Abstract
In this study, we tried to elucidate the changes in thyroid hormone (TH) receptor β2 (TRβ2) expression at the different levels of the hypothalamo–pituitary–thyroidal (HPT) axis during the last week of chicken embryonic development and hatching, a period characterized by an augmented activity of the HPT axis. We quantified TRβ2 mRNA in retina, pineal gland, and the major control levels of the HPT axis – brain, pituitary, and thyroid gland – at day 18 of incubation, and found the most abundant mRNA content in retina and pituitary. Thyroidal TRβ2 mRNA content increased dramatically between embryonic day 14 and 1 day post-hatch. In pituitary and hypothalamus, TRβ2 mRNA expression rose gradually, in parallel with increases in plasma thyroxine concentrations. Using in situ hybridization, we have demonstrated the presence of TRβ2 mRNA throughout the diencephalon and confirmed the elevation in TRβ2 mRNA expression in the hypophyseal thyrotropes. In vitro incubation with THs caused a down-regulation of TRβ2 mRNA levels in embryonic but not in post-hatch pituitaries. The observed expression patterns in pituitary and diencephalon may point to substantial changes in TRβ2-mediated TH feedback active during the perinatal period. The strong rise in thyroidal TRβ2 mRNA content could be indicative of an augmented modulation of thyroid development and/or function by THs toward and after hatching. Finally, THs proved to exert an age-dependent effect on pituitary TRβ2 mRNA expression.
Introduction
Late embryogenesis and the perinatal period in the chicken embryo are associated with substantial physiological changes, such as yolk sac retraction, transition from chorioallantoic to lung respiration, and the onset of endothermy (Decuypere et al. 1990). During this important phase of development, plasma thyroid hormone (TH) concentrations change markedly–with a profound increase toward the end of embryogenesis – and contribute to the critical events taking place around hatching (Decuypere et al. 1990). THs are known to play an important role in controlling their own secretion through feedback effects acting on the different levels of the hypothalamo–pituitary–thyroidal (HPT) axis. In birds, information on TH feedback is scarce. Most studies dealing with TH feedback have been performed at the hypophyseal level in embryos as well as in post-hatch chicks. Gregory et al. (1998) demonstrated a suppressive effect of THs on pituitary thyrotropin (TSH)-β mRNA levels in cultured anterior pituitary cells of 19-day-old embryos (E19). An increase in TSHβ mRNA expression was observed in 19-day-old embryos and 1-day-old (C1) chicks treated with methimazole, indicating that TH feedback is functional at this stage of development (Muchow et al. 2005). The THs are also able to inhibit in vitro corticotropin-releasing hormone (CRH)-induced TSH release in E19 and C8 animals (Geris et al. 1999).
THs exert their effects, including their feedback regulation, by binding to TH receptors (TRs) in the target cells, stimulating or inhibiting gene transcription. In chicken, three functional TR variants have been cloned: TRα, TRβ0, and TRβ2 (Sap et al. 1986, Forrest et al. 1990, Sjöberg et al. 1992). As TRβ2 is strongly expressed in chicken pituitary (Grommen et al. 2005) – it is even the most abundant isoform in rodent pituitary gland (Bradley et al. 1989, Hodin et al. 1989) – and given its role in mammalian TRH and TSH gene expression (Langlois et al. 1997, Abel et al. 1999, 2001, Nakano et al. 2004), our study focused on this receptor type. Our primary goal was to increase our knowledge of the TH feedback active during late embryogenesis and hatching and to examine whether a role is reserved for TRβ2 herein. We first determined TRβ2 mRNA levels in several brain parts, pituitary, thyroid gland, pineal gland, and retina. Subsequently, TRβ2 mRNA expression was quantified by real-time PCR in diencephalon, pituitary, and thyroid gland – the major control levels of the HPT axis – during the last week of embryonic development. Using in situ hybridization (ISH), we verified whether the density of the hypophyseal TRβ2 mRNA signal changes in the thyrotropic cells at E16 compared with E20 and investigated its distribution in diencephalon. As TH concentrations increase substantially during the perinatal period, we determined whether THs are able to alter TRβ2 mRNA expression levels in the embryonic and post-hatch pituitary in vitro.
Materials and Methods
All experiments were approved by the ethical committee for animal experiments of the K U Leuven.
Distribution of TRβ2 mRNA in embryonic tissues
Tissue sampling
Fertilized eggs from Cobb broiler chickens were purchased from Poel-Houben (Lummen, Belgium) and incubated in a laboratory incubator as described previously (Darras et al. 1992). The start of incubation was called day 1 (E1). At E18 animals were decapitated and the different brain parts, pituitary glands (pooled per 4), pineal glands (pooled per 4), thyroid glands (pooled per 3 pairs), and retinal tissue (pooled per 3 pairs) were collected, immediately frozen in liquid nitrogen, and stored at −80 °C.
RNA isolation and real-time PCR
Total RNA was isolated using Trizol reagent (Invitrogen) following the manufacturer's instructions. To rule out any genomic DNA contamination of the RNA, the samples were treated with DNase I using the DNA-free kit (Ambion, Austin, TX, USA). For each tissue, three individual samples or pools were used for analysis. One microgram of total RNA was reverse transcribed using 0.375 U/μl AMV reverse transcriptase (Invitrogen). Five microliter of cDNA, corresponding to ∼50 ng total RNA, were used for real-time PCR. Primers for TRβ2 – located in the unique amino-terminal region of the receptor (Sjöberg et al. 1992) – and the active reference β-actin were chosen using the Primer Express software v.2.0 (Applied Biosystems, Warrington, UK) and are listed in Table 1. The real-time PCR was performed using an ABI PRISM 7000 Sequence Detection System thermal cycler (Applied Biosystems) in a total volume of 25 μl with the following components: 1×Platinum SYBR Green (Invitrogen), 300 nM forward primer, and 300 nM reverse primer. The thermal cycle parameters used were 2 min at 50 °C, 2 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 30 s at 60 °C. The amplification program was followed by a dissociation protocol to detect any non-specific amplification. For each gene, a non-template control and a sample that was not reverse transcribed were added as negative controls. A 1:5 dilution series of pituitary cDNA was added as a standard. Each experimental sample was analyzed in triplo, and standard samples were measured in duplo.
