant with four putative transmembrane domains and cGHRHR-v1 is a variant with an N-terminal deletion of 36 amino acids including the aspartic acid residue at position 56 (Asp56). Strikingly, neither deletion of 36 amino acids nor mutation of Asp56 could abolish the ligand binding and signaling property of cGHRHR. These findings suggest a role of pituitary cGHRHR variants under normal physiological conditions, and also lead us to rethink the role of Asp56 or residues 50–85 in the interaction between GHRH and GHRHR.
Materials and Methods
Chemical and hormones
Human pancreatic GHRH (hpGHRH1–40) and ovine pituitary adenylate cyclase-activating polypeptide (oPACAP38) were purchased from Bachem (Bachem Inc., Torrance, CA, USA). Chicken GHRH (cGHRH1–31) and (cGHRH1–47) were synthesized by GL Biochem (GL Biochem. Shanghai, China). hpGHRH1–40, oPACAP38, cGHRH1–47, and cGHRH1–31 were first dissolved in distilled water and then diluted to working concentrations with medium before use.
Animals
Chicken embryos and adult chickens were kindly provided by Kadoorie Agricultural Research Centre (Hong Kong, China). All experiments were performed under license issued from the Government of the Hong Kong Special Administrative Region and endorsed by the Animal Experimentation Ethics Committee of The University of Hong Kong.
RNA extraction and RT-PCR assay
Pituitaries from chicken embryos, sexually immature and mature chickens were isolated, and attached brain tissues were carefully removed under a dissection microscope. Then, total RNA was extracted using Tri Reagent (Molecular Research Center, Cincinnati, OH, USA) according to the manufacturer's instruction. RT was carried out at 42 °C for 2 h in a total volume of 10 μl, consisting of 2 μg RNA, 1×single-strand buffer, 10 mM dithiothreitol, 0.5 μg oligo (dT), and 100U Superscript II (Invitrogen). One microliter of the first-strand cDNA was used as the template for each PCR. PCR was performed under the following conditions: 2 min at 94 °C for denaturation, followed by 25 (or 30, 35, or 40) cycles of 30 s at 95 °C, 30 s at 54 °C, and 60 s at 72 °C, ending with a 7-min extension at 72 °C. The primers used were listed in Table 1. The PCR products were electrophoresed in 1.5% agarose gel, stained with ethidium bromide, and visualized under u.v. illumination.
Primers useda
| Primer sequence (5′–3′) | Size (bp) | |
|---|---|---|
| Gene/construct | ||
| Primers for RT-PCR assay | ||
| GHRHR/GHRHR-v1 | Sense: CAGAGGAGCATGAGAATGCAA | 539/431b |
| Antisense: CTCTACCAGCAGCCATATGAA | ||
| GHRHR | Sense: CCAGAGGCAGATGCTGGA | 477 |
| Antisense: CTCTACCAGCAGCCATATGAA | ||
| GHRHR-v2 | Sense: CCAGAGGCAGATGCTGGA | 637 |
| Antisensec: CAGCATCTGAGAAAATAGCTG | ||
| Primers for constructing the expression plasmidsd | ||
| cGHRHR/cGHRHR-v1/cGHRHR-v2 | Sense: GGATCCTAGCATGTCATACCA | 1280/1172/1291 |
| Antisense: TCTAGAGTCTTTAGCACACAGA | ||
| GHRHR-G | Sensee: ACCTGGGGCAAATTACTCTGCTG | 1280 |
| Antisensee: GAGTAATTTGCCCCAGGTTTTCTTGC | ||
| GHRHR-A | Sensee: ACCTGGGCCAAATTACTCTGCTG | 1280 |
| Antisensee: GAGTAATTTGGCCCAGGTTTTCTTGC | ||
| Primers for quantitative real-time RT-PCR assays | ||
| β-actin | Sense: CCCAGACATCAGGGTGTGATG | 123 |
| Antisense: GTTGGTGACAATACCGTGTTCAAT | ||
| GHRHR | Sense: CAGAGGAGCATGAGAATGCAA | 142 |
| Antisense: ATCCCAGCTGGTTCTTCCATG | ||
| GHRHR-v1 | Sense: CACGAATCCTAGCATGTCATA | 185 |
| Antisense: TCTTACTATCCCAGCTGATGT | ||
| GHRHR-v2 | Sense: TGTCACTACTTCATGATGACCA | 205 |
| Antisense: CAGCATCTGAGAAAATAGCTG |
All primers were synthesized by Invitrogen (Hong Kong).
Primers were used to detect the expressions of both GHRHR and GHRHR-v1.
Primer was designed to amplify GHRHR-v2 specifically.
The restriction sites are underlined and the changed nucleotide is in bold typeface.
Primers were designed to prepare cGHRHR mutants by site-directed PCR mutagenesis.
Real-time RT-PCR quantitation of GHRHR, GHRHR-v1, and GHRHR-v2 expression in chicken pituitaries at different stages
To examine the relative expression levels of GHRHR and two GHRHR variants (GHRHR-v1 and GHRHR-v2) in chicken pituitaries at different stages, pituitaries from chicken embryos (day 13, N=4), sexually immature (3 weeks, N=4), and mature chickens (25 weeks, N=4) were collected for quantitative real-time RT-PCR assay.
