Abstract
Apoptosis plays a critical role in the diabetic cardiomyopathy, and endoplasmic reticulum stress (ERS) is one of the intrinsic apoptosis pathways. Previous studies have shown that the endoplasmic reticulum becomes swollen and dilated in diabetic myocardium, and ERS is involved in heart failure and diabetic kidney. This study is aimed to demonstrate whether ERS is induced in myocardium of streptozotocin (STZ)-induced diabetic rats. We established a type 1 diabetic rat model, used echocardiographic evaluation, hematoxylin–eosin staining, and the terminal deoxynucleotidyl transferase-mediated DNA nick-end labeling staining to identify the existence of diabetic cardiomyopathy and enhanced apoptosis in the diabetic heart. We performed immunohistochemistry, western blot, and real-time PCR to analyze the hallmarks of ERS that include glucose-regulated protein 78, CCAAT/enhancer-binding protein homologous protein (CHOP) and caspase12. We found these hallmarks to have enhanced expression in protein and mRNA levels in diabetic myocardium. Also, another pathway that can lead to cell death of ERS, c-Jun NH2-terminal kinase-dependent pathway, was also activated in diabetic heart. Those results suggested that ERS was induced in STZ-induced diabetic rats' myocardium, and ERS-associated apoptosis occurred in the pathophysiology of diabetic cardiomyopathy.
Introduction
In humans and animal models of diabetes, a heart muscle-specific disease in the absence of any vascular pathology has been described, and termed diabetic cardiomyopathy (Picano 2003, Avogaro et al. 2004). The pathogenesis of diabetic cardiomyopathy is a chronic and complex process that is attributed to abnormal cellular metabolism and defects in organelles such as myofibrils, mitochondria, and sarcolemma (Feuvray 2004, Tappia et al. 2004, Dyntar et al. 2006, Ligeti et al. 2006, Pereira et al. 2006). However, the mechanisms of diabetic cardiomyopathy are not fully known, and appropriate approaches to minimize these risks are still being explored.
Apoptosis, as a regulated, energy-dependent, cell suicide mechanism has been reported to play a critical role in the development of diabetic cardiomyopathy (Cai & Kang 2003, Dyntar et al. 2006, Ghosh & Rodrigues 2006). Endoplasmic reticulum (ER) is an organelle involved in the intrinsic pathway of apoptosis (Ferri & Kroemer 2001) and it is involved in several important functions such as the folding of secretory and membrane proteins. Various conditions can disturb the functions of the ER and result in ER stress (ERS). These conditions include ER-Ca2+ depletion, ischemia, hypoxia, exposure to free radicals, elevated protein synthesis, hyperhomocysteine, and gene mutation. Several signaling pathways are initiated to cope with ERS, which are designated as the unfolded protein response (UPR; Bernales et al. 2006). One major pathway of UPR is to increase regulation of the expression of ER-localized molecular chaperons, such as glucose-regulated protein 78 (GRP78), which can contribute to repairing unfolded proteins. The early UPR enhances cell survival by ensuring that the adverse effects of ERS are dealt with in a timely and efficient manner. When ERS conditions persist, initiation of apoptotic processes are promoted by transcriptional induction of CCAAT/enhancer-binding protein (C/EBP) homologous protein (CHOP/GADD153; Wang et al. 1996), the caspase12-dependent pathway (Hetz et al. 2003), and activation of the c-Jun NH2-terminal kinase (JNK)-dependent pathway (Hotamisligil 2005).
Evidence has demonstrated that apoptosis initiated by the ERS was involved in the pathogenesis of heart failure and diabetic kidney (Okada et al. 2004, Hayden et al. 2005, Nakatani et al. 2005). The ERS has been found in cultured hepatocytes, monocytes, and smooth muscle cells with both glucose and glucosamine independent of increased O-linked glycosylation (Werstuck et al. 2006). Actually, hyperglycemia environment also induces several conditions that can invoke ERS. It was reported that the ER Ca2+ store and rates of Ca2+ release and resequestration into ER were found depressed in diabetic rat myocytes because hyperglycemia inhibits the capacitative calcium entry, and there are direct correlations existing between hyperglycemia and oxidative stress and hyperglycemia and hyperhomocysteine (Choi et al. 2002, Pang et al. 2002, King & Loeken 2004, Wijekoon et al. 2007).
Ultrastructural analysis found ER swelling and dilation in the diabetic model myocardium (Jackson et al. 1985, Bhimji et al. 1986). Dilated ER is a change in morphology that suggests ERS (Riggs et al. 2005, Borradaile et al. 2006, Tiwari et al. 2006), but the relationship between ERS and diabetic cardiomyopathy is unknown.