Primers and probes used to amplify chicken TRβ2, β-actin, and GAPDH with real-time PCR
| Sequence (5′–3′) | Amplicon | |
|---|---|---|
| TRβ2 (X62642) | ||
| Forward primer | CCCAGCTGCTGGTAGCAATT | bp 55–74 |
| Reverse primer | CCTGAGCATCACAACTGCTGTA | bp 125–146 |
| β-actin (NM_205518) | ||
| Forward primer | ATGGCTCCGGTATGTGCAA | bp 103–122 |
| Reverse primer | TGTCTTTCTGGCCCATACCAA | bp 202–222 |
| GAPDH (NM_204305) | ||
| Forward primer | GAAGCTTACTGGAATGGCTTTCC | bp 729–751 |
| Reverse primer | GATATCATCATACTTGGCTGGTTTCTC | bp 825–799 |
| Sequence (5′–3′) | Bp numbering | |
|---|---|---|
| Taqman probes | ||
| TRβ2 | FAM-AGTCCACTGATTATTGC-NFQ-MGB | bp 85–100 |
| β-actin | FAM-CCCCAGACATCAGGGT-NFQ-MGB | bp 179–194 |
The EMBL accession number is indicated in parentheses beside each gene. TRβ2, thyroid hormone receptor β2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FAM, 6-carboxy fluorescein; NFQ, non-fluorescent quencher; MGB, minor groove binder; bp, base pair.
TRβ2 mRNA expression at the different levels of the HPT axis during the last week of embryonic development
Tissue sampling
Fertilized eggs from Ross (pituitary) or Cobb (diencephalon, thyroid gland) broiler chickens were purchased from Avibel (Halle-Zoersel, Belgium) and Poel-Houben respectively and incubated in a laboratory incubator for 21 days as described earlier. At day 20 (E20) of embryonic development, we made a distinction between animals that had already switched from allantois to lung respiration, which we called the internal pipping stage (E20IP), and animals that had not perforated the membrane of the air chamber, which was termed the non-pipping stage (E20NP). Blood and tissue samples were taken every day starting from E14 until 1-day-old chicks (C1). After collecting blood samples by heart puncture (embryos) or by decapitation (post-hatch chicks), pituitary glands (pooled per 5), thyroid glands (pooled per 3 pairs), and hypothalami were collected, frozen in liquid nitrogen, and stored at −80 °C. To examine the changes in TRβ2 mRNA expression in the thyrotropes and non-thyrotropic cell regions with ISH, E16 and E20IP pituitaries were collected and kept in 4% (w/v) paraformaldehyde (PFA) in PBS (pH 7.4) at 4 °C. After 24 h, tissues were cryoprotected overnight in the same solution with 30% (w/v) sucrose. The pituitaries were subsequently stored at −80 °C until sectioning. Twenty micrometer sections were cut with a cryostat and kept in a cryoprotectant solution containing 30% (v/v) ethylene glycol and 30% (v/v) glycerol in 0.1 M phosphate buffer at −80 °C.
RNA isolation and real-time PCR
In a first experiment, pituitary total RNA was isolated using the RNAgents Total RNA Isolation System (Promega), while in a second experiment, diencephalic and thyroidal total RNA was extracted with Trizol reagent (Invitrogen) according to the manufacturer's guidelines. Three pools of pituitary glands and thyroid glands and four diencephali of each developmental stage were used for RNA isolation. The samples were subsequently treated with DNase I using the DNA-free kit (Ambion). Reverse transcription was performed with the Reverse Transcription Reagents (Applied Biosystems) or using 0.375 U/μl AMV reverse transcriptase (Invitrogen). Five microliter of cDNA, corresponding to ∼50 ng or 100 ng total RNA, were used for real-time PCR. For the measurement of TRβ2 and β-actin expression in the pituitary gland, the primers were combined with a Taqman probe (Table 1). The real-time PCR was performed as described in Grommen et al. (2005). When measuring the diencephalic and thyroidal TRβ2 expression, the same primers were applied with SYBR Green using the real-time PCR protocol described in the tissue distribution experiment. In pituitary gland, β-actin mRNA was expressed at a constant level during late embryogenesis as measured with real-time PCR, while GAPDH was a more stable active reference in diencephalon and thyroid gland (own observation). The primers for GAPDH are listed in Table 1. For each gene, a non-template control and a sample that was not reverse transcribed were added as negative controls. For the TRβ2 mRNA expression in pituitary, a 1:2 dilution series of pituitary cDNA was added as a standard on every 96-well optical reaction plate. The diencephalic and thyroidal TRβ2 mRNA values were calculated using the ΔΔCt method after performing a validation experiment as described in Applied Biosystems User Bulletin No.2 (P/N 4303859). Each experimental sample was analyzed in triplo, and standard samples were measured in duplo.
RIA
Plasma 3,5,3′,5′-tetraiodothyronine (T4) concentrations were measured as described previously (Van der Geyten et al. 2001).
