Abstract
Etv4, Etv1, and Etv5 are members of Etv4 subfamily of E26 transformation-specific (Ets) transcription factors that are known to influence a host of biological processes. We previously showed that Etv5, expressed in Sertoli cells, plays a crucial role in maintaining spermatogonial stem cell niche in the mouse testis. However, it is not yet known whether Etv4 family members are expressed in the ovary or play any role in ovarian functions. Here, we show that Etv5 and Etv4 are expressed in mouse ovaries in granulosa and cumulus cells during folliculogenesis. Both Etv5 and Etv4 mRNAs are also detected in cumulus–oocyte complexes (COCs) and denuded oocytes. Notably, Etv4 is highly expressed in the cumulus cells of ovulated COCs at 16-h post-human chorionic gonadotropin. Cyclooxygenase-2 (PTGS2), a rate-limiting enzyme for prostaglandin synthesis, is critical for oocyte maturation and ovulation. Since several putative Ets-binding sites are present in the PTGS2 promoter, we examined whether Etv5 influences Ptgs2 transcriptional activity. Indeed, we found that addition of Etv5 increases the transcriptional activity of the 3.2-kb mouse Ptgs2 promoter by 2.5-fold in luciferase reporter assays. Collectively, the results show that Etv4 and Etv5 are expressed in granulosa and cumulus cells during folliculogenesis and ovulation, suggesting that they influence cellular events in the ovary by regulating downstream genes such as Ptgs2.
Introduction
Follicles are the major functional units of the ovary. During folliculogenesis, oocyte growth and maturation are coordinated with proliferation and differentiation of granulosa and theca cells. Once follicular growth is initiated, the oocyte grows to full size and granulosa cells (GCs) form multiple layers in response to various molecular signals. After the secondary follicle is formed, a theca cell layer forms around the follicle (Eppig 1991, Matzuk 2000). Follicle-stimulating hormone (Fshb) stimulates proliferation of GCs, aromatization of androgens to estrogens, and expression of luteinizing hormone (Lhb) receptor, while Lhb stimulates androgen production in theca cells. After ovulation, the collapsed follicles transform into corpora lutea, major endocrine units of pregnancy which produce progesterone (P4), 17β-estradiol (E2), and other hormones depending on species. The process of transformation of GCs into lutein cells is called luteinization (Johnson & Everitt 1995).
Follicular growth is regulated by various factors including gonadotropins, steroid hormones, growth factors, and prostaglandins (PGs) (Matzuk 2000). It is well established that a balance among Fshb, Lhb, and E2 is important for folliculogenesis and ovulation. For ovulation, PGs, P4, and certain proteases are implicated. For example, inactivation of cyclooxygenase-2 (PTGS2), rate-limiting enzyme in PG biosynthesis, and PTGER2, one of the Tbxa2r receptor subtypes, in mice results in defective ovulation (Matsumoto et al. 2001). P4 receptor (PR) and a transcriptional cofactor Nrip1 are also implicated in ovarian functions (Lydon et al. 1995, Leonardsson et al. 2002). Likewise, stromelysin and other proteases are implicated in ovulation (Hagglund et al. 1999).
Etv4 transcription factors belong to superfamily of E26 transformation-specific (Ets) transcription factors. The Ets transcription factors regulate expression of target genes by binding to a ∼10 bp element in the promoters of target genes, known as Ets-binding site (EBS; 5′-GGAA/T-3′) (Sharrocks 2001). More than 20 family members have been identified in mammals and are divided into subfamilies, such as Ets, translocation Ets leukemia (Etv6), Etv4, E74-like factor (Spnb2), and ETS-2 repressor factor (Erf), based on structural composition and homology within ETS domain (Oikawa & Yamada 2003). Ets factors have been linked to diverse biological processes. Etv4 subfamily is composed of three members, Etv4, Etv1, and Etv5. They are highly conserved and are thus capable of inducing activation of target genes interchangeably via Etv4 consensus element (Sharrocks 2001). Regulation of these factors at the transcription level is important for their availability in controlling target genes, while their activity may also be regulated by post-translational modification. Some of the known target genes of Etv4 transcription factors are Fshr, Ptgs2, stromelysin, osteopontin, matrilysin, and urokinase plasminogen activator (Rorth et al. 1990, Crawford et al. 2001, Howe et al. 2001, Levallet et al. 2001, El-Tanani et al. 2004). While expression of Etv4 factors in the ovary is not known, many of their target genes are associated with female reproductive events. Thus, it is plausible that the Etv4 subfamily of Ets factors function as transcriptional activators of the above-mentioned downstream targets in reproduction.
The Etv4 factors have been implicated in various cellular processes, including proliferation, differentiation, and tumorigenesis (Roehl & Nusslein-Volhard 2001, Oikawa & Yamada 2003). Etv4 and Etv1 are important for neuronal development (Arber et al. 2000, Laing et al. 2000, Vrieseling & Arber 2006). The role of Etv5 in male reproduction has recently been revealed in the gene-targeted mouse model. Etv5−/− male mice exhibit a Sertoli cell-only syndrome (Chen et al. 2005). The cause of male infertility in Etv5−/− mice is a deficit in maintaining spermatogonial stem cell population. However, potential roles for Etv5 in female reproduction are yet to be investigated.