Materials and Methods
Animals
Thirty male Wistar rats from animal center of Shandong University (8 weeks of age; mean body weight 280±10 g) were used. The rats were housed by cage and had free access to normal rat diet and tap water of the center. They were maintained under conditions of standard lighting (alternating 12 h light:12 h darkness cycle), temperature (22±0.5 °C), and humidity (60±10%) for at least 1 week before the experiments. All experiments were carried out in accordance with the recommendations of the Universities Federation for Animal Welfare (UFAW) Handbook on the Care and Management of Laboratory Animals. Of the 30 Wistar rats, 20 were given a single i.p. dose (65 mg/kg) of streptozotocin (STZ; S0130 Sigma–Aldrich; dissolved in citrate buffer (pH 4.5)), while the remaining 10 rats were given a same dosage of citrate buffer (pH 4.5). Diabetes was confirmed by measuring the venous circulating plasma concentrations of glucose. Seven days post-STZ injection, blood samples were obtained from the rat tail vein after 12 h of fasting, and the glucose concentration was determined with an automatic analyzer (One Touch SureStep Meter, LifeScan, CA, USA). Nineteen rats reached the diabetic rat standard of a fasting blood glucose level higher than 300 mg/dl, while the value in the control group of rats injected with saline ranged from 90 to 130 mg/dl. Due to infection, an STZ-diabetic rat died after 2 weeks and another STZ-diabetic rat died after 10 weeks. Sixteen weeks post-saline and STZ injection, 17 STZ-diabetic rats were left, while the control group survived.
Echocardiographic evaluation
During the 16 weeks of study, before killing, each rat was anesthetized with ketamine HCl (50 mg/kg) and xylazine (10 mg/kg) that was placed in the left lateral decubitus position. The chest of the rat was shaved and a layer of acoustic coupling gel was applied to the thorax, two-dimensional and M-mode echocardiography was performed using a commercially available 12-MHz linear array transducer system and echocardiogram machine (Sonos 5500, HP, Boston, MA, USA). The M-mode recordings obtained were of the left ventricle at the level of the mitral valve in the parasternal view using two-dimensional echocardiographic guidance in both the short- and long-axis views. Pulsed wave Doppler was used to examine mitral diastolic inflow from the apical four-chamber view. For each measurement, data from three consecutive cardiac cycles were averaged. All measurements were made from digital images captured at the time of the study by use of inherent analysis software (Sonos 5500 software package). The results are presented in Table 1.
The sequence for each primer and product length
| Sequence | Length (bps) | |
|---|---|---|
| GRP78 | F: 5′ TCAGCCCACCGTAACAAT 3′ | 275 |
| R: 5′ CAAACTTCTCGGCGTCAT 3′ | ||
| Caspase12 | F: 5′ GGAAGGTAGGCAAGAGT 3′ | 179 |
| R: 5′ GTAGAAGTAGCGTGTCATA 3′ | ||
| CHOP | F: 5′ AGCTGAGTCTCTGCCTTTCG 3′ | 456 |
| R: 5′ TGTGGTCTC TACCTCCCTGG 3′ | ||
| GAPDH | F: 5′ GTCGGTGTCAACGGATTTG 3′ | 397 |
| R: 5′ ACAAACATGGGGGCA TCAG 3′ |
The primers' sequence and product length designed for GRP78, caspase12, CHOP and GAPDH.
Histopathology, TUNEL, and immunohistochemistry (IHC) staining
After 2 days of echocardiographic evaluation, the rats were anesthetized again, their hearts removed and sliced transversely, and eight diabetic and five control hearts were fixed in 4% neutral buffered formalin, and then paraffin-embedded for light microscopic evaluation. Eight diabetic and five control hearts were frozen at −80 °C for the use of western blot and real-time PCR. The experimental procedures adhered to the guidelines of Shandong University's Code for the Care and Use of Animals for Scientific Purposes. All studies were performed with an observer overlooking the study groups to which the animals had been assigned. Hearts embedded in paraffin were sectioned at 5 μm and studied with hematoxylin–eosin stain, a terminal deoxynucleotidyl transferase (TDT)-mediated DNA nick-end labeling (TUNEL) assay kit, and IHC. The sections were examined using light microscopy and analyzed with a computer-assisted color image analysis system (Image-ProPlus 5.1, Media Cybernetics, Silver Spring, MD, USA).
Assessment for apoptosis was conducted using a commercially available TUNEL assay kit (code number KGA 703, Keygen Biotechnology, Nanjing, China). Briefly, sections were deparaffinized, digested with proteinase K (20 μg/ml), at room temperature for 15 min, and soaked in PBS for 5 min. Each section was covered with a TDT enzyme solution containing 45 μl equilibration buffer, 1 μl biotin-11-dUTP, 4 μl TDT enzyme, and incubated for 1 h at 37 °C in a humidified chamber. The sections were immersed in stop buffer to terminate the enzymatic reaction, and then gently rinsed with PBS. A 50 μl streptavidin–horseradish peroxidase (HRP) solution containing 0.25 μl streptavidin–HRP and 49.75 μl PBS was then applied to each section, and then incubated at room temperature for 30 min in the darkness. Slides were washed in PBS and exposed to 3,3-diaminobenzidine (DAB)+chromogen (code number ZLI-9032, Zhongshan Golden Bridge Biotechnology, Beijing, China) for 5–7 min. The slides were then rinsed in water and counterstained with hematoxylin. Then the sections were examined using light microscopy. Sections incubated with PBS, instead of TDT enzyme solution, served as the negative controls.