Combined ISH–immunohistochemistry (IHC)
Riboprobes were transcribed from 1 μg linearized plasmid containing a cDNA insert of chicken TRβ2 in the presence of 50 μCi [35S]UTP (Perkin–Elmer, Wellesly, MA, USA) and 20 U RNA polymerase (SP6 for antisense and T7 for sense probes; Roche Diagnostics). The TRβ2 insert was chosen in the unique amino-terminal region of the receptor and is located from base pairs 74–338 (EMBL accession number X62642). In situ hybridization was performed on free-floating cryosections of E16 and E20IP pituitaries and followed by immunohistochemical staining of the thyrotropic cells with a homologous anti-TSHβ antibody as described by De Groef et al. (2003).
Quantification of TRβ2 ISH signal
Sections were analyzed with a Leitz DM RBE microscope equipped with a color video camera (Optronics Engineering, Goleta, CA, USA) and connected to a computer-aided analysis system (Bioquant, R and M Biometrics, Nashville, TN, USA) as described in Arckens et al. (1998). The thyrotropic cells were identified in light microscopy mode based on anti-TSH immunoreactivity. The areal surface of each immunoreactive cell was outlined using the computer mouse. Upon switching to dark-field mode, we then automatically counted the number of overlaying pixels, with a brightness exceeding a pre-determined threshold, per μm2 inside these TSH cell outlines. The number of silver grain pixels/μm2 was determined for ∼100 thyrotropic cells per age group. In addition, we measured the number of silver grain pixels/μm2 for ∼80 regions of comparable size but positioned in between the thyrotropes for both age groups (Table 2).
Quantification of the number of silver grain pixels (TRβ2 mRNA in situ hybridization signal) overlaying the thyrotropic cells and areas covered by non-thyrotropic cells in the pituitary of 16-day-old chicken embryos (E16) and 20-day-old embryos at the internal pipping stage (E20IP). Values are means±s.e.m. with n=∼100 for the thyrotropic cells and n=∼80 for the non-thyrotropic cell regions.
| E16 | E20IP | |
|---|---|---|
| Thyrotropes | 12.41±1.49 | 30.59±1.66*** |
| Non-thyrotropic cells | 12.74±0.76 | 34.29±1.61*** |
Data are expressed as pixels/100 μm2. A significant difference between both age groups is indicated with ***(student's t-test, P<0.001). TRβ2, thyroid hormone receptor β2.
Localization of TRβ2 mRNA in diencephalon
Tissue sampling and preparation
Cobb broiler chicks (Poel-Houben) were kept in warmed cages and provided with food and water ad libitum. Brains from C5 chicks were fixed by transcardiac perfusion with 1% PFA in PBS for 1 min and PBS with 4% PFA for 10 min. After removal, brains were kept in PBS containing 4% PFA for 24 h at 4 °C, in PBS for another 24 h at 4 °C and cryoprotected overnight in PBS with 10% sucrose at 4 °C. Finally, the tissue was embedded in 10% gelatin (w/v) and 10% sucrose in PBS and stored at −80 °C. Cryosections of 30 μm were cut and stored at −80 °C.
In situ hybridization
Sections were fixed with 4% PFA in PBS for 10 min. After washing in PBS for 3×5 min, the slides were treated for 10 min with 0.2 M HCl, 10 min with 0.25% (v/v) acetic anhydride in 0.1 M triethanolamine, 30 min with PBS with 1% (v/v) Triton X-100 (TX), and washed 3×5 min in PBS. Next, the sections were prehybridized for 2 h at room temperature in hybridization buffer (50% (v/v) formamide, 10% (w/v) dextran sulfate, 5×Denhardt's, 0.62 M NaCl, 20 mM sodium piperazine-N,N′-bis(2-ethanesulfonic acid) (pH 6.8), 10 mM EDTA, and 0.2% (w/v) SDS, adjusted to 50 ml with diethylpyrocarbonate-treated water), containing 50 mM dithiothreitol, 250 μg/ml herring sperm DNA, and 250 μg/ml yeast RNA. Finally, the sections were incubated overnight at 80 °C in hybridization buffer containing 400 ng/ml antisense or sense digoxigenine (DIG)-labeled cRNA probe. Riboprobes were transcribed from 1 μg linearized pCRII-TOPO plasmid (Invitrogen) containing an insert of the chicken TRβ2 (base pairs 74–338, base pair numbering based on EMBL accession number X62642) in the presence of DIG RNA labeling mix and 40 U RNA polymerase, SP6 for antisense, and T7 for sense probes (Roche Diagnostics). A spotting test was performed to check the efficiency of the labeling. Coverslips were removed by soaking the sections in 5×saline sodium citrate (SSC) at 72 °C. After washing for 45 min in 2×SSC at 72 °C, 2×5 min in 2×SSC at room temperature and 3×5 min in PBS with 0.1% TX, slides were treated for 1 h at room temperature with PBS containing 4% (w/v) BSA, 0.1% TX, and 0.1 M lysine. They were subsequently incubated overnight at 4 °C in alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics) diluted 1/5000 in PBS with 4% BSA and 0.1% TX. The alkaline phosphatase signal was detected using the nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate toluidine salt (NBT/BCIP) chromagen system (Roche Diagnostics) according to the manufacturer's guidelines.
In vitro incubation of pituitaries with 3,5,3′-tri-iodothyronine (T3) or T4
Sampling, incubation, and analysis of TRβ2 mRNA expression
Studies were performed on pituitaries of embryonic (E18) and post-hatch (C10) Ross broiler chickens (Avibel). Animals were killed by decapitation and the pituitaries were immediately transferred to 24-well plates with ice-cold M199 medium (Gibco). The medium was replaced with pre-warmed medium, and the pituitaries were incubated individually at 37 °C for 1 h of pre-equilibration. The medium was then substituted with new pre-warmed medium (control) or medium containing 10 or 100 nM T3 or T4. The pituitaries were collected after 30 min of incubation. For each treatment, three pools of eight pituitaries were frozen on dry ice and stored at −80 °C until analysis. Total RNA was isolated using the RNAgents Total RNA Isolation System (Promega). The real-time PCR analysis was performed as described for the pituitary TRβ2 expression during embryonic development. Results were calculated using the ΔΔCt method. For each age group, the different treatments were analyzed on separate 96-well plates, and on each plate one pool was chosen as a calibrator.