To this end, we assessed the spatiotemporal expression profile of Etv4, Etv1, and Etv5 in the mouse ovary during folliculogenesis and ovulation. Our data show for the first time that Etv5 and Etv4 are highly expressed in the GCs during follicular growth with different expression kinetics and that Etv5 is capable of regulating activity of the Ptgs2 promoter. Collectively, the results suggest that Etv5 and Etv4 are important transcriptional regulators during folliculogenesis and ovulation by regulating expression of target genes.
Materials and Methods
Animals and sample preparation
Five-week-old virgin CD-1 female mice were purchased from Orient-Bio (Gyunggi-do, Korea). Mice were maintained in accordance with the policies of the Konkuk University Institutional Animal Care and Use Committee. Mice were cared in a controlled barrier facility within College of Veterinary Medicine, Konkuk University. Temperature, humidity, and photoperiod (12-h light:12-h darkness cycle) were kept constant. Female mice were i.p. injected with 5 IU pregnant mare's serum gonadotropin (PMSG) (Sigma) to stimulate the growth of pre-ovulatory follicles. Forty-eight hours later, some PMSG-treated mice were i.p. injected with 5 IU human chorionic gonadotropin (hCG) (Sigma). Experimental groups are 0 h (PMSG only), 3 h (3-h post-hCG), 6 h (6-h post-hCG), 9 h (9-h post-hCG), 16 h (16-h post-hCG), and 24 h (24-h post-hCG). In some experiments, ovarian samples were collected from PMSG-injected mice at 0- (cycling mice), 3-, 6-, 12-, 24-, 36-, and 48-h post-injection. Five female mice were used in each experimental group. One ovary of each mouse was collected (n=5 each time point) for RNA extraction. The other ovaries were frozen for cryosectioning (below).
Materials
The mouse Ptgs2 (mPtgs2) promoter of 3.2 kb was a generous gift from Dr D DeWitt (Michigan State University). Anti-peptide polyclonal antibodies for Etv4 and Etv5 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-Ptgs2 antibody was purchased from Cayman Chemical (Ann Arbor, MI, USA) and anti-Etv1 antibody was from Abcam (Cambridge, MA, USA).
Tissue preparation for cryosections
Some ovaries were frozen and embedded in Tissue Freezing Medium (Electron Microscopy Sciences, Washington, PA, USA). Cryosections of ovary were cut at 12 μm and mounted onto poly-l-lysine-coated slides (Polysciences, Inc., Washington, PA, USA).
Collection of cumulus–oocyte complexes (COCs) and denuded oocytes
Six-week-old CD-1 mice were injected with 5 IU PMSG followed by 5 IU hCG 48 h later to induce superovulation. At 16- or 24-h post-hCG, ampullae of oviducts were torn open for retrieval of ovulated COCs. Pre-ovulatory COCs were collected from 6-h post-hCG ovaries by ovary puncture. For denudation, cumulus cells were removed mechanically by a mouth-controlled pipette. Collected COCs or denuded oocytes were processed for RNA isolation or immunofluorescence staining. To isolate minute amounts of RNA from these samples, glycogen was used in a modified protocol.
RT-PCR
Total RNA extraction was performed by TRIzol Reagent (Sigma) according to the manufacturer's protocol. The resuspended RNA samples were treated with ribonuclease A (RNase A)-free DNase I (DNase I, Takara, Japan) for 1 h at 37 °C to remove residual genomic DNA. Concentration and purity of the samples were evaluated by the ratio of optical density (OD)260:(OD)280 by a spectrophotometer. Two micrograms of total RNA were incubated with 2 μl primer cocktail at 68 °C and subjected to reverse transcription (RT) using SuperScript III reverse transcriptase (Invitrogen) for cDNA synthesis. The samples were either used directly for PCR or stored in −20 °C. PCR was carried out using Prime Taq Premix (2×) (Genet Bio, Daejeon, Korea) and reactions were carried out in the PCR thermal cycler (Applied Biosystems, Foster City, CA, USA). Following initial denaturation at 95 °C for 5 min, PCR was performed at 95 °C for 30 s, at specific annealing temperature (55–62 °C) for 30 s, and 72 °C for 30 s. Expression of the glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was compared as internal control. Primer sequences are given in Table 1.
