Two cytochrome P450 aromatase genes in the hermaphrodite ricefield eel Monopterus albus: mRNA expression during ovarian development and sex change

in Journal of Endocrinology
View More View Less
  • 1 Biology Department, State Key Laboratory of Biocontrol, The Key Laboratory of Applied Marine Biology of Guangdong Province and Chinese Academy of Sciences, School of Life Sciences

Previously, the ricefield eel (Monopterus albus) was speculated to have only one cytochrome p450 aromatase gene. In this study, however, the cDNAs encoding two distinct cytochrome p450 aromatases, cyp19a1a and cyp19a1b, were isolated. The genomic organizations of both cyp19 genes were conserved when compared with other teleosts. Northern blot detected an abundant expression of cyp19a1a in the ovary, and cyp19a1b in the hypothalamus. RT-PCR coupled with Southern blot showed that cyp19a1a was expressed predominantly in the gonads of both sexes, with higher levels in the ovary than testis, while cyp19a1b was expressed in all the tissues examined in the male, but only in the brain and pituitary in the female. The levels of cyp19a1a mRNA in the ovary were increased significantly during vitellogenesis, but decreased significantly at mature stage. The levels of cyp19a1b mRNA in the brain and pituitary did not vary significantly during vitellogenesis. As ovarian development shifted from vitellogenesis to maturation, the levels of cyp19a1b mRNA was decreased significantly in the brain, but increased significantly in the pituitary. During natural sex change from female to male, the levels of cyp19a1a mRNA in the gonad were significantly decreased. The levels of cyp19a1b mRNA in the hypothalamus were significantly increased at the early intersexual phase, whereas the expression levels in the pituitary were significantly decreased at the intersexual phases. Taken together, these results showed a novel sexual dimorphism of cyp19a1b mRNA tissue distribution, and both CYP19 genes were associated with the ovarian development and natural sex change of the ricefield eel.

Abstract

Previously, the ricefield eel (Monopterus albus) was speculated to have only one cytochrome p450 aromatase gene. In this study, however, the cDNAs encoding two distinct cytochrome p450 aromatases, cyp19a1a and cyp19a1b, were isolated. The genomic organizations of both cyp19 genes were conserved when compared with other teleosts. Northern blot detected an abundant expression of cyp19a1a in the ovary, and cyp19a1b in the hypothalamus. RT-PCR coupled with Southern blot showed that cyp19a1a was expressed predominantly in the gonads of both sexes, with higher levels in the ovary than testis, while cyp19a1b was expressed in all the tissues examined in the male, but only in the brain and pituitary in the female. The levels of cyp19a1a mRNA in the ovary were increased significantly during vitellogenesis, but decreased significantly at mature stage. The levels of cyp19a1b mRNA in the brain and pituitary did not vary significantly during vitellogenesis. As ovarian development shifted from vitellogenesis to maturation, the levels of cyp19a1b mRNA was decreased significantly in the brain, but increased significantly in the pituitary. During natural sex change from female to male, the levels of cyp19a1a mRNA in the gonad were significantly decreased. The levels of cyp19a1b mRNA in the hypothalamus were significantly increased at the early intersexual phase, whereas the expression levels in the pituitary were significantly decreased at the intersexual phases. Taken together, these results showed a novel sexual dimorphism of cyp19a1b mRNA tissue distribution, and both CYP19 genes were associated with the ovarian development and natural sex change of the ricefield eel.

Introduction

Hermaphroditism is widespread among teleosts (Devlin & Nagahama 2002). In the sequential hermaphrodite fish, sex change, the transformation of an individual from one sex to the other in adulthood, occurs naturally in its life cycle. It has been shown that estradiol (E2) administration induced male to female sex change of protandrous black porgy (Lee et al. 2000, 2001), while inhibition of aromatase, the enzyme complex for catalyzing the conversion of androgens to estrogens, induced sex change from female to male in the protogynous goby (Kroon & Liley 2000) and grouper (Bhandari et al. 2004), but blocked natural sex change in the protandrous porgy (Lee et al. 2001). In Gobiodon erythrospilus, a hermaphroditic fish that naturally exhibits bidirectional sex change, manipulation of E2 levels via the aromatase pathway induced adult sex change in each direction (Kroon et al. 2005). The above studies imply that aromatase plays important roles in the gonadal differentiation and sex change in hermaphrodite fish.

Cytochrome P450 aromatase (CYP19) is an essential part of the aromatase enzyme complex. In mammals, with the exception of pig (Choi et al. 1997, Graddy et al. 2000), CYP19 is encoded by a single copy of the CYP19 gene, and the tissue-specific expression was achieved by the use of tissue-specific promoters and alternative splicing of 5′untranslated exons (Simpson 2003). However, two distinct CYP19 genes, namely cyp19a1a and cyp19a1b, which were expressed mainly in the ovary and brain respectively, were identified in teleosts, such as Carassius auratus (Tchoudakova & Callard 1998), Oncorhynchus mykiss (Tanaka et al. 1992, Valle et al. 2002), Danio rerio (Kishida & Callard 2001), Oreochromis niloticus (Kwon et al. 2001), Dicentrarchus labrax (Blázquez & Piferrer 2004), Halichoeres tenuispinis (Choi et al. 2005), Fundulus heteroclitus (Greytak et al. 2005), and Epinephelus coioides (Zhang et al. 2004). In fishes such as rainbow trout and tilapia, the expression of cyp19a1a was shown to be crucial for ovarian differentiation (Guiguen et al. 1999). In the protandrous gilthead seabream, differential expression of cyp19a1a gene in the gonad was shown to be associated with sex reversal (Wong et al. 2006). In the protogynous grouper, gonadal cyp19a1a expression was decreased during 17α-methyltestosterone (MT)-induced precocious sex change (Zhang et al. 2004, 2007). In juvenile sea bass, on the other hand, females exhibited higher mRNA expression levels of cyp19a1b in the brain than males by the time of gonadal sex differentiation (Blázquez & Piferrer 2004). These studies suggest that both cyp19 genes may be involved in the gonadal differentiation in teleosts, but more studies are needed, especially regarding cyp19a1b.