The tissue expression of GRP78 was assessed immunohistochemically using antibody (code number sc1611, Santa Cruz Biotechnology, Santa Cruz, CA, USA). After deparaffinization, endogenous peroxidase activity was quenched with 30% methanol and 0.3% hydrogen PBS. The slides were then boiled in citrate buffer with microwaves. After blocking nonspecific binding with 5% BSA, the slides were incubated with primary antibodies overnight at 4 °C (dilutions for anti-GRP78 1:400). The following day, the sections were thoroughly washed in PBS and incubated with a peroxidase-conjugated polymer that carries antibodies to goat (1:200) immunoglobulin (code number ZB-2306, Zhongshan Golden Bridge Biotechnology) for 30 min. After rinsing with PBS, the sections were exposed to DAB+chromogen for 7 min. The slides were rinsed in water and counterstained with hematoxylin. The immunohistochemical staining of the samples was performed at different times but by the same technical personnel. The sections incubated with PBS, instead of the primary antiserum, served as the negative controls.
Western blot
Protein from the heart of the diabetic and normal rat was extracted for western blot use. The tissue samples were homogenized in a lysis buffer (0.1 mol/l NaCl, 0.01 M Tris–HCl (pH 7.5), 1 mM EDTA, and 1 μg/ml Aprotinin) and then the homogenates were centrifuged at 7000 g for 15 min at 4 °C. The supernatants were used as protein samples. We used a Bradford assay (Bio-Rad Laboratories) to determine each sample's protein concentration, then performed western blot analysis with a 5% acrylamide stacking gel and a 14% acrylamide resolving gel, and 60 μg protein was subjected to gel electrophoresis. Proteins from the gel to nitrocellulose membranes (code number LC2006, Invitrogen) was performed for 50 min at 120 V. Nonspecific protein binding to the nitrocellulose membrane was reduced by pre-incubating the membrane with blocking buffer (5% nonfat dry milk, 2.7 mM KCl, 137 mM NaCl, 8 mM NaHPO4, 1.4 mM KPO4, and 0.1% Tween 20) for 2 h at room temperature. Then incubation with the monoclonal antibody anti-β actin (1:1000 diluted in blocking buffer, Zhongshan Golden Bridge Biotechnology), anti-GRP78 (1:500), anti-CHOP (1:500, SC-7531, Santa Cruz Biotechnology), anti-caspase12, (1:1000, SC-1050, Santa Cruz Biotechnology), and anti-JNK1 (1:2000, SC-474, Santa Cruz Biotechnology) were performed overnight at 4 °C. Then incubation with secondary antibody (anti-rabbit, anti-rat, and anti-goat IgG conjugated to HRP, in blocking buffer 1:1000, Zhongshan Golden Bridge Biotechnology) lasted 1 h, also at room temperature. The reaction was visualized by chemiluminescence (Enhanced Chemiluminescent Kit, ECL, Amersham). The film was scanned with an imaging densitometer (fluorchem HD IS-9900, Alpha, CA, USA), and the optical density was quantified using Multi-Analyst software.
RNA expression analysis
Total RNA was extracted from normal and diabetic rat hearts by the single-step acid–guanidium–phenol–chloroform method (21) using Trizol reagent (code number 15596-026, Invitrogen) according to the manufacturer's instructions. The RNA was quantified by u.v. spectrophotometry at 260/280 nm and diluted to 1 μg/μl in diethyl pyrocarbonate (DEPC)-treated water. The RNA samples were analyzed by formaldehyde–agarose gel electrophoresis, and integrity was confirmed by visualization of 18S and 28S rRNA bands. First-strand cDNA was synthesized in a 40 μl total volume by using oligo (dT) 12–18 primer and Moloney murine leukemia virus (MMLV) reverse transcriptase (code number m1701, Promega). To reduce pipetting variation, a master RT mixture was prepared and added to each of the different RNA samples. Briefly, reverse transcription was performed in a 40 μl volume mixture made up of 6 μl total RNA, 2 μl Olig (dT), 8 μl reverse-transcription buffer, 2 μl 2.5 mM dNTP mixture, 2 μl MMLV reverse transcriptase, and 20 μl DEPC-treated water. The condition was incubated at 37 °C for 1 h and then heated at 95 °C for 5 min. The cDNA was stored at −20 °C for use. The sequence for each primer and product are presented in Table 1.
Real-time PCR was carried out using the real-time detection system (ABI Prism 7000, Foster City, CA, USA) with a real-time PCR master mix (code number: QPK-201, Toyobo, Japan) that contains SYBR-Green I as fluorescent dye enabling real-time detection of PCR products. The protocol was followed according to the manufacturer's instructions. A 50 μl volume mixture was made up of 1 μl sense primer (10 μM), 1 μl antisense primer (10 μM), 25 μl real-time PCR master mix, 18 μl (DEPC)-treated water, and 5 μl cDNA. The cycling conditions were 95 °C for 3 min, followed by 40 cycles at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 60 s. For quantification, the mRNA of GRP78, CHOP, and caspase12 gene was normalized to the mRNA of the internal standard gene glyceraldehyde-3-phosphate dehydrogenase.