Primers used for RT-PCR and quantitative RT-PCR in this study
| Primer sequence | Product size (bp) | GenBank Accession no. | |
|---|---|---|---|
| Gene name | |||
| Etv4_1 | (F) TGAAAGGCGGATACTTGGAC | 203 | NM_008815 |
| (R) GTCCGGTACCTGAGCTTCTG | |||
| Etv4_2a | (F) CCACCAGGATCAAGAAGGAA | 131 | NM_008815 |
| (R) TTGTCTGGGGGAGTCATAGG | |||
| Etv1 | (F) TGAAAATGGAGCCCCAATCA | 139 | NM_007960 |
| (R) GCTGGTGTTCCTGAAGGCTTC | |||
| Etv5 | (F) AGGACCCCAGGCTGTACTTT | 260 | NM_023794 |
| (R) TGGCCGATTCTTCTGGATAC | |||
| Ptgs2 | (F) TTGCATTCTTTGCCCAGCAC | 96 | NM_011198 |
| (R) TCCACTCCATGGCCCAGTC | |||
| Gapdh | (F) TGCCCCCATGTTTGTGATG | 249 | NM_001037921 |
| (R) TGTGGTCATGAGCCCTTCC |
Used in RT-PCR and qRT-PCR in Fig. 1.
Quantitative RT-PCR
Quantitative RT-PCR (qRT-PCR) was performed by real-time monitoring of increases in fluorescence of the SYBR Green dye (Molecular Probes, Eugene, OR, USA) as described (Wittwer et al. 1997, Morrison et al. 1998) using the ABI Prism 7500 Sequence Detection System (Applied Biosystems). For comparison of transcript levels between samples, a standard curve of cycle thresholds for serial dilutions of a cDNA sample was established and then used to calculate the relative abundance of each gene. Values were then normalized to the relative amounts of Gapdh cDNA, which were obtained from a similar standard curve. All PCRs were performed in triplicates. Melting curves were plotted to determine the identity of PCR product (Ririe et al. 1997).
Immunofluorescence staining and confocal laser microscopy
Cryosections were fixed with ice-cold methanol for 20 min at room temperature and washed thrice with PBS for 5 min each. Freshly isolated COCs were fixed with 4% paraformaldehyde in PBS. The sections were then permeabilized with PBS containing 0.1% Tween 20 for 20 min and washed with PBS. The sections were blocked in 2% BSA in PBS for 1 h followed by specific primary antibodies in 2% BSA in PBS for 40 min at room temperature. The slides were rinsed thrice with 2% BSA in PBS. The sections were incubated with Alexa Fluor 488-conjugated secondary antibodies (Molecular Probes) at 1:250 in 2% BSA in PBS for 30 min in dark and washed twice. The sections were counterstained with TO-PRO-3-iodide in PBS (1:500) for 20 min and rinsed thrice in PBS. Cover slips were mounted onto sections with Antifade mounting medium (Invitrogen) and sealed with nail polish. Images were obtained using the Olympus Fluoview FV1000 Confocal Microscope (Olympus, Tokyo, Japan) and analyzed using the software Fluoview version 1.5, a platform associated with the confocal microscope.
Western blot
Protein extracts from ovaries were prepared in solubilization buffer (50 mm Tris–Cl (pH 7.5), 150 mm NaCl, 1% Nonidet P-40 (NP-40), 10% glycerol, 1 mm EGTA) containing an aliquot of Complete protease inhibitor cocktail (Roche). Tissues were homogenized with Polytron homogenizer (Brinkmann, Westbury, NY, USA) and centrifuged at 12 800 g. The supernatants were subjected to Bradford assays (Bio-Rad Laboratories) for quantitation. Approximately 60–100 μg proteins were loaded onto 7.5% SDS-PAGE gels. After transferring to nitrocellulose membranes, the membranes were subjected to western blotting with specific antibodies. Intensity of anti-β-actin is compared among loaded samples. Chemiluminescence signal was detected by LAS3000 (Fuji Film, Japan).
Transfection and luciferase reporter assays
293T cells were obtained from American Type Culture Collection (Rockville, MD, USA). The cells were grown in Dulbecco's modified Eagle medium (Invitrogen) supplemented with 10% FBS (Sigma) and penicillin (100 U/ml)–streptomycin (100 μg/ml) in a 5% CO2 atmosphere. The cells were split into six-well plates a day before transfection. The cells were transfected with a mixture containing FuGENE6 transfection reagent (Roche), 0.6 μg/ml mPtgs2-luciferase reporter vector, 0.2 μg/ml renilla luciferase vector, 0.6 μg/ml empty, Etv5, or Etv1 expression vector under the control of CMV promoter in serum-free DMEM for 5 h. All transfection reactions were normalized to a total of 2.0 μg/ml plasmid DNA with pCDNA3. The transfection mixture was replaced with complete media. After 24 h, the cells were harvested in lysis buffer (0.05% Tris/MES, (pH 7.8), 1% Triton X-100). Relative light units from luciferase activity were determined using Veritas (Turner Biosystems, Sunnyvale, CA, USA) and normalized to the renilla luciferase activity using Dual Luciferase Assay Kit (Promega). Data are presented as fold activation relative to vehicle-treated cells in the pCDNA-transfected group and represented the mean from at least three independent transfection experiments. A statistical significance was examined by a student's t-test (two tails) using Microsoft Excel program. All error bars represent s.d. from the mean.