Before real-time RT-PCR assay, four plasmids containing cDNA fragment of β-actin, or full-length cDNAs of GHRHR or GHRHR variants, were quantitated by a UV-Visible Recording Spectrophotometer (Shimadzu Corp., Tokyo, Japan), and the copy number of DNA molecule was calculated. Then, these serially diluted plasmids with known copy number were used to set the standard curves in all real-time PCR assays.
The real-time PCR was performed on the iCycler Real-time PCR Detection System (Bio-Rad) in a volume of 20 μl containing 0.5 μl RT product, 1× PCR buffer, 0.2 mM each dNTP, 2.5 mM MgCl2, 0.2 μM each primer, 0.5 U Taq DNA polymerase (Invitrogen), and 1 μl EvaGreen (Biotium Inc., Hayward, CA, USA). The PCR profile consisted of 40 cycles of 95 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, and 80 °C for 7 s for signal detection. To assess the specificity of PCR amplification, melting curve analysis and agarose gel electrophoresis were performed at the end of the PCR to confirm that a specific PCR band was produced. In addition, the identities of the PCR products for all genes were confirmed by sequencing analysis (Perkin–Elmer, Foster City, CA, USA). In the quantitative real-time RT-PCR assays, PCR was carried out in duplicate for evaluation of its reproducibility.
Finally, according to the standard curve set in each quantitative real-time PCR, the copy numbers of target transcript (including β-actin, GHRHR, GHRHR-v1, and GHRHR-v2) in RT samples were calculated.
Construction of expression plasmids encoding cGHRHR, cGHRHR-v1, cGHRHR-v2, and cGHRHR mutants
In this experiment, the expression plasmids encoding cGHRHR (1280 bp), cGHRHR-v1 (1172 bp), and cGHRHR-v2 (1291 bp) were first constructed. In brief, the coding regions were amplified by PCR using the antisense primer containing an Xba I site at the 5′-end (5′-TCTAGAGTCTTTAGCACACAGA-3′) and the sense primer with a BamH I site at the 5′-end (5′-GGATCCTAGCATGTCATACCA-3′). PCR condition was as follows: 2 min at 94 °C for denaturation, followed by 31 cycles of amplification (94 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min) and a 10-min final extension at 72 °C. The PCR products were cloned into pBluescript SK (+/−) vector (Stratagene, La Jolla, CA, USA) and sequenced by ABI3100 Genetic Analyzer (Perkin–Elmer). The fragments with correct sequences were released by restriction enzyme digestion (BamH I and Xba I) and subcloned into pcDNA3.1 (+) expression vector (Invitrogen).
To generate the cGHRHR mutants with a replacement of aspartate 56 by alanine (Asp56→Ala56) or glycine (Asp56→Gly56), site-directed mutagenesis PCR was used in this study. The mutagenic primers were used to introduce a single amino acid substitution at position 56 (Asp56→Ala56 or Asp56→Gly56) of cGHRHR. The sequences of the mutagenic primers were listed in Table 1. Using the plasmid containing the open reading frame (ORF) region of cGHRHR as template, the ORF region was amplified and cloned into pBluescript SK (+/−) vector (Stratagene). After sequencing analysis, inserts with the mutated sites were released by restriction enzyme digestion and subcloned into pcDNA3.1 (+) expression vector (Invitrogen; Fig. 5). In this study, the two cGHRHR mutants were named cGHRHR-A (Asp56→Ala56) and cGHRHR-G (Asp56→Gly56) respectively.
Activation of two chicken GHRHR mutants expressed in CHO cells by human GHRH (B) hpGHRH1–40: 10−12–10−7 M and chicken GHRH (C), cGHRH1–47: 10−12–10−7 M and (D), cGHRH1–31: 10−12–10−7 M. The pGL3-CRE-luciferase reporter construct was co-transfected with cGHRHR or cGHRHR mutant expression plasmid into CHO cells to monitor the changes in intracellular cAMP levels after agonist treatment. Each data point represents mean±s.e.m. of three replicates. Arrows in (A) show the mutated nucleotides in two receptor mutants: GHRHR-A (GAC→GCC) and GHRHR-G (GAC→GGC).
Citation: Journal of Endocrinology 195, 3; 10.1677/JOE-07-0167
Functional analysis of cGHRHR, cGHRHR-v1, cGHRHR-v2, cGHRHR-A, and cGHRHR-G
Chinese hamster ovary (CHO) cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (HyClone, Logan, UT, USA), 100 IU/ml penicillin G, and 100 μg/ml streptomycin (Life Technologies Inc., Grand Island, NY, USA) in a 90 cm culture dish (NUNC, Rochester, NY, USA) and incubated at 37 °C with 5% CO2. CHO cells were first subcultured on six-well plates and grown for 24 h before transfection. Then, the cells were co-transfected with a mixture containing 700 ng pGL3-CRE-luciferase reporter construct (Wang et al. 2007), 300 ng of different pcDNA3.1 expression plasmids (or empty pcDNA3.1 vector), and 6 μl DOSPER (Roche Diagnostics). Transfected cells were grown in fresh DMEM for an additional 24 h. CHO cells were trypsinized and then cultured in a 96-well plate at 37 °C for an additional 24 h before hormone treatment. hpGHRH1–40, oPACAP38, cGHRH1–47, and cGHRH1–31 were diluted by serum-free DMEM to the indicated concentrations. After 6-h treatment (serum-free medium used as a control), CHO cells were harvested with 1× passive lysis buffer for luciferase assay (Promega). The luciferase activity was measured by a Luminometer (Lumat LB9507, EG&G Berthold, Bad Wildbad, Germany) according to the manufacturer's instruction.