Statistical analysis
All the results are expressed as mean±s.d. The individual groups were tested for differences by using one-way ANOVA repeated measurements, followed by independent samples t-test. Differences were considered as being statistically significant at #P<0.05.
Results
Establishment of the diabetic cardiomyopathy model
The body weight and blood glucose levels are shown in Fig. 1A and B. The left ventricular systolic function parameters, fractional shortening (%), and ejection fraction of the diabetic animals were significantly reduced when compared with their week 1 levels and normal animals at 16 weeks (Table 2). Left ventricular diastolic function variables expressed by the E-wave (early diastolic filling and early peak velocity) and A-wave (late atrial filling and atrial peak velocity) differed significantly in diabetic animals when compared with their week 1 levels and normal animals at 16 weeks. A significant decrease in the E-wave velocity, significant increase in the A-wave velocity, and a significant decrease in the E/A ratio was found, after 16 weeks in the diabetic groups, with a significant decrease in the fractional shortening and ejection fraction. The altered cardiac diastolic performance is thought to result from a reduced cardiac compliance. With hematoxylin–eosin staining (Fig. 2), we found that diabetic cardiac muscle fibers were disordered, and many of them were collapsed. Diabetic myocardium showed fibrosis and extensive focal coalescent areas of ischemic myocyte degeneration in the subendocardial, subepicardial region, and papillary muscles of the myocardium. The above results certified that our diabetic rats suffered from diabetic cardiomyopathy.
(A) Body weight significantly decreased in diabetic rats whereas it significantly increased in normal rats at 16 weeks when compared with their week 1 levels. (B) Blood glucose levels in the diabetic animals have shown a significant raise at 1 week after diabetes induction, and continued to 16 weeks compared with the normal rats. *P<0.05 versus normal rats.
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0230
(A) The normal and (B) diabetic myocardium were stained with hematoxylin–eosin. Diabetic cardiac muscle fibers were disordered and many of them had collapsed. Diabetic myocardium showed fibrosis and extensive focal coalescent areas of ischemic myocyte degeneration in the subendocardial, subepicardial region, and papillary muscles of the myocardium. Bar=50 μm.
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0230
Transmitral Doppler flow velocity recordings in normal (n=10) and diabetic (n=17) rats at weeks 1 and 16. Results shown are mean±s.d.
| Week 1 | Week 16 | |||
|---|---|---|---|---|
| Normal | Diabetic | Normal | Diabetic | |
| E | 53.25±5.57 | 52.24±5.62 | 55.34±5.67 | 30.45±7.56*,† |
| A | 27.34±6.57 | 31.09±5.65 | 28.45±6.67 | 53.45±6.87*,† |
| E/A | 2.11±0.31 | 1.76±0.13 | 2.05±0.45 | 0.61±0.06*,† |
| Eat | 28.15±6.45 | 27.89±5.89 | 27.45±6.34 | 16.95±5.45*,† |
| Edt | 48.34±6.59 | 47.23±7.12 | 48.98±7.01 | 52.48±7.14 |
| EF | 61.34±7.76 | 61.57±4.42 | 60.56±5.10 | 38.05±7.76*,† |
| FS | 27.39±3.19 | 27.18±4.67 | 28.16±4.08 | 16.31±5.27*,† |
| LVSD (mm) | 1.01±0.39 | 1.03±0.42 | 1.12±0.43 | 1.73±0.54*,† |
| LVDD (mm) | 4.92±0.43 | 4.98±0.4 | 5.42±0.51 | 6.42±0.67*,† |
E, peak early transmitral filling velocity during early diastole; A, peak transmitral atrial filling velocity during late diastole; Eat, acceleration time of E-wave; Edt, deceleration time of E-wave; EF, ejection fraction; FS, fractional shortening; LVSD, ventricular systolic dysfunction; LVDD, left ventricular diastolic diameter. *P<0.05 compared to week 1 data. †P<0.05 compared to normal rats.
Localization of apoptosis by TUNEL assay and IHC analysis of GRP78 distribution
To assess whether diabetes results in apoptotic cell death in the diabetic myocardium, the tissue sections were labeled with an in situ TUNEL assay. Apoptosis was observed in both the cardiomyocyte and endothelium of the diabetic heart (Fig. 3A). Estimation of cardiac apoptosis revealed a nearly sevenfold increase in TUNEL-positive nuclei in diabetic hearts (Fig. 3C). As can be seen in Fig. 3B, immunochemistry studies showed that GRP78 was abundantly expressed in the myocardium from diabetic rats. In contrast, normal rats exhibited modest or weak immunoreactivity for this molecule. We also found that in diabetic myocardium, the increase of GRP78 positive cells paralleled with the increase of apoptotic cells (Fig. 3C).
TUNEL staining of apoptotic bodies (pointed by arrows) and IHC staining of GRP78 in (A and C) normal and (B and D) diabetic rat myocardium. When compared with the normal heart, the diabetic heart has significantly (E) higher positive expression. *P<0.05 versus normal rat. Bar=50 μm.