Results
Etv4, Etv1, and Etv5 are expressed during follicular growth and ovulation
RNA samples of PMSG/hCG-treated ovaries were first validated by the expression of a known marker gene of hormone responsiveness, Ptgs2. Ptgs2 is a crucial factor for ovulation and is generally induced around 3-h post-hCG (Lim et al. 1997, Joyce et al. 2001, Segi et al. 2003). As shown in Fig. 1A, induction of Ptgs2 at 3-h post-hCG is consistent with previous reports (Joyce et al. 2001). Thus, these ovarian RNA samples show proper hormone responsiveness. We then used these samples to examine mRNA expression of Etv4, Etv1, and Etv5. As shown in Fig. 1A, these three genes were all expressed in the ovary.
Expression of Etv4 transcription factors in the ovaries of PMSG/hCG-injected mice. Total RNA samples were obtained from whole ovaries of hormone-treated mice at 0-, 3-, 6-, 9-, 16-, and 24-h post-hCG. RNA samples were subjected to reverse transcription (RT) (n=5 each group). (A) RT-PCR analysis of Ptgs2, Etv4, Etv1, and Etv5 in one representative set of RT samples. Ptgs2 was used as a marker to show hormone responsiveness. Primer sequences are shown in Table 1. (B–D) Quantitative RT(qRT)-PCR analysis of Etv4, Etv1, and Etv5 using three sets of samples showing good hormone responsiveness judging from Ptgs2 expression. qRT-PCR was performed by monitoring in real time the increases in fluorescence of the SYBR green dye as described, using ABI Prism 7500 Sequence Detection System. For comparison of transcript levels between samples, a standard curve of cycle thresholds for several serial dilutions of a cDNA sample was established and then used to calculate the relative abundance of each gene. Values were then normalized to the relative amounts of Gapdh cDNA, which were obtained from a similar standard curve. All PCRs were performed in triplicate. Error bars represent s.d. values. (E) Western blot analysis of Etv4 and Etv5 protein. Immunoreactive Etv4 and Etv5 at predicted sizes are detected in ovary lysates obtained from PMSG/hCG-treated mice at indicated post-hCG time points. 293T transfected with full-length Etv5 serves as a positive control. β-actin serves as loading control. All primary antibodies were used at 1:1000. This experiment was repeated twice with independent samples.
Citation: Journal of Endocrinology 198, 2; 10.1677/JOE-08-0142
To quantify mRNA expression of Etv4, Etv1, and Etv5 in the ovaries of PMSG/hCG-treated mice, we performed quantitative real-time PCR using three sets of ovarian cDNA samples (Fig. 1B–D). The expression of Etv4 is slightly increased at 3-h post-hCG and decreased at 16 h (Fig. 1B). Etv1 is maintained at low levels during follicular growth and ovulation (Fig. 1C). Etv5 is expressed at all time points but its mRNA level is the highest around 6- to 9-h post-hCG (Fig. 1D).
To examine whether Etv5 and Etv4 transcripts are translated in mouse ovaries, we performed western blot analysis using ovary lysates obtained from hormone-treated mice. As shown in Fig. 1E, steady-state expression of ∼70 kDa ETV5 protein was detected in all ovary samples. Immunoreactive ETV4 protein, in doublets, was also detected in the ovaries of hormone-treated mice. This doublet feature of immunoreactive ETV4 was previously reported by others (Kathuria et al. 2004).
Expression of Etv4 transcription factors in the ovaries of PMSG-injected mice
The above results show that Etv4, Etv1, and Etv5 are all expressed in ovaries during pre-ovulatory and ovulatory follicular growth. We then examined whether expression of these factors fluctuate during earlier phases of folliculogenesis in the ovaries of PMSG-injected mice. As shown in Fig. 2, Etv4, Etv1, and Etv5 all maintain steady-state levels of mRNA expression in groups of 0- to 48-h post-PMSG. Immunoreactive ETV5 and ETV4 protein are detected at all time points in western blot analyses.
Expression of Etv4 transcription factors in the ovaries of PMSG-treated mice. (A) Total RNA samples were obtained from whole ovaries of PMSG-treated mice at 0, 3, 6, 12, 24, 36, and 48 h. RNA samples were subjected to reverse transcription (RT). All three genes maintain steady-state levels of expression. (B) Western blot analysis of immunoreactive Etv4 and Etv5 at indicated time points. β-actin serves as loading control. All primary antibodies were used at 1:1000. These experiments were repeated twice with independent samples.
Citation: Journal of Endocrinology 198, 2; 10.1677/JOE-08-0142
Etv4 transcription factors exhibit cell type-specific expression in the mouse ovary
To examine cell type-specific localization of Etv4, Etv1, and Etv5, we performed immunofluorescence staining in the ovarian cryosections at 48-h post-hCG and 6-h post-hCG (following PMSG). As shown in Fig. 3, Etv4 was predominantly localized in GC layers in early and late follicles at both time points. Immunoreactive ETV4 is also detected in nuclei of oocytes within follicles. Etv1 expression was not noted in any major cell types in the ovary. On a brain section, anti-ETV1 antibody shows weak positive staining in the cell bodies (data not shown), thus negative staining of ETV1 in the mouse ovary does not seem to be due to poor antibody reactivity. Immunoreactive ETV5 was also found in GCs of follicles at various stages. The result suggests that both Etv4 and Etv5 functions in GCs during folliculogenesis.