Statistical analysis
Statistical analysis was performed using the SAS program (SAS Institute, Cary, NC, USA). Real-time PCR data of the TRβ2 mRNA expression in diencephalon, pituitary gland, and thyroid gland were analyzed using Scheffé's lines on ranked values. Statistical differences in silver grain pixel counts between E16 and E20IP pituitaries were calculated using a student's t-test. The non-parametric Wilcoxon (Rank Sum) Test was used for the statistical analysis of the in vitro incubation data.
Results
Distribution of TRβ2 mRNA in embryonic tissues
TRβ2 mRNA expression was determined in different parts of the brain, pituitary gland, thyroid gland, pineal gland, and retinal tissue of 18-day-old embryos using real-time PCR (Fig. 1). At this embryonic stage, TRβ2 mRNA could be detected in all the examined tissues, but the most abundant expression was observed in retina and pituitary gland, with respectively a ten- and threefold higher TRβ2 mRNA amount compared with diencephalon.
Distribution of TRβ2 mRNA in various tissues of 18-day-old embryos measured with real-time PCR. Results were calculated using the standard curve method and expressed as mean relative values±s.e.m. (n=3 tissues or 3 pools of tissues).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Distribution of TRβ2 mRNA in various tissues of 18-day-old embryos measured with real-time PCR. Results were calculated using the standard curve method and expressed as mean relative values±s.e.m. (n=3 tissues or 3 pools of tissues).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Distribution of TRβ2 mRNA in various tissues of 18-day-old embryos measured with real-time PCR. Results were calculated using the standard curve method and expressed as mean relative values±s.e.m. (n=3 tissues or 3 pools of tissues).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
TRβ2 mRNA expression at the different levels of the HPT axis during the last week of embryonic development
TRβ2 mRNA expression was measured in thyroid gland and diencephalon (Fig. 2A) as well as in pituitary gland (Fig. 2B) from E14 till C0/C1 with real-time PCR. In thyroid tissue, we observed a dramatic rise in TRβ2 mRNA values during this developmental period as TRβ2 mRNA expression had increased 20-fold at E18 and 60-fold at C1 in comparison with E14. In both pituitary gland and diencephalon, mRNA levels rose gradually during the last week of embryogenesis with peak values at embryonic day 20. At E20IP, pituitary and diencephalic mRNA expression was significantly higher compared with E14 and E15, and in case of the pituitary also E16. The developmental pattern of TRβ2 mRNA expression in diencephalon and pituitary closely resembled concurring plasma T4 profiles (Fig. 2A and B).
Thyroid hormone receptor β2 mRNA expression in (A) thyroid gland and diencephalon and (B) pituitary gland during the last week of embryonic development, expressed as mean relative values±s.e.m. (thyroid gland, n=3 pools; diencephalon, n=4; pituitary, n=3 pools). Plasma T4 concentrations corresponding to each experiment are shown in the upper panels as means (pmol/ml)±s.e.m. (A, n=20; B, n=13–17). Samples with a common letter are not significantly different (TRβ2: Scheffé's test on ranked values, P<0.05; T4: Scheffé's test, P<0.05).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Thyroid hormone receptor β2 mRNA expression in (A) thyroid gland and diencephalon and (B) pituitary gland during the last week of embryonic development, expressed as mean relative values±s.e.m. (thyroid gland, n=3 pools; diencephalon, n=4; pituitary, n=3 pools). Plasma T4 concentrations corresponding to each experiment are shown in the upper panels as means (pmol/ml)±s.e.m. (A, n=20; B, n=13–17). Samples with a common letter are not significantly different (TRβ2: Scheffé's test on ranked values, P<0.05; T4: Scheffé's test, P<0.05).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Thyroid hormone receptor β2 mRNA expression in (A) thyroid gland and diencephalon and (B) pituitary gland during the last week of embryonic development, expressed as mean relative values±s.e.m. (thyroid gland, n=3 pools; diencephalon, n=4; pituitary, n=3 pools). Plasma T4 concentrations corresponding to each experiment are shown in the upper panels as means (pmol/ml)±s.e.m. (A, n=20; B, n=13–17). Samples with a common letter are not significantly different (TRβ2: Scheffé's test on ranked values, P<0.05; T4: Scheffé's test, P<0.05).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
The substantial change in pituitary TRβ2 mRNA expression was confirmed by ISH combined with IHC detection of the thyrotropic cells (Fig. 3A and B). At both incubation stages TRβ2 mRNA was present in the thyrotropic cells, but substantial ISH signal was also visible on other hypophyseal cell types. The grain density, expressed as pixels/100 μm2, was approximately three times higher in the thyrotropes – as well as in the area covered by non-thyrotropic cells – of E20IP pituitary sections in comparison with E16 (Table 2); when performing an ISH with the sense probe, no signal was observed (Fig. 3C).
Combined in situ hybridization (ISH)–immunohistochemistry (IHC) for the detection of TRβ2 mRNA (black dots) and thyrotropic cells (brown) in the pituitary gland of 16-day-old (E16) and 20-day-old embryos at the internal pipping stage (E20IP). (A and B) ISH–IHC using the antisense probe. (C) ISH–IHC using the sense probe (negative control). Bar=10 μm.
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Combined in situ hybridization (ISH)–immunohistochemistry (IHC) for the detection of TRβ2 mRNA (black dots) and thyrotropic cells (brown) in the pituitary gland of 16-day-old (E16) and 20-day-old embryos at the internal pipping stage (E20IP). (A and B) ISH–IHC using the antisense probe. (C) ISH–IHC using the sense probe (negative control). Bar=10 μm.