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0230
Western blot analysis of GRP78, CHOP, caspase12 and JNK1
In western blots (Fig. 4), we detected GRP78, CHOP, and JNK1 proteins in rat myocardium as single bands migrating at 78, 30, and 46 kDa respectively, and two bands between 30 and 50 kDa for caspase12. The densitometric analysis of bands for GRP78, CHOP, caspase12, and JNK1 revealed a significant (P<0.05) increase in relative protein content in myocardium from diabetic rats in comparison with those from normal rats. This means CHOP was induced, and caspase12 and JNK pathway were activated in the diabetic heart.
Immunoblot analysis for (A) GRP78, (B) CHOP, (C) caspase12, and (D) JNK1 in the myocardium of diabetic and normal rats. The upper trace of each panel shows representative blots of the respective protein in normal (left hand) and diabetic (right hand) hearts. The lower panels show the bar graphs summarizing the immunoblot data. Densitometric results are expressed as a fold induction of each band obtained in normal rats. Data are shown as mean±s.d. *P<0.05 versus normal rat.
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0230
RT-PCR analysis of GRP78, CHOP, and caspase12 expression
Changes in RNA expression of GRP78, CHOP, and caspase12 were quantified by RT-PCR in control and diabetic rat hearts (Fig. 5). Expressions of GRP78, CHOP, and caspase12 were significantly increased in the diabetic heart (P<0.05), paralleled with their enhanced protein expression.
Total RNA was extracted from myocardium and subjected to real-time PCR quantification as described under Materials and Methods. Values represent the ratio to GAPDH mRNA that is arbitrarily defined as 1. Data are shown as mean±s.d. *P<0.05 versus normal rat.
Citation: Journal of Endocrinology 196, 3; 10.1677/JOE-07-0230
Discussion
Diabetic cardiomyopathy is characterized by both systolic and diastolic dysfunction (Galderisi 2006). In this current study, we established type 1 diabetic rat model and used both echocardiographic evaluation and histological changes with hematoxylin–eosin staining to identify the existence of diabetic cardiomyopathy in them. The result of TUNEL staining of the myocardium suggested that more cardiomyocytes and endothelial cells were apoptotic in the diabetic hearts than in normal hearts. We demonstrated that GRP78 has enhanced expression that paralleled with increased apoptotic cells. Also, three hallmarks of ERS-induced apoptosis CHOP, caspase12, and JNK1 were found to have increased in protein and mRNA levels. These findings suggest that ERS was induced in our experimental paradigm, and ERS-associated apoptosis pathway was activated. To our knowledge, this is the first study that implicates that ERS plays a role in the pathophysiology of diabetic cardiomyopathy.
As a comprehensive consequence of abnormal cellular metabolism and gene expression in response to hyperglycemia, cell death has been considered to be the important cause of diabetic cardiomyopathy. Because myocytes rarely proliferate in adult cardiac muscles, the loss of cardiomyocytes would eventually lead to compromised cardiac function. In the same way, loss of endothelial cells will lead to vascular dysfunction and aggravate the ischemia of the heart. Apoptotic cardiomyocytes and endothelial cells have been observed in the heart of patient with diabetes and in STZ-induced diabetic rat (Cai & Kang 2003, Adeghate 2004), and exposing to high glucose also induced the same two types of cells to death in vitro (Detaille et al. 2005, Malhotra et al. 2005). A recent study showed that high glucose could increase apoptosis of cultured lens epithelial cells through ERS pathway. In diabetic heart, ER was found to be dilated and swollen by ultrastructural analysis, suggesting that the ER was in disorder in hyperglycemia environment (Jackson et al. 1985, Bhimji et al. 1986, Mulhern et al. 2006). Indeed, besides hyperglycemia, the diabetic heart experiences many other conditions that can invoke ERS, such as depressed ER Ca2+ store, increased oxidative stress, hypoxia, hyperhomocysteine, lipid deposition, and increased synthesis of secretory proteins (Ganguly 1991, Siebenhofer et al. 2003). Studies showed that UPR was induced in cardiomyocytes in hypoxic conditions, and pressure overload by transverse aortic constriction also induced UPR associated with cardiomyocyte apoptosis (Okada et al. 2004). Moreover, cytokines (Cardozo et al. 2005) and norepinephrine (Mao et al. 2006), both of which play roles in the pathophysiology of diabetic cardiomyopathy, also induce UPR, suggesting that cardiomyocytes may be sensitive to ERS. All of the above results prompted us to examine whether ERS-specific apoptotic signaling is involved in diabetic rat heart.
The GRP78, also referred to as immunoglobulin heavy chain binding protein (BiP), is a central regulator of ER function due to its roles: protein folding and assembly, targeting misfolded protein for degradation, ER Ca2+ binding, and controlling the activation of transmembrane ERS sensors. Induction of GRP78 has been widely used as a marker for ERS and the onset of UPR (Schröder & Kaufman 2005).Furthermore, GRP78 serves as a master modulator for the UPR network by binding to the ERS sensors such as protein kinase R (PKR)-like ER kinase, inositol requiring 1 (IRE1), and activating transcription factor 6 (ATF6) and inhibiting their activation (Schröder & Kaufman 2005).