Cell type-specific expression of Etv4 transcription factors in the mouse ovary. Immunolocalization of Etv4, Etv1, and Etv4 on cryosections was performed with specific antibodies and visualized by confocal laser microscopy. Rabbit anti-ETV4, rabbit anti-ETV1, and goat anti-ETV5 antibodies were used and followed by Alexa Fluor 488-conjugated secondary antibodies. Thus, green fluorescence indicates the site of protein expression. Red fluorescence is from a nuclear dye TO-PRO-3-iodide. Yellow fluorescence is an overlay of protein localization (green) and nuclear staining (red). Etv4 and Etv5 expression is noted in GC layers strongly. Etv1 was not detected, although weak nuclear staining was detected in some cell bodies of a brain section which was used as a positive control (data not shown). Anti-ETV5 and anti-ETV4 antibodies (Santa Cruz) were used at 4 μg/ml. Anti-ETV1 antibody (Abcam) was used at 1:500.
Citation: Journal of Endocrinology 198, 2; 10.1677/JOE-08-0142
Expression of Etv4 and Etv5 in the ovulated COCs
To examine expression of Etv4 and Etv5 in the ovulated eggs, COCs were collected from ampullae of superovulated mice. For each sample, 20–30 COCs or oocytes were used and Gapdh expression was compared among samples. As shown in Fig. 4, both Etv4 and Etv5 were localized in cumulus cells. Etv4 is localized in most of the cumulus cells with high abundance (Fig. 4A). Green fluorescence in ooplasm is likely an artefact, as rabbit IgG used as a negative control also gave similar pattern of staining in the ooplasm (data not shown).
Expression of Etv4 and Etv5 in the ovulated cumulus–oocyte complexes. Cumulus–oocyte complexes (COCs) were collected from ampullae of superovulated mice. (A) Etv4 and Etv5 expression at 6- and 16-h post-hCG was confirmed with specific antibody in ovulated COCs. Green fluorescence indicates immunoreactive protein and red fluorescence indicates nuclear staining. Both Etv5 and Etv4 are localized in cumulus cells. Strong green staining in the ooplasm is likely an artefact, since staining with rabbit IgG also generated similar staining pattern in the ooplasm (data not shown). (B) RT-PCR analyses were performed in RNA sampled obtained from denuded oocytes (O) and COCs (COC) at indicated time points. These experiments were repeated twice with independent samples.
Citation: Journal of Endocrinology 198, 2; 10.1677/JOE-08-0142
COCs and denuded oocytes were collected by ovary puncture (6-h post-hCG) or oviduct tearing (16- and 24-h post-hCG) for RT-PCR analysis of Etv4 and Etv5. Etv5 exhibits steady-state expression in COCs and oocytes (Fig. 4B). By contrast, Etv4 message is induced at the highest level in the ovulated COCs (16-h post-hCG). This expression subsides by 24 h. Collectively, these results show that Etv4 and Etv5 are expressed in cumulus cells of ovulated oocytes with different time kinetics and that they are potential transcriptional regulators of genes associated with folliculogenesis and ovulation.
Etv5 increases the promoter activity of the mPtgs2 promoter
As mentioned above, one of the potential target genes of Etv4 transcription factors is Ptgs2. It is known previously that the human Ptgs2 promoter of about 1.5 kb responds to addition of Etv4 or Etv5, showing heightened reporter activity (Howe et al. 2001). By MatInspector database (Cartharius et al. 2005), we found that there are at least 19 potential EBS with a core sequence of GGAA/T within the mPtgs2 promoter of 3.2 kb (data not shown). Two of these sites are classified as potential binding sites for Etv4 factors. From the expression profiles above, we hypothesized that Etv4 factors expressed in the GCs is one of the transcriptional regulators of Ptgs2 required for ovulation. Thus, we performed luciferase reporter assays in 293T cells to examine whether the addition of Etv4 transcription factors increases transcriptional activity of the mPtgs2 promoter. As shown in Fig. 5B, the addition of Etv5 increases basal activity of the 3.2 kb mPtgs2 promoter close to 2.5-fold. Etv1 did not have such effect. As shown in Fig. 5C and as described previously (Lim et al. 1997, Takahashi et al. 2006), Ptgs2 is expressed in granulosa and cumulus cells of ovulated oocytes (Fig. 5C). Distinct perinuclear staining of Ptgs2 is visible in these cells. Thus, Etv5 and Ptgs2 are indeed present in the same cell type making direct transcriptional interaction possible.