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Combined in situ hybridization (ISH)–immunohistochemistry (IHC) for the detection of TRβ2 mRNA (black dots) and thyrotropic cells (brown) in the pituitary gland of 16-day-old (E16) and 20-day-old embryos at the internal pipping stage (E20IP). (A and B) ISH–IHC using the antisense probe. (C) ISH–IHC using the sense probe (negative control). Bar=10 μm.
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Localization of TRβ2 mRNA in diencephalon
We have also detected TRβ2 mRNA expression in the hypothalamic region of a 5-day-old chick using ISH with DIG-labeled riboprobes. The staining signal indicated that this receptor was widely expressed throughout the diencephalon including the peri- and paraventricular nuclei (Fig. 4A and B). When using the sense probe, no signal was observed (Fig. 4C).
Localization of TRβ2 mRNA in the hypothalamic region of a 5-day-old chick with in situ hybridization (ISH). (A and B) ISH using the antisense probe. (C) ISH performed with the sense probe (negative control). Bar=200 μm (A) or 50 μm (B and C) (PVN, paraventricular nucleus; PHN, periventricular nucleus; III, third brain ventricle).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Localization of TRβ2 mRNA in the hypothalamic region of a 5-day-old chick with in situ hybridization (ISH). (A and B) ISH using the antisense probe. (C) ISH performed with the sense probe (negative control). Bar=200 μm (A) or 50 μm (B and C) (PVN, paraventricular nucleus; PHN, periventricular nucleus; III, third brain ventricle).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Localization of TRβ2 mRNA in the hypothalamic region of a 5-day-old chick with in situ hybridization (ISH). (A and B) ISH using the antisense probe. (C) ISH performed with the sense probe (negative control). Bar=200 μm (A) or 50 μm (B and C) (PVN, paraventricular nucleus; PHN, periventricular nucleus; III, third brain ventricle).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Effect of THs on TRβ2 mRNA expression in E18 and C10 pituitaries
Pituitaries of E18 and C10 chicks were treated in vitro with two doses (10 and 100 nM) of T3 or T4 for 30 min (Fig. 5). A twofold decline in TRβ2 mRNA expression occurred after treating E18 pituitaries with 10 nM T3 as well as with 100 nM T3 or T4. TRβ2 mRNA expression in C10 pituitaries was unaffected regardless of the treatment dose.
Expression of TRβ2 mRNA in pituitaries of 18-day-old embryos (E18) and 10-day-old chicks (C10) incubated with 10 or 100 nM T3, T4, or control medium for 30 min. Relative differences were measured with real-time PCR and calculated using the ΔΔCt method. Results were expressed as mean relative values±s.e.m. (n=3 pools of tissues). Significantly different results compared with corresponding control values are indicated with *(Wilcoxon rank sum test, P<0.05).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Expression of TRβ2 mRNA in pituitaries of 18-day-old embryos (E18) and 10-day-old chicks (C10) incubated with 10 or 100 nM T3, T4, or control medium for 30 min. Relative differences were measured with real-time PCR and calculated using the ΔΔCt method. Results were expressed as mean relative values±s.e.m. (n=3 pools of tissues). Significantly different results compared with corresponding control values are indicated with *(Wilcoxon rank sum test, P<0.05).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Expression of TRβ2 mRNA in pituitaries of 18-day-old embryos (E18) and 10-day-old chicks (C10) incubated with 10 or 100 nM T3, T4, or control medium for 30 min. Relative differences were measured with real-time PCR and calculated using the ΔΔCt method. Results were expressed as mean relative values±s.e.m. (n=3 pools of tissues). Significantly different results compared with corresponding control values are indicated with *(Wilcoxon rank sum test, P<0.05).
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0443
Discussion
In this study, we demonstrated the presence of TRβ2 mRNA in chicken thyroid gland, pituitary gland (including the thyrotropic cells), and diencephalon – together constituting the HPT axis. Guissouma et al. (1998) found that chicken TRβ2 – in contrast with chicken TRα – is able to induce a T3-dependent regulation of rat TRH transcription when co-expressed with a rat TRH promoter-luciferase construct in murine hypothalamus. The amino terminus of the chicken TRβ2 is 87% identical to the human isoform, and amino acids important for the negative regulation of TRH by T3 in humans are completely conserved in chicken (Langlois et al. 1997). In combination with our present findings, these observations suggest a role for TRβ2 in the negative feedback regulation of TSH and TSH-regulating hormones in the chicken. Next to TRβ2, TRα and TRβ0 have also been detected in the pituitary gland of the domestic duck (Bishop et al. 2000) and the hypothalamus of the chick (Forrest et al. 1991). Therefore, these receptor isoforms could also contribute to the TH feedback effects in the HPT axis. However, TRβ isoforms seem to play a more important role than TRα in the TH-regulated inhibition of TRH gene expression, since only TRβ0- and not TRα-dependent TRH transcription was modulated by T3 in chicken hypothalamic cells (Lezoualc'h et al. 1992). Likewise, several studies in mammals point to an important role for the β-isoforms in mediating TH-induced TSH and TRH down-regulation (Weiss et al. 1997, Abel et al. 1999, 2001). Moreover, TRβ2 exhibited the strongest suppression of the TSHβ promoter in the presence of T3 in CV1 cells (Nakano et al. 2004).