Of the apoptotic pathways, three are known to be related to ERS. The first is transcriptional induction of the gene for CHOP; CHOP protein belongs to the C/EBP family of transcription factors. It is commonly accepted that CHOP/GADD153 expression is under the control of ATF6 and IRE1 signalings (Wang et al. 1998, Yoshida et al. 2000). Overexpression of CHOP promotes apoptosis, and deficiency of CHOP can protect cells from ERS-induced apoptosis (Zinszner et al. 1998, Oyadomari et al. 2002), suggesting that CHOP is involved in the process of cell death caused by ERS, and overexpression of CHOP sensitized the cells to ERS via down-regulation of proto-onco gene Bcl-2 expression. The second is the activation of caspase12. The ERS leads to increase in cytosolic calcium levels that induce the activation of m-calpain. Activated m-calpain cleaves Bcl-XL and proteolytically activates caspase12. Processed-caspase12 reportedly activates caspase9, followed by activation of caspase3 (Rao et al. 2002). Nakagawa et al. (2000) demonstrated that caspase12-mediated apoptosis was a specific apoptotic pathway of ER, and apoptosis that occurred as a result of membrane- or mitochondrial-targeted signals did not activate it. The caspase12 knockout mice exhibit resistance to ERS, suggesting that caspase12 also plays a role in the process of cell death caused by ERS. The third is activation of the JNK pathway (Urano et al. 2000) that is mediated by formation of the IRE1-tumor necrosis factor receptor-associated factor 2-apoptosis signal-regulating kinase 1 complex. Activation of JNK is a common response to many forms of stress and is known to influence the cell-death machinery through the regulation of BCL2 family proteins (Davis 2000). Phosphorylation of BCL2 by JNK, which occurs primarily at the ER, suppresses the anti-apoptotic activity of BCL2. Of the three components of the ER-related death pathways, induction of CHOP and activation of caspase12 are ER-specific pathways. Therefore, we used these two pathways as markers of induction of the ER-specific death pathway, and also examined the JNK pathway. In the present study, the increased induction of GRP78, CHOP, cleavage of caspase12, and JNK in diabetic rat myocardium paralleled with the increased apoptotic cells. These findings indicate that a hyperglycemia environment induce ER-dependent death pathway activity, leading to apoptosis.
To our knowledge, in normal heart, synthesis of secretory proteins is not a major function of a cardiac myocyte, but with the development of cardiomyopathy in diabetes, the heart could become a neuroendocrine organ attributed to prolonged elevation of protein synthesis such as atrial natriuretic peptide and brain natriuretic peptide (Howarth et al. 2006, Obineche et al. 2006) and together with other strong inducers we suggested in the introduction that the ERS may participate in the beginning of diabetic cardiomyopathy. Compared with other mechanisms, involved in the diabetic myocardial cell, ERS may have crosstalk with them; this means that ERS is not only parallel with them but also as a result and mediator for other ways to apoptosis. For example, increased ROS derived from hyperglycemia has been considered the most important reason for cell death, because it can cause abnormal gene expression, altered signal transduction, and it is also involved in the activation of the UPR on exposure to oxidative stress, which is an adaptive mechanism to preserve cell function and survival, but persistent oxidative stress and protein misfolding initiate apoptotic cascades which then lead to cell death.
In summary, this study provides the first evidence of GRP78 increase, and that the three pathways of ERS-induced apoptosis are activated in the diabetic heart. Our findings suggest that ER-initiated apoptosis may contribute to diabetic cardiomyopathy, and further investigation about the intracellular signaling and the weight of ERS-induced apoptosis in diabetic cardiomyopathy will be required.
Acknowledgements
The authors would like to thank Mr Jin-Bo Feng, Mrs Hong Jiang, Miss Xu-Ping Wang, and Mrs Chun-Xi Liu for the technical work in this research, and Matthew Coutsos and Preetinder Singh Bhullar for help in the revision. This work was supported by a grant from the National Basic Research Program of China (973 Program) 2007 CB512003. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.
References
Adeghate E 2004 Molecular and cellular basis of the aetiology and management of diabetic cardiomyopathy: a short review. Molecular and Cellular Biochemistry 261 187–191.
Avogaro A, Vigili de Kreutzenberg S, Negut C, Tiengo A & Scognamiglio R 2004 Diabetic cardiomyopathy: a metabolic perspective. American Journal of Cardiology 93 13A–16A.
Bernales S, Papa FR & Walter P 2006 Intracellular signaling by the unfolded protein response. Annual Review of Cell and Developmental Biology 22 487–508.
Bhimji S, Godin DV & McNeill JH 1986 Myocardial ultrastructural changes in alloxan-induced diabetes in rabbits. Acta Anatomica 125 195–200.
Borradaile NM, Han X, Harp JD, Gale SE, Ory DS & Schaffer JE 2006 Disruption of endoplasmic reticulum structure and integrity in lipotoxic cell death. Journal of Lipid Research 47 2726–2737.
Cai L & Kang YJ 2003 Cell death and diabetic cardiomyopathy. Cardiovascular Toxicology 3 219–228.