Activation of the mPtgs2 Promoter by Etv5. (A) A hypothesis. mPtgs2 has potential Ets-binding sites in the promoter. mPtgs2 and Etv5 are both expressed in granulosa and cumulus cells. (B) In 293T cells, 3.2 kb mPtgs2 promoter with luciferase reporter was transfected along with full-length mouse Etv5 or Etv1 cDNA. Addition of Etv5, but not Etv1, increases mPtgs2 promoter activity up to 2.5-fold. Error bars represent s.d. and statistical significance was examined by a student t-test. *P<0.01. This experiment was repeated four times with similar results. (C and D) Immunofluorescence staining of mPtgs2 in the ovarian section at 6-h post-hCG. Distinct perinuclear staining of mPtgs2 is noted in GC layers and cumulus cells surrounding an oocyte (O). Arrows indicate chromosomes (red) in the oocyte.
Citation: Journal of Endocrinology 198, 2; 10.1677/JOE-08-0142
Discussion
Follicular development and ovulation require well-coordinated signaling by multiple intra-ovarian and extra-ovarian factors. These factors include gonadotropins, steroid hormones, growth factors, and cell cycle molecules. While certain endocrine factors have been obvious targets of research on ovarian functions for a long time, the list of genes involved in ovarian physiology is expanding by the availability of diverse gene-targeted mouse models and other advanced bioinformatic techniques.
The hypothesis we tested herein is that Etv5 and related factor Etv4 exhibit specific expression patterns in the mouse ovary during folliculogenesis and ovulation. We formulated this notion from our previous work showing the crucial function of Etv5 in maintaining spermatogonial stem cell niche in the mouse testis (Chen et al. 2005). Since developmental process and cellular components of male and female gonads share common as well as distinct characteristics, it is plausible that Etv5 serves an important function in female mice as in male. In the mouse testis, Etv5 is predominantly expressed in Sertoli cells. It is believed that Etv5 in Sertoli cells induces certain secreted factors, affecting stem cell niche at the basal side of Sertoli cells (Chen et al. 2005). As we have shown herein, Etv5 and Etv4 are expressed primarily in the granulosa and cumulus cells, the counterpart of Sertoli cells in female mice. Spatiotemporal expression patterns of Etv5 and Etv4 in the mouse ovary suggest that these transcription factors may play important roles in regulating genes involved in events of follicular growth and ovulation. Preliminary work with Etv5-deficient female mice show ovulation defects (Lim et al. unpublished observations) but the underlying mechanism is still under investigation. Our data showing cell type-specific localization of Etv5 will help reveal the mechanism of infertility in ETV5-deficient female mice.
Our results show that Etv5 expression is maintained during all stages of follicular growth and ovulation. This is reminiscent of expression pattern of Etv5 in the mouse testis, where Etv5 is found in Sertoli cells at all times with the onset of puberty (Chen et al. 2005). By contrast, expression of Etv4 exhibits notable fluctuation during follicular growth. By 9-h post-hCG, the levels of Etv4 are built up in the ovary, and with ovulation, its expression is downregulated (Fig. 1). High Etv4 expression is now reflected in the cumulus cells of ovulated COCs (Fig. 4). This result is suggestive of Etv4's role in pre-ovulatory GCs and post-ovulatory cumulus cells within a narrow time frame. Dynamic expression of Etv4 suggests that it may play a role in oocyte–cumulus cell crosstalk prior to ovulation. While this dynamic expression pattern of Etv4 during follicular growth is interesting, Etv4-deficient female mice do not seem to have any problem with their reproductive performance (Laing et al. 2000). Thus, Etv4 may not be essential in ovarian functions.
We show that the promoter activity of mPtgs2 can be increased by Etv5, but not by Etv1. Etv5 and Ptgs2 are both expressed in pre-ovulatory GCs and cumulus cells in the ovulated COCs, increasing the likelihood that Ptgs2 is under direct transcriptional regulation by Etv5. Whether Etv4 also regulate Ptgs2 transcription is yet to be investigated. In addition, since there are several putative binding sites for Etv4 transcription factors within the 3.2 kb of the mPtgs2 promoter, identification of actual binding site(s) for Etv5 should ensue.
Three members of the Etv4 subfamily, Etv4, Etv1, and Etv5, share high sequence homology and have well-conserved functional domains. The protein sequence of these three members are more than 95% identical within the Ets domain, 85% within N-terminal transactivation domain, and approximately 50% overall (de Launoit et al. 2000). While gene targeting experiments revealed specific neuronal functions for Etv4 and Etv1, they are also associated with oncogenesis. For example, overexpression of Etv4 is observed in metastatic mammary adenocarcinomas in MMTV-neu transgenic mice (Trimble et al. 1993). In these mice, all three members of Etv4 subfamily are coordinately overexpressed in mammary tumors (Shepherd et al. 2001). Indeed, Etv4 factors are overexpressed human breast cancer cells (Baert et al. 2002). Furthermore, Etv4 is overexpressed in ovarian carcinoma in humans (Davidson et al. 2003), while upregulation of Etv5 is associated with degree of myometrial infiltration in endometrial carcinoma (Planaguma et al. 2005). Thus, Etv4 transcriptional factors seem to bear oncogenic features in female reproductive organs. Expression of Etv4 factors are correlated with tumor invasiveness and thus their functions is assumed to be associated with regulation of certain proteases required for tumor invasion (Horiuchi et al. 2003, Yamamoto et al. 2004).