Data analysis
The luciferase activities in each treatment group were expressed as relative fold increase as compared with the control group (without hormone treatment). The expression level of each mRNA transcript in each sample was first calculated as the ratio to that of β-actin and finally expressed as the percentage of the expression level of GHRHR in day 13 embryonic pituitaries. The data were analyzed by one-way ANOVA followed by Dunnett's test or student's t-test using GraphPad Prism 4 (GraphPad Software, San Diego, CA, USA). To validate our results, all experiments were repeated at least twice.
Results
Identification of two novel cGHRHR splice variants: cGHRHR-v1 and cGHRHR-v2
To identify cGHRHR variants, primers amplifying the full-length cGHRHR were used (Table. 1). As shown in Fig. 4A, a minor PCR band was noted, coinciding with the finding in our previous study (Wang et al. 2006). Sequencing analysis revealed that this full-length cDNA lacks 108 bp (corresponding to exon 3) and encodes a receptor of 383 amino acids with seven intact transmembrane domains. Strikingly, loss of exon 3 results in a deletion of 36 amino acid residues (residues 50–85) in the large extracellular domain including an aspartate at position 56, a glycine at position 67, two tryptophans, and three cysteines conserved in all members of B-I GPCR subfamily (Fig. 1). In this study, this cGHRHR variant is named as cGHRHR-v1 (GenBank accession no.: DQ451550).
(A) Detection of GHRHR (bright band) and GHRHR-v1 (faint band) expressions in adult chicken pituitary by RT-PCR. Numbers indicate the PCR cycles used. (B) Alignment of the N-terminal extracellular domain of chicken GHRHR (cGHRHR: NP_001032923) with that of chicken GHRHR-v1 (cGHRHR-v1: DQ451550), human GHRHR (hGHRHR: NP_000814), rat GHRHR (rGHRHR: NP_036982), mouse GHRHR (mGHRHR: NP_001003685), goldfish GHRH-like peptide receptor (gfGHRHL-R: AF048819), human PACAP type I receptor (hPAC1: NP_001109), zebrafish PACAP type I receptor (zfPAC1: AY738798), mouse VIP type I receptor (mVAPC1: NP_035833), human VIP type II receptor (hVPAC2: NP_003373), and human secretin receptor (hSCTR: tophans (W), and cysteines (C) are boxed. The shaded regions are shown to be involved in the formation of splice variant of cGHRHR, hPAC1, and hSCTR. Dots indicate amino acid residues identical to cGHRHR and dashes represent gaps in sequence. TM1, transmembrane domain 1.
Citation: Journal of Endocrinology 195, 3; 10.1677/JOE-07-0167
Activation of cGHRHR and cGHRHR-v1 by chicken GHRH (10−12–10−7 M, 6 h) and human GHRH (10−12–10−7 M, 6 h). (A) Amplification of the full-length cGHRHR and cGHRHR-v1 from adult chicken pituitary (Pi) and kidney (Ki) by RT-PCR. Negative controls are not shown. (B), (C), and (D) The effect of human pancreatic GHRH (B, hpGHRH1–40) and chicken GHRH (C, cGHRH1–47; D, cGHRH1–31) on the activation of chicken GHRHR, GHRHR-v1, and GHRHR-v2 over-expressed in CHO cells. The pGL3-CRE-luciferase reporter construct was co-transfected with different expression plasmids into CHO cells to monitor the changes in intracellular cAMP levels after GHRH treatment. The co-transfection of empty pcDNA3.1(+) vector and pGL3-CRE-luciferase reporter construct into CHO cells was used as an internal control. Each data point represents mean±s.e.m. of three replicates.
Citation: Journal of Endocrinology 195, 3; 10.1677/JOE-07-0167
Using the same primers, we isolated another cGHRHR variant (Genbank accession no.: EF433463), which is 11 bp longer than cGHRHR. Unlike cGHRHR-v1, this variant is resulted from the alternative use of a splice acceptor site at intron 8 (Fig. 2B). The alternative mRNA splicing leads to the retention of 11 bp intronic sequence and formation of a premature stop codon located on exon 9 (Fig. 2B). Using a primer specific to 11 bp intronic sequence (Table 1), this receptor variant could be amplified from the pituitary, whereas no PCR band was found using plasmid containing cGHRHR as template, confirming the specific amplification of cGHRHR-v2 (Fig. 2C). Interestingly, this splice transcript encodes a C-terminally truncated cGHRHR variant with the first four transmembrane domains and an altered C-terminal tail (16 amino acids; Fig. 2A). Herein, this truncated GHRHR variant is designated as cGHRHR-v2.