At the level of the pituitary gland, we observed that TRβ2 mRNA levels rose gradually during the last week of chicken embryogenesis. THs are known to decrease TSHβ mRNA levels in chicken anterior pituitary cells (Gregory et al. 1998), and a negative TH responsive element has been found in the promoter region of the TSHβ gene in the Japanese crested ibis (Kawasaki et al. 2003). Therefore, the strong increase in TRβ2 mRNA levels before hatching – which can also be observed in the thyrotropes specifically (present study) – could account for the lowered activity of the HPT axis early post-hatch. Besides suppressing TSHβ gene transcription directly, THs are able to up-regulate the expression of hypophyseal somatostatin (SS) receptor subtypes 2 and 5 (SSTR2, SSTR5) – which mediate the inhibition of TRH- and CRH-induced TSH release by SS (Geris et al. 2003, De Groef et al. 2007). The respective decrease in TSHβ (De Groef et al. 2006) and increase in SSTR2 and SSTR5 mRNA levels between E19 and hatching could be the result of the coinciding rise in TRβ2 mRNA expression. It is interesting to note that TRβ2 is not confined to the thyrotropic cells and that the increase in TRβ2 mRNA expression in the pituitary during the last week of embryonic development occurs in thyrotropic as well as non-thyrotropic hypophyseal cells. Hence, changes in receptor expression in the pituitary likely also reflect an altered TH effect on other hormonal axes.
TRβ2 mRNA was widely expressed in chicken diencephalon and was also readily detected in all brain parts with real-time PCR. Together with the widespread distribution of immunoreactive TRβ2 in the central nervous system of the rat (Lechan et al. 1993), this implicates a significant role for TRβ2 in mediating TH action in vertebrate brain. As we measured ontogenic changes of TRβ2 mRNA levels in the entire diencephalon, the observed elevated receptor expression could either represent a global change in TRβ2 mRNA levels or an augmented TRβ2 mRNA content in certain nuclei. In the paraventricular nucleus (PVN) and periventricular nucleus (PHN), TRβ2 may function to regulate the expression of TSH-releasing and release-inhibiting hormones as in mammals. THs are able to reduce TRH expression in the rodent PVN (Koller et al. 1987, Segerson et al. 1987, Yamada et al. 1989, Kakucska et al. 1992) and TRβ2 plays an important role in modulating mammalian TRH gene expression (Dupré et al. 2004).
The marked elevation in TRβ2 mRNA amount in the thyroid gland suggests a significant rise in the sensitivity of the thyroidal follicular cells for TH modulation. In contrast with the hypophyseal and diencephalic TRβ2 mRNA expression, the increase in mRNA values in the thyroid gland during late embryogenesis is much more pronounced and does not parallel the plasma T4 pattern toward and after hatching. At this point, it is not clear whether the rise in thyroidal TRβ2 mRNA signifies an elevated regulation of thyroid gland development by THs, or an increased ultra-short feedback regulation of thyroid function. The THs are able to induce cell proliferation in FRTL-5 cells (Akiguchi et al. 1992) and bovine thyroid cells depleted of endogenous T3 (Di Fulvio et al. 2000), but studies using transgenic mice proposed an important function for mainly TRα in the growth of the thyroid gland (Gauthier et al. 1999). Various studies suggest a suppressive action of THs on their production organ as THs evoke inhibitory effects mainly – both in vivo and in vitro – on several TSH-stimulated processes in the mammalian thyroid gland such as iodine uptake and sodium iodide symporter mRNA expression (Yu et al. 1976, Akiguchi et al. 1992, Spitzweg et al. 1999). The elevated TRβ2 mRNA content could therefore include an augmented negative action of THs on their production organ before and after hatching, which perhaps signifies that local fine-tuning becomes more and more important once TH concentrations have started to increase substantially.
As plasma TH concentrations change considerably during the second half of embryogenesis, we investigated the effect of TH treatment on the TRβ2 mRNA expression in E18 and C10 pituitaries in vitro. The THs reduced TRβ2 expression levels only in embryos and not in post-hatch chicks. A similar repression of TRβ2 mRNA levels was observed when GH3 cells were incubated with T3 (Hodin et al. 1989, Jones et al. 1993), while hypothyroidism leads to an up-regulation of TRβ2 mRNA in adult rat pituitary gland (Li & Boyages 1997). The different response of embryonic versus post-hatch pituitaries to a short-term TH challenge, as observed in this study, could be the result of an age-specific difference in regulatory factors participating in the control of TRβ2 gene transcription. Several co-activators and co-repressors involved in TR-mediated effects (e.g. steroid receptor coactivator (SRC)-1-3, SYT, NCoR) are expressed in an age-dependent way in mammals (Martinez de Arrieta et al. 2000, Iwasaki et al. 2005, Schmidt et al. 2007), but virtually no data concerning these regulatory molecules in chicken are available. The down-regulation of chicken TRβ2 mRNA content in embryonic pituitary following an acute TH treatment in vitro may seem contradictory to the increasing expression of TRβ2 coinciding with the rising T4 concentrations during late embryogenesis. It is not unlikely though, that an increase in plasma T4 concentrations for a longer period of time – in contrast with the short-term TH administration in our experiment – has an opposite effect on TRβ2 mRNA expression.
In conclusion, we have investigated whether the TRβ2 mRNA expression at the major control levels of the HPT axis alters during late embryogenesis and the perinatal period in the chicken. The presence of TRβ2 mRNA in these tissues may imply a role for this TR isoform in TH-mediated feedback effects. We detected a significant rise in pituitary and diencephalon TRβ2 mRNA levels toward hatching, and although expression was not restricted to the pituitary thyrotropes and the hypothalamic PVN and PHN, this significant increase could translate into an augmented regulation of the production of TSH and its regulatory hormones. In thyroid tissue, an impressive rise in receptor expression was noticeable during late embryogenesis till C1, indicative of an increasing modulation of thyroid development and/or function by THs. Furthermore, the regulation of TRβ2 expression by THs seems to be age dependent as T3 and T4 down-regulate receptor levels only in embryonic and not in post-hatch pituitaries in vitro.