Our previous work on the expression of Etv5, Etv1, and Etv4 in mouse uterus during periimplantation (Koo et al. 2005), we showed that expression of Etv5 is associated with early events of implantation. Etv1 is expressed highly in the developing vasculature of post-implantation uterus. Thus, it is possible that Etv4 transcription factors play distinct functions in the female reproductive organs potentially in hormone-regulated manners. It will be important to scrutinize steroid hormone-induced expression patterns of Etv5, Etv1, and Etv4, to gain further insights into the roles of these factors in ovulation and other female reproductive functions.
Collectively, the present investigation provides new information that Etv4 subfamily of Ets transcription factors exhibit specific spatiotemporal expression in the mouse ovary. These transcription factors may play important roles in regulating genes involved in proliferation and differentiation of GC layers and subsequent ovulation. Our preliminary work shows that Etv5 and Etv4 are expressed also in cumulus cells in humans (unpublished observations), and the role for these factors in functions of human cumulus cells will be important to explore. Further investigation is required to reveal mechanism of Etv5 action in ovulation using Etv5-deficient mice. Identification of other target genes for Etv5 and Etv4 will also provide clues to understand mechanisms of action of these transcription factors in follicular growth and ovulation.
Declaration of Interest
The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.
Funding
This work was supported by the Korean Research Foundation Grant funded by the Korean Government (MOEHRD, Basic Research Promotion Fund) (KRF-2006-312-C00642).
Author contribution statement
Study concept and design: K M, H S and H J L; Statistical analysis: J E; Acquisition of data: J E and K H; Analyses and interpretation of data: J E, K H, K M, H S and H J L; Writing the manuscript: J E and H J L.
Acknowledgements
We thank Dr D DeWitt for generously providing the mouse Ptgs2 promoter construct. Authors also appreciate technical support of Ms H Shin.
References
Arber S, Ladle DR, Lin JH, Frank E & Jessell TM 2000 ETS gene Er81 controls the formation of functional connections between group Ia sensory afferents and motor neurons. Cell 101 485–498.
Baert JL, Beaudoin C, Coutte L & de LY 2002 ERM transactivation is up-regulated by the repression of DNA binding after the PKA phosphorylation of a consensus site at the edge of the ETS domain. Journal of Biological Chemistry 277 1002–1012.
Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, Frisch M, Bayerlein M & Werner T 2005 MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21 2933–2942.
Chen C, Ouyang W, Grigura V, Zhou Q, Carnes K, Lim H, Zhao GQ, Arber S, Kurpios N & Murphy TL et al. 2005 ERM is required for transcriptional control of the spermatogonial stem cell niche. Nature 436 1030–1034.
Crawford HC, Fingleton B, Gustavson MD, Kurpios N, Wagenaar RA, Hassell JA & Matrisian LM 2001 The PEA3 subfamily of Ets transcription factors synergizes with beta-catenin-LEF-1 to activate matrilysin transcription in intestinal tumors. Molecular and Cellular Biology 21 1370–1383.
Davidson B, Goldberg I, Gotlieb WH, Kopolovic J, Ben-Baruch G & Reich R 2003 PEA3 is the second Ets family transcription factor involved in tumor progression in ovarian carcinoma. Clinical Cancer Research 9 1412–1419.
El-Tanani M, Platt-Higgins A, Rudland PS & Campbell FC 2004 Ets gene PEA3 cooperates with beta-catenin-Lef-1 and c-Jun in regulation of osteopontin transcription. Journal of Biological Chemistry 279 20794–20806.
Eppig JJ 1991 Intercommunication between mammalian oocytes and companion somatic cells. BioEssays 13 569–574.
Hagglund AC, Ny A, Leonardsson G & Ny T 1999 Regulation and localization of matrix metalloproteinases and tissue inhibitors of metalloproteinases in the mouse ovary during gonadotropin-induced ovulation. Endocrinology 140 4351–4358.
Horiuchi S, Yamamoto H, Min Y, Adachi Y, Itoh F & Imai K 2003 Association of ets-related transcriptional factor E1AF expression with tumour progression and overexpression of MMP-1 and matrilysin in human colorectal cancer. Journal of Pathology 200 568–576.
Howe LR, Crawford HC, Subbaramaiah K, Hassell JA, Dannenberg AJ & Brown AM 2001 PEA3 is up-regulated in response to Wnt1 and activates the expression of cyclooxygenase-2. Journal of Biological Chemistry 276 20108–20115.
Johnson MH & Everitt BJ 1995 Ovarian function. In Essential Reproduction, edn 4, pp 60–78. Cambridge: Blackwell Science..
Joyce IM, Pendola FL, O'Brien M & Eppig JJ 2001 Regulation of prostaglandin-endoperoxide synthase 2 messenger ribonucleic acid expression in mouse granulosa cells during ovulation. Endocrinology 142 3187–3197.
Kathuria H, Cao YX, Ramirez MI & Williams MC 2004 Transcription of the caveolin-1 gene is differentially regulated in lung type I epithelial and endothelial cell lines. A role for ETS proteins in epithelial cell expression. Journal of Biological Chemistry 279 30028–30036.