(A) The deduced amino acid sequence of cGHRHR splice variant 2 (cGHRHR-v2). The four putative transmembrane domains are shaded and labeled as TM1, TM2, TM3, and TM4 respectively. The altered C-terminal tail (16 amino acids) is boxed. The inserted partial sequence (11 bp) of intron 8 is boxed and shaded. (B) Arrow indicates the alternate splice acceptor site (ag) on intron 8. The usage of this splice acceptor site results in the retention of 11-bp sequence (boxed) of intron 8 and formation of a premature stop codon in exon 9 (underlined). (C) Detection of cGHRHR (wt) and cGHRHR-v2 (v2) mRNA in adult chicken pituitary. Plasmid containing the full-length cGHRHR (plasmid (wt)) was used as template to test the specificity of PCR. RT : RT product from adult chicken pituitary. Numbers in brackets indicate the PCR cycle numbers used.
Citation: Journal of Endocrinology 195, 3; 10.1677/JOE-07-0167
Relative expression levels of GHRHR, GHRHR-v1, and GHRHR-v2 in the chicken pituitary
To evaluate the relative mRNA levels of GHRHR, GHRHR-v1, and GHRHR-v2 in chicken pituitary at different developmental stages, pituitaries from day 13 embryos, sexually immature (3 weeks), and mature chickens were chosen for quantitative real-time RT-PCR assay in this study. Consistent with our RT-PCR results (Figs 1A and 4A), cGHRHR was shown to be abundantly expressed at all stages examined, with the highest expression level observed in 3-week pituitary. In contrast, cGHRHR-v1 was detected to be expressed at a level much lower than cGHRHR regardless of the developmental stage of pituitary used (Fig. 3). And its expression level is only about 5–20% of that of cGHRHR in most individuals examined. Compared with cGHRHR-v1, cGHRHR-v2 was shown to have even much lower abundance, and its expression level is <5% of that of cGHRHR in most individuals investigated (Fig. 3).
Relative mRNA levels of GHRHR, GHRHR-v1, and GHRHR-v2 in the pituitaries of chicken embryos (d13: day 13), sexually immature (w3: 3 weeks), and mature (Ad) chickens. Part of the exon organization of chicken GHRHR, GHRHR-v1, and GHRHR-v2 transcripts is shown in (A). Exon 1 is labeled as e1, exon 2 as e2, and so forth. Arrows indicate the location of primers used in quantitative real-time RT-PCR assays. The expression levels of GHRHR, GHRHR-v1, and GHRHR-v2 at different stages are normalized by that of β-actin and expressed as the percentage of the expression level of GHRHR (d13-GHRHR) in day-13 embryonic pituitaries (B). Each data point represents the mean±s.e.m. of four individuals (N=4).
Citation: Journal of Endocrinology 195, 3; 10.1677/JOE-07-0167
Activation of cGHRHR-v1 by chicken GHRH or human GHRH
To examine the signaling property of cGHRHR-v1, cGHRHR-v1 recombinant construct was transiently expressed in CHO cells and challenged with human GHRH (hpGHRH1–40) or chicken GHRH (cGHRH1–47 or cGHRH1–31). To monitor the changes of intracellular cAMP levels, a pGL3-CRE-luciferase reporter system was used as reported in our previous study (Wang et al. 2007). Surprisingly, both chicken and human GHRH could activate cGHRHR-v1 at ≥10−8 M dosages (Fig. 4), suggesting that cGHRHR-v1 is still likely to be a functional membrane-spanning receptor. Though GHRH could activate both cGHRHR and cGHRHR-v1, it should be noted that GHRH is ∼1000-fold less potent in activating cGHRHR-v1 than in activating cGHRHR (Fig. 4).
Asp56 is not a crucial determinant for receptor activation and direct ligand–receptor interaction
Deletion of N-terminal 36 amino acid residues including Asp56 fails to abolish the receptor-activated cAMP–PKA signaling pathway (Fig. 4), leading us to speculate that Asp56 may not be crucial for receptor activation and direct ligand–receptor interaction. To test this possibility, two receptor mutants with a replacement of Asp56 by Ala or Gly (Asp→Ala or Asp→Gly) were generated and tested in the pGL3-CRE-luciferase reporter system (Fig. 5). Strikingly, both chicken and human GHRH could activate cGHRHR-G (Asp→Ala) or cGHRHR-A (Asp→Gly) with slightly reduced potencies (∼2- to 14-fold less potent), suggesting that Asp56 is not critical for receptor activation and direct interaction between cGHRH and cGHRHR (Fig. 5).
Activation of cGHRHR-v1 and cGHRHR mutants by oPACAP38
To determine whether cGHRHR-v1 and cGHRHR mutants could abolish the ligand-binding selectivity, PACAP38, a structurally and functionally related peptide, was used in this experiment. Interestingly, ovine PACAP38 (oPACAP38) activated both cGHRHR-v1 and cGHRHR mutants (cGHRHR-A or cGHRHR-G; Fig. 6). However, its potency is comparatively lower than human or chicken GHRH (about 100-fold less potent), clearly suggesting that mutation of Asp56, or deletion of residues 50–85, could not abolish the ligand-binding selectivity of cGHRHR (Fig. 6).
Activation of GHRHR-v1 (A) and two GHRHR mutants (GHRHR-A and GHRHR-G) (B) by ovine PACAP38 (oPACAP38: 10−12–10−6 M, 6 h). The pGL3-CRE-luciferase reporter construct was co-transfected with different expression plasmids to monitor the changes in intracellular cAMP levels of CHO cells upon PACAP treatment. Each data point represents mean±s.e.m. of three replicates.