Cardozo AK, Ortis F, Storling J, Feng YM, Rasschaert J, Tonnesen M, Van Eylen F, Mandrup-Poulsen T, Herchuelz A & Eizirik DL 2005 Cytokines downregulate the sarcoendoplasmic reticulum pump Ca2+ ATPase 2b and deplete endoplasmic reticulum Ca2+, leading to induction of endoplasmic reticulum stress in pancreatic beta-cells. Diabetes 54 452–461.
Choi KM, Zhong Y, Hoit BD, Grupp IL, Hahn H, Dilly KW, Guatimosim S, Lederer WJ & Matlib MA 2002 Defective intracellular Ca(2+) signaling contributes to cardiomyopathy in Type 1 diabetic rats. American Journal of Physiology, Heart and Circulatory Physiology 283 H1398–H1408.
Davis RJ 2000 Signal transduction by the JNK group of MAP kinases. Cell 103 239–252.
Detaille D, Guigas B, Chauvin C, Batandier C, Fontaine E, Wiernsperger N & Leverve X 2005 Metformin prevents high-glucose-induced endothelial cell death through a mitochondrial permeability transition-dependent process. Diabetes 54 2179–2187.
Dyntar D, Sergeev P, Klisic J, Ambuhl P, Schaub MC & Donath MY 2006 High glucose alters cardiomyocyte contacts and inhibits myofibrillar formation. Journal of Clinical Endocrinology and Metabolism 91 1961–1967.
Ferri KF & Kroemer G 2001 Organelle-specific initiation of cell death pathways. Nature Cell Biology 3 E255–E263.
Feuvray D 2004 Diabetic cardiomyopathy. Archives des Maladies du Coeur et des Vaisseaux 97 261–265.
Galderisi M 2006 Diastolic dysfunction and diabetic cardiomyopathy: evaluation by Doppler echocardiography. Journal of the American College of Cardiology 48 1548–1551.
Ganguly PK 1991 Role of atrial natriuretic peptide in congestive heart failure due to chronic diabetes. Canadian Journal of Cardiology 7 275–280.
Ghosh S & Rodrigues B 2006 Cardiac cell death in early diabetes and its modulation by dietary fatty acids. Biochimica et Biophysica Acta 1761 1148–1162.
Hayden MR, Tyagi SC, Kerklo MM & Nicolls MR 2005 Type 2 diabetes mellitus as a conformational disease. Journal of the Pancreas 6 287–302.
Hetz C, Russelakis-Carneiro M, Maundrell K, Castilla J & Soto C 2003 Caspase-12 and endoplasmic reticulum stress mediate neurotoxicity of pathological prion protein. EMBO Journal 22 5435–5445.
Hotamisligil GS Role of endoplasmic reticulum stress and c-Jun NH2-terminal kinase pathways in inflammation and origin of obesity and diabetes Diabetes 54 Suppl 2 2005 S73–S78.
Howarth FC, Al-Shamsi N, Al-Qaydi M, Al-Mazrouei M, Qureshi A, Chandranath SI, Kazzam E & Adem A 2006 Effects of brain natriuretic peptide on contraction and intracellular Ca2+ in ventricular myocytes from the streptozotocin-induced diabetic rat. Annals of the New York Academy of Sciences 1084 155–165.
Jackson CV, McGrath GM, Tahiliani AG, Vadlamudi RV & McNeill JH 1985 A functional and ultrastructural analysis of experimental diabetic rat myocardium. Manifestation of a cardiomyopathy. Diabetes 34 876–883.
King GL & Loeken MR 2004 Hyperglycemia-induced oxidative stress in diabetic complications. Histochemistry and Cell Biology 122 333–338.
Ligeti L, Szenczi O, Prestia CM, Szabo C, Horvath K, Marcsek ZL, van Stiphout RG, van Riel NA, Op den Buijs J & Van der Vusse GJ et al. 2006 Altered calcium handling is an early sign of streptozotocin-induced diabetic cardiomyopathy. International Journal of Molecular Medicine 17 1035–1043.
Malhotra A, Kang BP, Hashmi S & Meggs LG 2005 PKCepsilon inhibits the hyperglycemia-induced apoptosis signal in adult rat ventricular myocytes. Molecular and Cellular Biochemistry 268 169–173.
Mao W, Iwai C, Keng PC, Vulapalli R & Liang CS 2006 Norepinephrine-induced oxidative stress causes PC-12 cell apoptosis by both endoplasmic reticulum stress and mitochondrial intrinsic pathway: inhibition of phosphatidylinositol 3-kinase survival pathway. American Journal of Physiology, Cell Physiology 290 C1373–C1384.
Mulhern ML, Madson CJ, Danford A, Ikesugi K, Kador PF & Shinohara T 2006 The unfolded protein response in lens epithelial cells from galactosemic rat lenses. Investigative Ophthalmology and Visual Science 47 3951–3959.
Nakagawa T, Zhu H, Morishima N, Li E, Xu J, Yankner BA & Yuan J 2000 Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature 403 98–103.