Koo TB, Song H, Moon I, Han K, Chen C, Murphy K & Lim H 2005 Differential expression of the PEA3 subfamily of ETS transcription factors in the mouse ovary and peri-implantation uterus. Reproduction 129 651–657.
Laing MA, Coonrod S, Hinton BT, Downie JW, Tozer R, Rudnicki MA & Hassell JA 2000 Male sexual dysfunction in mice bearing targeted mutant alleles of the PEA3 ets gene. Molecular and Cellular Biology 20 9337–9345.
de Launoit Y, Chotteau-Lelievre A, Beaudoin C, Coutte L, Netzer S, Brenner C, Huvent I & Baert JL 2000 The PEA3 group of ETS-related transcription factors. Role in breast cancer metastasis. Advances in Experimental Medicine and Biology 480 107–116.
Leonardsson G, Jacobs MA, White R, Jeffery R, Poulsom R, Milligan S & Parker M 2002 Embryo transfer experiments and ovarian transplantation identify the ovary as the only site in which nuclear receptor interacting protein 1/RIP140 action is crucial for female fertility. Endocrinology 143 700–707.
Levallet J, Koskimies P, Rahman N & Huhtaniemi I 2001 The promoter of murine follicle-stimulating hormone receptor: functional characterization and regulation by transcription factor steroidogenic factor 1. Molecular Endocrinology 15 80–92.
Lim H, Paria BC, Das SK, Dinchuk JE, Langenbach R, Trzaskos JM & Dey SK 1997 Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91 197–208.
Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery CA, Shyamala G, Conneely OM & Malley BW 1995 Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes and Development 9 2266–2278.
Matsumoto H, Ma W, Smalley W, Trzaskos J, Breyer RM & Dey SK 2001 Diversification of cyclooxygenase-2-derived prostaglandins in ovulation and implantation. Biology of Reproduction 64 1557–1565.
Matzuk MM 2000 Revelations of ovarian follicle biology from gene knockout mice. Molecular and Cellular Endocrinology 163 61–66.
Morrison TB, Weis JJ & Wittwer CT 1998 Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification. Biotechniques 24 954–958, 960, 962.
Oikawa T & Yamada T 2003 Molecular biology of the Ets family of transcription factors. Gene 303 11–34.
Planaguma J, Abal M, Gil-Moreno A, az-Fuertes M, Monge M, Garcia A, Baro T, Xercavins J, Reventos J & Alameda F 2005 Up-regulation of ERM/ETV5 correlates with the degree of myometrial infiltration in endometrioid endometrial carcinoma. Journal of Pathology 207 422–429.
Ririe KM, Rasmussen RP & Wittwer CT 1997 Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Analytical Biochemistry 245 154–160.
Roehl H & Nusslein-Volhard C 2001 Zebrafish pea3 and erm are general targets of FGF8 signaling. Current Biology 11 503–507.
Rorth P, Nerlov C, Blasi F & Johnsen M 1990 Transcription factor PEA3 participates in the induction of urokinase plasminogen activator transcription in murine keratinocytes stimulated with epidermal growth factor or phorbol-ester. Nucleic Acids Research 18 5009–5017.
Segi E, Haraguchi K, Sugimoto Y, Tsuji M, Tsunekawa H, Tamba S, Tsuboi K, Tanaka S & Ichikawa A 2003 Expression of messenger RNA for prostaglandin E receptor subtypes EP4/EP2 and cyclooxygenase isozymes in mouse periovulatory follicles and oviducts during superovulation. Biology of Reproduction 68 804–811.
Sharrocks AD 2001 The ETS-domain transcription factor family. Nature Review. Molecular and Cellular Biology 2 827–837.
Shepherd TG, Kockeritz L, Szrajber MR, Muller WJ & Hassell JA 2001 The pea3 subfamily ets genes are required for HER2/Neu-mediated mammary oncogenesis. Current Biology 11 1739–1748.
Takahashi T, Morrow JD, Wang H & Dey SK 2006 Cyclooxygenase-2-derived prostaglandin E2 directs oocyte maturation by differentially influencing multiple signaling pathways. Journal of Biological Chemistry 281 37117–37129.
Trimble MS, Xin JH, Guy CT, Muller WJ & Hassell JA 1993 PEA3 is overexpressed in mouse metastatic mammary adenocarcinomas. Oncogene 8 3037–3042.
Vrieseling E & Arber S 2006 Target-induced transcriptional control of dendritic patterning and connectivity in motor neurons by the ETS gene Pea3. Cell 127 1439–1452.
Wittwer CT, Herrmann MG, Moss AA & Rasmussen RP 1997 Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques 22 130–138.
Yamamoto H, Horiuchi S, Adachi Y, Taniguchi H, Nosho K, Min Y & Imai K 2004 Expression of ets-related transcriptional factor E1AF is associated with tumor progression and over-expression of matrilysin in human gastric cancer. Carcinogenesis 25 325–332.