Citation: Journal of Endocrinology 195, 3; 10.1677/JOE-07-0167
Effects of co-expressing cGHRHR and cGHRHR-v1 on cGHRHR signaling in CHO cells
The co-expression of cGHRHR and cGHRHR-v1 in the pituitary suggests that cGHRHR-v1 may modify cGHRHR signaling in normal pituitary. To test this possibility, we co-expressed cGHRHR and cGHRHR-v1 in CHO cells and monitored the changes in ligand-stimulated luciferase activity. Interestingly, when treated with GHRH, particularly at low concentrations (10−10 M), the fold increase in luciferase activity appeared to be significantly reduced in the presence of equal amount of cGHRHR-v1 and cGHRHR expression plasmids when compared with cells expressing cGHRHR alone (Fig. 7). However, when the two expression plasmids were co-transfected at a ratio of 5:1 (cGHRHR:cGHRHR-v1), only a minor difference was noted between cells expressing cGHRHR alone and cells expressing both cGHRHR and cGHRHR-v1 (data not shown).
Effect of the co-expression of GHRHR and GHRHR-v1 on GHRHR signaling in CHO cells. In this experiment, CHO cells were transfected with either GHRHR or GHRHR-v1 expression plasmid, or co-transfected with both constructs at a ratio of 1:1 (GHRHR+GHRHR-v1), and then treated with chicken GHRH1–31 (A) or GHRH1–47 (B) (10−12–10−7 M) for 6 h. The empty pcDNA3.1(+) vector was used to keep the net amount of plasmids constant among different groups. The pGL3-CRE-luciferase reporter construct was co-transfected into CHO cell to monitor the changes in intracellular cAMP levels after GHRH treatment. Each data point represents mean±s.e.m. of three replicates. *P<0.01 versus GHRHR.
Citation: Journal of Endocrinology 195, 3; 10.1677/JOE-07-0167
Inability of cGHRHR-v2 in activating cAMP–PKA signaling pathway upon ligand stimulation
To demonstrate the functionality of cGHRHR-v2, cGHRHR-v2 was also transiently expressed in CHO cells. As shown in Fig. 4, neither chicken GHRH (cGHRH1–31 and cGHRH1–47) nor human GHRH (hpGHRH1–40) could activate cGHRHR-v2 and signal through cAMP–PKA pathway at any dosage tested. When cGHRHR-v2 and cGHRHR were co-transfected into CHO cells at different ratio (1:1 or 1:5), no difference was found in agonist-induced fold increase in luciferase activity between cGHRHR transfected and co-transfected cells (data not shown).
Discussion
In this study, two GHRHR splice variants, named cGHRHR-v1 and cGHRHR-v2, have been identified from chicken pituitary. cGHRHR-v1 is a receptor variant with an N-terminal deletion of 36 amino acid residues, including an aspartate at position 56, two tryptophans and three cysteines, which are fully conserved in GPCR B-I subfamily (Harmar 2001, Mayo et al. 2003). cGHRHR-v2 is a C-terminal truncated receptor with four putative transmembrane domains. To our knowledge, our study is the first to report two novel GHRHR variants expressed in the pituitary of vertebrate species.
Although alternative mRNA splicing of GHRHR gene has been found in the normal pituitaries of both mammals and chickens, the alternative splicing site of chicken ghrhr gene is shown to be different from its mammalian counterparts. In mammals, mRNA alternative splicing occurs at the third IL (Mayo 1992, Hashimoto et al. 1995, McElvaine & Mayo 2006) or the C-terminal tail of GHRHR (Hashimoto et al. 1995, Zeitler et al. 1998). In chickens, alternative mRNA splicing of cGHRHR was noted at two novel sites. One is located on exon 3 and the other is located downstream of the fourth transmembrane domain (Figs 1 and 2). Despite the lack of information on exon 3 deletion of GHRHR from other species, a similar N-terminal spliced variant (hPAC1vs) of PACAP type I receptor, a GPCR having close evolutionary relationship to GHRHR, has been identified in human cerebellum tissues (Dautzenberg et al. 1999). In addition, the similar deletion of 36 amino acids (encoded by exon 3) had also been reported in secretin receptor identified from human gastrinomas (Ding et al. 2002b). These evidence strongly suggest that the N-terminal deletion (exon 3 deletion) may be a potential mechanism for generating splice variants of secretin/PACAP/GHRH receptors. Although no splicing occurs in intron 8 of mammalian GHRHR, retention of intronic sequence appears to be common in generating functional splice variants of GPCRs (Kilpatrick et al. 1999). In humans, retention of intron 10 (561 bp) leads to the formation of a truncated GHRHR splice variant with five transmembrane domains, which is expressed in normal pituitary and pituitary adenomas (Hashimoto et al. 1995, McElvaine & Mayo 2006).
cGHRHR-v1 involves a deletion of 36 amino acid residues, a region which is generally believed to be crucial for direct ligand–receptor interaction of subfamily B-I GPCRs (Carruthers et al. 1994, Couvineau et al. 1995, Gaylinn 2002), raising an issue regarding the functionality of cGHRHR-v1. Interestingly, cGHRHR-v1 could be activated by human and chicken GHRH at high dosages (≥10−8 M), suggesting that cGHRHR-v1 is still likely to be a membrane-spanning receptor with a reduced ligand-binding affinity. Consistent with our finding, the human PAC1vs over-expressed in HEK293 cells could bind PACAP with reduced affinity and signal cAMP accumulation (Dautzenberg et al. 1999). Our findings in cGHRHR-v1, together with the study on hPAC1vs, provide two exceptional, nonetheless important, cases among all members in the GPCR B-I subfamily, in which the N-terminal deletions neither abolish receptor activation nor prevent the normal traffic of receptor variants to the cell surface, though the deleted regions may contain structural motif or functional domain critical for high-affinity ligand binding (Fig. 4; Dautzenberg et al. 1999).