Nakatani Y, Kaneto H, Kawamori D, Yoshiuchi K, Hatazaki M, Matsuoka TA, Ozawa K, Ogawa S, Hori M & Yamasaki Y et al. 2005 Involvement of endoplasmic reticulum stress in insulin resistance and diabetes. Journal of Biological Chemistry 280 847–851.
Obineche E, Chandranath I, Adeghate E, Benedict S, Fahim M & Adem A 2006 Alterations in atrial natriuretic peptide and its receptor levels in long-term, streptozotocin-induced, diabetes in rats. Annals of the New York Academy of Sciences 1084 223–234.
Okada K, Minamino T, Tsukamoto Y, Liao Y, Tsukamoto O, Takashima S, Hirata A, Fujita M, Nagamachi Y & Nakatani T et al. 2004 Prolonged endoplasmic reticulum stress in hypertrophic and failing heart after aortic constriction: possible contribution of endoplasmic reticulum stress to cardiac myocyte apoptosis. Circulation 110 705–712.
Oyadomari S, Koizumi A, Takeda K, Gotoh T, Akira S, Araki E & Mori M 2002 Targeted disruption of the Chop gene delays endoplasmic reticulum stress-mediated diabetes. Journal of Clinical Investigation 109 525–532.
Pang Y, Hunton DL, Bounelis P & Marchase RB 2002 Hyperglycemia inhibits capacitative calcium entry and hypertrophy in neonatal cardiomyocytes. Diabetes 51 3461–3467.
Pereira L, Matthes J, Schuster I, Valdivia HH, Herzig S, Richard S & Gomez AM 2006 Mechanisms of [Ca2+]i transient decrease in cardiomyopathy of db/db type 2 diabetic mice. Diabetes 55 608–615.
Picano E 2003 Diabetic cardiomyopathy: the importance of being earliest. Journal of the American College of Cardiology 42 454–457.
Rao RV, Castro-Obregon S, Frankowski H, Schuler M, Stoka V, del Rio G, Bredesen DE & Ellerby HM 2002 Coupling endoplasmic reticulum stress to the cell death program. An Apaf-1-independent intrinsic pathway. Journal of Biological Chemistry 277 21836–21842.
Riggs AC, Bernal-Mizrachi E, Ohsugi M, Wasson J, Fatrai S, Welling C, Murray J, Schmidt RE, Herrera PL & Permutt MA 2005 Mice conditionally lacking the Wolfram gene in pancreatic islet beta cells exhibit diabetes as a result of enhanced endoplasmic reticulum stress and apoptosis. Diabetologia 48 2313–2321.
Schröder M & Kaufman RJ 2005 The mammalian unfolded protein response. Annual Review of Biochemistry 74 739–789.
Siebenhofer A, Ng LL, Plank J, Berghold A, Hodl R & Pieber TR 2003 Plasma N-terminal pro-brain natriuretic peptide in Type 1 diabetic patients with and without diabetic nephropathy. Diabetic Medicine 20 535–539.
Tappia PS, Asemu G, Aroutiounova N & Dhalla NS 2004 Defective sarcolemmal phospholipase C signaling in diabetic cardiomyopathy. Molecular and Cellular Biochemistry 261 193–199.
Tiwari M, Kumar A, Sinha RA, Shrivastava A, Balapure AK, Sharma R, Bajpai VK, Mitra K, Babu S & Godbole MM 2006 Mechanism of 4-HPR-induced apoptosis in glioma cells: evidences suggesting role of mitochondrial-mediated pathway and endoplasmic reticulum stress. Carcinogenesis 27 2047–2058.
Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP & Ron D 2000 Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 287 664–666.
Wang XZ, Lawson B, Brewer JW, Zinszner H, Sanjay A, Mi LJ, Boorstein R, Kreibich G, Hendershot LM & Ron D 1996 Signals from the stressed endoplasmic reticulum induce C/EBP-homologous protein (CHOP/GADD153). Molecular and Cellular Biology 16 4273–4280.
Wang XZ, Harding HP, Zhang Y, Jolicoeur EM, Kuroda M & Ron D 1998 Cloning of mammalian Ire1 reveals diversity in the ER stress responses. EMBO Journal 17 5708–5717.
Werstuck GH, Khan MI, Femia G, Kim AJ, Tedesco V, Trigatti B & Shi Y 2006 Glucosamine-induced endoplasmic reticulum dysfunction is associated with accelerated atherosclerosis in a hyperglycemic mouse model. Diabetes 55 93–101.
Wijekoon EP, Brosnan ME & Brosnan JT 2007 Homocysteine metabolism in diabetes. Biochemical Society Transactions 35 1175–1179.
Yoshida H, Okada T, Haze K, Yanagi H, Yura T, Negishi M & Mori K 2000 ATF6 activated by proteolysis binds in the presence of NF-Y (CBF) directly to the cis-acting element responsible for the mammalian unfolded protein response. Molecular and Cellular Biology 20 6755–6767.
Zinszner H, Kuroda M, Wang X, Batchvarova N, Lightfoot RT, Remotti H, Stevens JL & Ron D 1998 CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes and Development 12 982–995.
(Z Li and T Zhang contributed equally to this work)