Acknowledgements
The authors like to thank L Noterdaeme, W Van Ham, and F Voets for their technical assistance and Dr A Iwasawa (Gifu University, Gifu, Japan) for kindly donating the anti-TSHβ antibody. Bert De Groef is a postdoctoral fellow of the Research Foundation – Flanders (FWO-Vlaanderen). This work was partially funded by FWO project G.0582.06, and OT/05/34/TBA and OT/05/33 from the K U Leuven. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.
References
Abel ED, Boers ME, Pazes-Moura C, Moura E, Kaulbach H, Zakaria M, Lowell B, Radovick S, Liberman MC & Wondisford F 1999 Divergent roles for thyroid hormone receptor beta isoforms in the endocrine axis and auditory system. Journal of Clinical Investigation 104 291–300.
Abel ED, Ahima RS, Boers ME, Elmquist JK & Wondisford FE 2001 Critical role for thyroid hormone receptor beta2 in the regulation of paraventricular thyrotropin-releasing neurons. Journal of Clinical Investigation 107 1017–1023.
Akiguchi I, Strauss K, Borges M, Silva JE & Moses AC 1992 Thyroid hormone receptors and 3,5,3′-triiodothyronine biological effects in FRTL5 thyroid follicular cells. Endocrinology 131 1279–1287.
Arckens L, Eysel UT, Vanderhaeghen JJ, Orban GA & Vandesande F 1998 Effect of sensory deafferentation on the GABAergic circuitry of the adult cat visual system. Neuroscience 83 381–391.
Bishop CM, McCabe CJ, Gittoes NJ, Butler PJ & Franklyn JA 2000 Tissue-specific regulation of thyroid hormone receptor mRNA isoforms and target gene proteins in domestic ducks. Journal of Endocrinology 165 607–615.
Bradley DJ, Young WS III & Weinberger C 1989 Differential expression of alpha and beta thyroid hormone receptor genes in rat brain and pituitary. PNAS 86 7250–7254.
Darras VM, Visser TJ, Berghman LR & Kühn ER 1992 Ontogeny of type I and type III deiodinase activities in embryonic and posthatch chicks: relationship with changes in plasma triiodothyronine and growth hormone levels. Comparative Biochemistry and Physiology. Comparative Physiology 103 131–136.
Decuypere E, Dewil E & Kühn ER 1990 The hatching process and the role of hormones. In Avian Incubation, pp 239–256. Eds Tullett SC. London, UK: Butterworth & Co.
Dupré SM, Guissouma H, Flamant F, Seugnet I, Scanlan TS, Baxter JD, Samarut J, Demeneix BA & Becker N 2004 Both thyroid hormone receptor (TR)beta 1 and TR beta 2 isoforms contribute to the regulation of hypothalamic thyrotropin-releasing hormone. Endocrinology 145 2337–2345.
Forrest D, Sjöberg M & Vennström B 1990 Contrasting developmental and tissue-specific expression of alpha and beta thyroid hormone receptor genes. EMBO Journal 9 1519–1528.
Forrest D, Hallböök F, Persson H & Vennström B 1991 Distinct functions for thyroid hormone receptors alpha and beta in brain development indicated by differential expression of receptor genes. EMBO Journal 10 269–275.
Di Fulvio M, Coleoni AH, Pellizas CG & Masini-Repiso AM 2000 Tri-iodothyronine induces proliferation in cultured bovine thyroid cells: evidence for the involvement of epidermal growth factor-associated tyrosine kinase activity. Journal of Endocrinology 166 173–182.
Gauthier K, Chassende O, Plateroti M, Roux JP, Legrand C, Pain B, Rousset B, Weiss R, Trouillas J & Samarut J 1999 Different functions for the thyroid hormone receptors TRalpha and TRbeta in the control of thyroid hormone production and post-natal development. EMBO Journal 18 623–631.
Geris KL, Laheye A, Berghman LR, Kühn ER & Darras VM 1999 Adrenal inhibition of corticotropin-releasing hormone-induced thyrotropin release: a comparative study in pre- and posthatch chicks. Journal of Experimental Zoology 284 776–782.
Geris KL, De Groef B, Rohrer SP, Geelissen S, Kühn ER & Darras VM 2003 Identification of somatostatin receptors controlling growth hormone and thyrotropin secretion in the chicken using receptor subtype-specific agonists. Journal of Endocrinology 177 279–286.
Van der Geyten S, Segers I, Gereben B, Bartha T, Rudas P, Larsen PR, Kühn ER & Darras VM 2001 Transcriptional regulation of iodothyronine deiodinases during embryonic development. Molecular and Cellular Endocrinology 183 1–9.
Gregory CC, Dean CE & Porter TE 1998 Expression of chicken thyroid-stimulating hormone beta-subunit messenger ribonucleic acid during embryonic and neonatal development. Endocrinology 139 474–478.
De Groef B, Geris KL, Manzano J, Bernal J, Millar RP, Abou-Samra AB, Porter TE, Iwasawa A, Kühn ER & Darras VM 2003 Involvement of thyrotropin-releasing hormone receptor, somatostatin receptor subtype 2 and corticotropin-releasing hormone receptor type 1 in the control of chicken thyrotropin secretion. Molecular and Cellular Endocrinology 203 33–39.
De Groef B, Grommen SV & Darras VM 2006 Increasing plasma thyroxine levels during late embryogenesis and hatching in the chicken are not caused by an increased sensitivity of the thyrotropes to hypothalamic stimulation. Journal of Endocrinology 189 271–278.
De Groef B, Grommen SV & Darras VM 2007 Feedback control of thyrotropin secretion in the chicken: thyroid hormones increase the expression of hypophyseal somatostatin receptor types 2 and 5. General and Comparative Endocrinology 152 178–182.