The loss of an aspartic acid residue at position 56 (Asp56), which is fully conserved among subfamily B-I GPCRs (Harmar 2001), did not impair the cGHRHR-v1 activation in the present study, strongly arguing against its suggested critical role in receptor activation and direct ligand–receptor interaction. Several studies demonstrated that point mutation of aspartate (Asp60) in little mouse GHRHR (Godfrey et al. 1993, Lin et al. 1993) renders receptor totally defective in ligand binding and ligand-stimulated cAMP production despite its expression level similar to wild-type receptor in vitro (Gaylinn et al. 1999), claiming that this aspartic acid residue is critical for receptor activation and direct ligand–receptor interaction. This notion is also strongly supported by studies that mutation of this equivalent residue in receptors of VIP, glucagon, and GHRH-like peptide abolishes the ability of receptors to bind their respective ligands (Carruthers et al. 1994, Couvineau et al. 1995, Kee et al. 2005). However, in sharp contrast to this concept, substitution of Asp56 with Gly (D→G, cGHRHR-G) or Ala (D→A, cGHRHR-A) has little effect on cGHRHR signaling and only causes slightly reduced potencies of GHRH on activating two receptor mutants (Fig. 5). To our knowledge, our finding provides the unique and important piece of direct evidence that the conserved Asp56 is not a crucial determinant for receptor activation and direct interaction between GHRH and GHRHR. In view of the remarkable conservation of Asp56 in all GPCRs belonging to secretin/VIP/GHRHR subfamily (Fig. 1; Sherwood et al. 2000, Harmar 2001, Mayo et al. 2003), it leads us to hypothesize that the presence of aspartic acid residue confers these receptors a right conformational structure required for high-affinity ligand binding, and mutation of this residue may result in the formation of a steric obstacle in their binding pockets, which would interfere with the receptor–ligand interaction.
Since cGHRHR-v1 and two receptor mutants could be activated by chicken and human GHRH, it led us to further examine whether the N-terminal 36 amino acid residues or Asp56 is involved in determining the ligand-binding specificity or selectivity of cGHRHR. In this study, PACAP38, a peptide structurally and functionally related to GHRH, was used (Sherwood et al. 2000). Consistent with our previous study, oPACAP38 activates cGHRHR with a potency much lower than that of human or chicken GHRH (Fig. 6; Wang et al. 2007). Similarly, oPACAP38 also activates two cGHRHR mutants and cGHRHR-v1 with potencies much lower than human or chicken GHRH (Figs 4–6), clearly indicating that mutation of aspartate 56 (Asp56) or deletion of residues 50–85 could not abolish the selectivity of cGHRHR or cGHRHR-v1. In agreement with our findings, DeAlmeida & Mayo (1998), using a chimeric receptor approach, have also demonstrated transmembrane domains and/or extracellular loops, instead of the N-terminal extracellular domain, of human GHRHR to be critical in determining the specificity of ligand binding.
It is of particular interest to point out that in our study, cGHRHR mutants (cGHRHR-A or cGHRHR-G) could still be activated by human GHRH (Fig. 5). This finding appears to contrast the studies in mammals. In mice, GHRHR mutant with a substitution of aspartate (Asp60) is unable to bind mouse GHRH and signal intracellular cAMP accumulation (Godfrey et al. 1993, Lin et al. 1993, Gaylinn et al. 1999). This remarkable difference implies that a coevolutionary event may have occurred in both mammalian GHRH and GHRHR genes (Wang et al. 2007).
Unlike cGHRHR-v1, cGHRHR-v2 could not transduce signal in response to GHRH or PACAP. The inability of signaling through cAMP pathway is not surprising since the predicted cGHRHR-v2 only has four transmembrane domains and lacks the third IL3 and C-terminal tail, both of which have been demonstrated to be critical for G-protein (Gs or Gi) coupling and activation of GPCRs (O'Dowd et al. 1988, Minneman 2001).
The co-expression of cGHRHR and its variants in normal pituitary raises an interesting issue regarding their physiological relevance in vivo. In this study, both cGHRHR and cGHRHR-v1 alone could signal cAMP–PKA pathway upon agonist stimulation; however, cGHRHR-v1 could only be activated by GHRH at high concentrations (≥10−8 M; Fig. 4), suggesting that cGHRHR-v1 is less likely to be directly involved in triggering cAMP accumulation in vivo. Interestingly, co-expression of cGHRHR-v1 and cGHRHR leads to the reduction in fold increase of ligand-stimulated luciferase activity of CHO cells and a right-shifted dose–response curve, suggesting that cGHRHR-v1 may inhibit the signaling of full-length cGHRHR when co-expressed in CHO cells. The underlying mechanism is unclear. One possible explanation is that cGHRHR-v1 may form hetero-complexes with the full-length cGHRHR on the cell surface, thereby inhibiting the function of full-length cGHRHR, as have previously been demonstrated for secretin receptor variant without exon 3 (Ding et al. 2002a,b). The expression level of cGHRHR-v1 is much lower than that of cGHRHR in pituitaries of most individuals examined (Fig. 3) and the inhibitory effect of cGHRHR-v1 is shown to be concentration-dependent in vitro (Fig. 7); thus, whether cGHRHR-v1 could modulate GHRHR signaling in the pituitary under normal physiological conditions remains to be further clarified.
There is also evidence showing that GPCR with four transmembrane domains, such as truncated gonadotropin-releasing hormone receptor and V2 vasopressin receptor (No2), could act as an inhibitor to control the signaling of GPCR by directing degradation of full-length receptor and diminishing its cell surface expression (Grosse et al. 1997, Zhu & Wess 1998). However, co-expression of cGHRHR-v2 with cGHRHR does not display any inhibitory effect on cGHRHR function despite the high concentration of cGHRHR-v2 expression plasmid used (cGHRHR-v2:cGHRHR=1:1). Thus, the physiological relevance of cGHRHR-v2 expressed in pituitary remains to be elucidated in our future study.
In summary, two GHRHR splice variants, cGHRHR-v1 and cGHRHR-v2, were identified and shown to be expressed in normal chicken pituitaries. cGHRHR-v2 is a receptor variant with four transmembrane domains and incapable of transmitting signal upon ligand stimulation. cGHRHR-v1 is a splice variant with an N-terminal deletion of 36 amino acid residues including Asp56 conserved in GPCR B-I subfamily. Functional studies further demonstrated that both cGHRHR-v1 and cGHRHR mutants with a substitution of Asp56 could be activated by GHRH and PACAP. Our study, for the first time, provides direct evidence that the conserved Asp56, though required for full function of cGHRHR, is nonessential for receptor activation and direct receptor–ligand interaction (Fig. 5).
Acknowledgements
This work was supported by Research Grant Council of the Hong Kong Government HKU7345/03M, HKU Faculty of Science Research Development Fund and The University of Hong Kong Research Development Fund for Strategic Research Theme on Genomics, Proteomics and Bio-informatics 10206152-11222-21700-302-01. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.
References
Carruthers CJ, Unson CG, Kim HN & Sakmar TP 1994 Synthesis and expression of a gene for the rat glucagon receptor. Replacement of an aspartic acid in the extracellular domain prevents glucagon binding. Journal of Biological Chemistry 269 29321–29328.
Couvineau A, Gaudin P, Maoret JJ, Rouyer-Fessard C, Nicole P & Laburthe M 1995 Highly conserved aspartate 68, tryptophane 73 and glycine 109 in the N-terminal extracellular domain of the human VIP receptor are essential for its ability to bind VIP. Biochemical and Biophysical Research Communications 206 246–252.
Dautzenberg FM, Mevenkamp G, Wille S & Hauger RL 1999 N-terminal splice variants of the type I PACAP receptor: isolation, characterization and ligand binding/selectivity determinants. Journal of Neuroendocrinology 11 941–949.
DeAlmeida VI & Mayo KE 1998 Identification of binding domains of the growth hormone-releasing hormone receptor by analysis of mutant and chimeric receptor proteins. Molecular Endocrinology 12 750–765.
Ding WQ, Cheng ZJ, McElhiney J, Kuntz SM & Miller LJ 2002a Silencing of secretin receptor function by dimerization with a misspliced variant secretin receptor in ductal pancreatic adenocarcinoma. Cancer Research 62 5223–5229.
Ding WQ, Kuntz S, Bohmig M, Wiedenmann B & Miller LJ 2002b Dominant negative action of an abnormal secretin receptor arising from mRNA missplicing in a gastrinoma. Gastroenterology 122 500–511.
Frohman LA & Kineman RD 2002 Growth hormone-releasing hormone and pituitary development, hyperplasia and tumorigenesis. Trends in Endocrinology and Metabolism 13 299–303.
Gaylinn BD 2002 Growth hormone releasing hormone receptor. Receptors and Channels 8 155–162.
Gaylinn BD, Dealmeida VI, Lyons CE Jr, Wu KC, Mayo KE & Thorner MO 1999 The mutant growth hormone-releasing hormone (GHRH) receptor of the little mouse does not bind GHRH. Endocrinology 140 5066–5074.
Giustina A & Veldhuis JD 1998 Pathophysiology of the neuroregulation of growth hormone secretion in experimental animals and the human. Endocrine Reviews 19 717–797.
Godfrey P, Rahal JO, Beamer WG, Copeland NG, Jenkins NA & Mayo KE 1993 GHRH receptor of little mice contains a missense mutation in the extracellular domain that disrupts receptor function. Nature Genetics 4 227–232.
Grosse R, Schoneberg T, Schultz G & Gudermann T 1997 Inhibition of gonadotropin-releasing hormone receptor signaling by expression of a splice variant of the human receptor. Molecular Endocrinology 11 1305–1318.
Harmar AJ 2001 Family-B G-protein-coupled receptors. Genome Biology 2 3013 (Reviews).
Harvey S 1999 GHRH: a growth hormone-releasing factor in birds? In Neural Regulation in the Vertebrate Endocrine System, pp 69–83. Eds Prasada Rao PD, Peter RE. New York: Kluwer Academic/Plenum Publishers.