Grommen SVH, De Groef F, Kühn ER & Darras VM 2005 The use of real-time PCR to study the expression of thyroid hormone receptor beta 2 in the developing chicken. Annals of the New York Academy of Sciences 1040 328–331.
Guissouma H, Ghorbel MT, Seugnet I, Ouatas T & Demeneix BA 1998 Physiological regulation of hypothalamic TRH transcription in vivo is T3 receptor isoform specific. FASEB Journal 12 1755–1764.
Hodin RA, Lazar MA, Wintman BI, Darling DS, Koenig RJ, Larsen PR, Moore DD & Chin WW 1989 Identification of a thyroid hormone receptor that is pituitary-specific. Science 244 76–79.
Iwasaki T, Koibuchi N & Chin WW 2005 Synovial sarcoma translocation (SYT) encodes a nuclear receptor coactivator. Endocrinology 146 3892–3899.
Jones KE, Yaffe BM & Chin WW 1993 Regulation of thyroid hormone receptor beta-2 mRNA levels by retinoic acid. Molecular and Cellular Endocrinology 91 113–118.
Kakucska I, Rand W & Lechan RM 1992 Thyrotropin-releasing hormone gene expression in the hypothalamic paraventricular nucleus is dependent upon feedback regulation by both triiodothyronine and thyroxine. Endocrinology 130 2845–2850.
Kawasaki D, Aotsuka T, Higashinakagawa T & Ishii S 2003 Cloning of the gene for the thyrotropin beta subunit in the Japanese crested ibis, Nipponia nippon. Zoological Science 20 203–210.
Koller KJ, Wolff RS, Warden MK & Zoeller RT 1987 Thyroid hormones regulate levels of thyrotropin-releasing hormone mRNA in paraventricular nucleus. PNAS 84 7329–7333.
Langlois MF, Zanger K, Monden T, Safer JD, Hollenberg AN & Wondisford FE 1997 A unique role of the β-2 thyroid hormone receptor isoform in negative regulation by thyroid hormone. Mapping of a novel amino-terminal domain important for ligand-independent activation. Journal of Biological Chemistry 272 24927–249233.
Lechan RM, Qi Y, Davis KD, Schwartz HL, Strait KA, Oppenheimer JH & Lazar MA 1993 Immunocytochemical delineation of thyroid hormone receptor beta 2-like immunoreactivity in the rat central nervous system. Endocrinology 132 2461–2469.
Lezoualc'h F, Hassan AH, Giraud P, Loeffler JP, Lee SL & Demeneix BA 1992 Assignment of the beta-thyroid hormone receptor to 3,5,3′-triiodothyronine-dependent inhibition of transcription from the thyrotropin-releasing hormone promoter in chick hypothalamic neurons. Molecular Endocrinology 6 1797–1804.
Li M & Boyages SC 1997 Expression of β2-thyroid hormone receptor in euthyroid and hypothyroid rat pituitary gland: an in situ hybridisation and immunocytochemical study. Brain Research 773 125–131.
Martinez de Arrieta C, Koibuchi N & Chin WW 2000 Coactivator and corepressor gene expression in rat cerebellum during postnatal development and the effect of altered thyroid status. Endocrinology 141 1693–1698.
Muchow M, Bossis I & Porter TE 2005 Ontogeny of pituitary thyrotrophs and regulation by endogenous thyroid hormone feedback in the chick embryo. Journal of Endocrinology 184 407–416.
Nakano K, Matsushita A, Sasaki S, Misawa H, Nishiyama K, Kashiwabara Y & Nakamura H 2004 Thyroid-hormone-dependent negative regulation of thyrotropin beta gene by thyroid hormone receptors: study with a new experimental system using CV1 cells. Biochemical Journal 378 549–557.
Sap J, Munoz A, Damm K, Goldberg Y, Ghysdael J, Leutz A, Beug H & Vennström B 1986 The c-erb-A protein is a high-affinity receptor for thyroid hormone. Nature 324 635–640.
Schmidt MV, Oitzl M, Steenbergen P, Lachize S, Wurst W, Müller MB, de Kloet ER & Meijer OC 2007 Ontogeny of steroid receptor coactivators in the hippocampus and their role in regulating postnatal HPA axis function. Brain Research 1174 1–6.
Segerson TP, Kauer J, Wolfe HC, Mobtaker H, Wu P, Jackson IM & Lechan RM 1987 Thyroid hormone regulates TRH biosynthesis in the paraventricular nucleus of the rat hypothalamus. Science 238 78–80.
Sjöberg M, Vennström B & Forrest D 1992 Thyroid hormone receptors in chick retinal development: differential expression of mRNAs for alpha and N-terminal variant beta receptors. Development 114 39–47.
Spitzweg C, Joba W, Morris JC & Heufelder AE 1999 Regulation of sodium iodide symporter gene expression in FRTL-5 rat thyroid cells. Thyroid 9 821–830.
Weiss RE, Forrest D, Pohlenz J, Cua K, Curran T & Refetoff S 1997 Thyrotropin regulation by thyroid hormone in thyroid hormone receptor beta-deficient mice. Endocrinology 138 3624–3629.
Yamada M, Rogers D & Wilber JF 1989 Exogenous triiodothyronine lowers thyrotropin-releasing hormone concentrations in the specific hypothalamic nucleus (paraventricular) involved in thyrotropin regulation and also in posterior nucleus. Neuroendocrinology 50 560–563.
Yu S, Friedman Y, Richman R & Burke G 1976 Altered thyroidal responsivity to thyrotropin induced by circulating thyroid hormones. A ‘short-loop’ regulatory mechanism? Journal of Clinical Investigation 57 745–755.