Hashimoto K, Koga M, Motomura T, Kasayama S, Kouhara H, Ohnishi T, Arita N, Hayakawa T, Sato B & Kishimoto T 1995 Identification of alternatively spliced messenger ribonucleic acid encoding truncated growth hormone-releasing hormone receptor in human pituitary adenomas. Journal of Clinical Endocrinology and Metabolism 80 2933–2939.
Hassan HA 2001 Biological activities of two porcine growth hormone-releasing hormone receptor isoforms. Archives of Biochemistry and Biophysics 387 20–26.
Kee F, Ng SS, Vaudry H, Pang RT, Lau EH, Chan SM & Chow BK 2005 Aspartic acid scanning mutation analysis of a goldfish growth hormone-releasing hormone (GHRH) receptor specific to the GHRH salmon-like peptide. General and Comparative Endocrinology 140 41–51.
Kilpatrick GJ, Dautzenberg FM, Martin GR & Eglen RM 1999 7TM receptors: the splicing on the cake. Trends in Pharmacological Sciences 20 294–301.
Leung FC & Taylor JE 1983 In vivo and in vitro stimulation of growth hormone release in chickens by synthetic human pancreatic growth hormone releasing factor (hpGRFs). Endocrinology 113 1913–1915.
Lin SC, Lin CR, Gukovsky I, Lusis AJ, Sawchenko PE & Rosenfeld MG 1993 Molecular basis of the little mouse phenotype and implications for cell type-specific growth. Nature 364 208–213.
Lin-Su K & Wajnrajch MP 2002 Growth hormone releasing hormone (GHRH) and the GHRH receptor. Reviews in Endocrine and Metabolic Disorders 3 313–323.
Mayo KE 1992 Molecular cloning and expression of a pituitary-specific receptor for growth hormone-releasing hormone. Molecular Endocrinology 6 1734–1744.
Mayo KE, Miller LJ, Bataille D, Dalle S, Goke B, Thorens B & Drucker DJ 2003 International Union of Pharmacology. XXXV. The glucagon receptor family. Pharmacological Reviews 55 167–194.
McElvaine AT & Mayo KE 2006 A dominant-negative human growth hormone-releasing hormone (GHRH) receptor splice variant inhibits GHRH binding. Endocrinology 147 1884–1894.
Miller TL, Godfrey PA, Dealmeida VI & Mayo KE 1999 The rat growth hormone-releasing hormone receptor gene: structure, regulation, and generation of receptor isoforms with different signaling properties. Endocrinology 140 4152–4165.
Minneman KP 2001 Splice variants of G protein-coupled receptors. Molecular Interventions 1 108–116.
O'Dowd BF, Hnatowich M, Regan JW, Leader WM, Caron MG & Lefkowitz RJ 1988 Site-directed mutagenesis of the cytoplasmic domains of the human β 2-adrenergic receptor. Localization of regions involved in G protein-receptor coupling. Journal of Biological Chemistry 263 15985–15992.
Petersenn S & Schulte HM 2000 Structure and function of the growth-hormone-releasing hormone receptor. Vitamins and Hormones 59 35–69.
Porter TE, Ellestad LE, Fay A, Stewart JL & Bossis I 2006 Identification of the chicken growth hormone-releasing hormone receptor (GHRH-R) mRNA and gene: regulation of anterior pituitary GHRH-R mRNA levels by homologous and heterologous hormones. Endocrinology 147 2535–2543.
Scanes CG & Harvey S 1984 Stimulation of growth hormone secretion by human pancreatic growth-hormone-releasing factor and thyrotrophin-releasing hormone in anaesthetized chickens. General and Comparative Endocrinology 56 198–203.
Scanes CG, Harvey S, Rivier J & Vale W 1986 Stimulation of in vivo growth hormone secretion in young chickens by rat hypothalamic growth hormone-releasing factor and synthetic analogues. Journal of Endocrinology 108 413–416.
Sherwood NM, Krueckl SL & McRory JE 2000 The origin and function of the pituitary adenylate cyclase-activating polypeptide (PACAP)/glucagon superfamily. Endocrine Reviews 21 619–670.
Toogood AA, Harvey S, Thorner MO & Gaylinn BD 2006 Cloning of the chicken pituitary receptor for growth hormone-releasing hormone. Endocrinology 147 1838–1846.
Wang CY, Wang Y, Li J & Leung FC 2006 Expression profiles of growth hormone-releasing hormone and growth hormone-releasing hormone receptor during chicken embryonic pituitary development. Poultry Science 85 569–576.
Wang Y, Li J, Ying Wang C, Ho Yan Kwok A & Leung FC 2007 Identification of the endogenous ligands for chicken growth hormone-releasing hormone (GHRH) receptor: evidence for a separate gene encoding GHRH in submammalian vertebrates. Endocrinology 148 2405–2416.
Zeitler P, Stevens P & Siriwardana G 1998 Functional GHRH receptor carboxyl terminal isoforms in normal and dwarf (dw) rats. Journal of Molecular Endocrinology 21 363–371.
Zhu X & Wess J 1998 Truncated V2 vasopressin receptors as negative regulators of wild-type V2 receptor function. Biochemistry 37 15773–15784.
(C Y Wang and Y Wang contributed equally to this work)