Ricefield eel Monopterus albus, a member of the order Synbranchiformes, is a protogynous hermaphrodite fish that changes sex from functional female, through an intersexual stage, to the functional male phase during its life cycle. This is an intriguing phenomenon and has been under extensive investigation; however, the mechanism of natural sex change in the ricefield eel remains unclear (Ye et al. 2007). The purpose of this study was to elucidate the involvement of cyp19 gene in the process of sex change in the ricefield eel. A previous study speculated that there was only one form of cyp19 gene in the ricefield eel (Yu et al. 2008). Our present study, however, identified two cyp19 genes, and results indicated that in addition to cyp19a1a in the gonad, cyp19a1b in the hypothalamus and pituitary was also associated with the ovarian development and sex change of the ricefield eel.

Materials and Methods

Animals and tissues

The ricefield eels used in this study were obtained from a local dealer in Guangzhou, Guangdong Province, P R China. All procedures and investigations were reviewed and approved by the Center for Laboratory Animals of Sun Yat-Sen University, and were performed in accordance with the Guiding Principles for the Care and Use of Laboratory Animals. Fish were killed by decapitation, and tissues were dissected, frozen immediately in liquid nitrogen and stored at −70 °C until RNA extraction. The phenotypic sex and gonadal developmental stages of the ricefield eel were verified by histological sectioning of gonads and microscopic analysis. Ovarian development was classified as four stages in this paper, namely oocytes at previtellogenic stage (stage PV), oocytes at early vitellogenic stage (stage EV), oocytes at mid- to late-vitellogenic stage (stage MLV), and mature oocytes (stage OM). The transition of sex from female to male was classified into five sexual phases according to previous work (Chan & Phillips 1967, Chan et al. 1972), namely female stage (F, gonadal lamella filled with oocytes at vitellogenic stage), early intersexual stage (IE, appearance of small testicular lobules and some atretic oocytes in the gonadal lamella, which was mainly occupied by ovarian follicles at various stages of maturation), middle intersexual stage (IM, the gonad lamella was occupied by a significant amount of testicular tissues, with some remnant atretic ovarian follicles), late intersexual stage (IL, the gonad lamella was mainly occupied by testicular lobules, with a few atretic primary oocytes), and male stage (M, the gonadal lamella was filled with testicular tissues, and devoid of ovarian tissues).

Isolation of total RNA

Total RNA was isolated from frozen tissues using TRIzol reagent (Invitrogen) and quantified based on the absorbance at 260 nm. The integrity of RNA was checked with agarose gel electrophoresis.

Oligonucleotides

The sequences of oligonucleotides used as PCR primers are listed in Table 1. Oligonucleotides CYP19F1, CYP19R1, and CYP19R2 were degenerate primers and designed based on the nucleotide sequences in highly conserved regions of previously identified vertebrate CYP19. Other oligonucleotides CYP19A1F1, CYP19A1F2, CYP19A1F3, CYP19A1F4, CYP19A1F5, CYP19A1F6, CYP19A1R1, CYP19A1R2, CYP19A1R3, CYP19A1R4, CYP19A1R5, CYP19A1R6, CYP19A2F1, CYP19A2F2, CYP19A2F3, CYP19A2F4, CYP19A2F5, CYP19A2F6, CYP19A2R1, CYP19A2R2, CYP19A2R3, CYP19A2R4, CYP19A2R5, CYP19A2R6, β-actinF1, β-actinF2, β-actinR1, and β-actinR2 were gene specific, and these primers were denoted at the end by either ‘R’ or ‘F’ to indicate reverse or forward primers respectively. Oligonucleotides GR3P and GR3NP were adapter primers for the 3′RACE, and oligonucleotide GR5P and GR5NP were adapter primers for the 5′RACE. Oligonucleotides β-actinF1, β-actinF2, β-actinR1, and β-actinR2 were designed according to ricefield eel β-actin (AY647143), and LHF1 and LHR1 according to ricefield eel luteinizing hormone (LH) β-subunit (lhb, EU840258).

Table 1

Sequences of oligonucleotide primers used

Sequence (5′–3′)
Primer name
CYP19F1WCSGCRTGCAACTAGTACAA
CYP19R1CATCTCCARCACRCACTG
CYP19R2GGCTGGAAMWAACGWCKVGG
CYP19A2R1CTGTCTGCCAGGTCTCAAAGTA
CYP19A2R2CGTGTCCAGAGGGAGCAGTC
CYP19A2F1GGAGGATGATCTTGACTTTG
CYP19A2F2CTAATCTTTGCCCAGAACCACGG
CYP19A1R1GTAGTTGCTGGCTGTGCCTAT
CYP19A1R2GCAGACGAGCAGCATCAAGG
CYP19A1F1CGCCGTTACTTCCAGCCATTC
CYP19A1F2ACTGCCTCCCACAGACCAACA
GR5PCGACTGGAGCACGAGGACACTGA
GR5NPGGACACTGACATGGACTGAAGGAGTA
GR3PGCTGTCAACGATACGCTACGTAACG
GR3NPCGCTACGTAACGGCATGACAGTG
CYP19A1F3CGCTTGGACCGTTCATTAGGC
CYP19A1F4TCACCTAGACGACCTGGACAAT
CYP19A1F5CGGACACTTTATCCATCAGCCTC
CYP19A1R4CACAACAGTGTCAATTTCCT
CYP19A1R5GCTCAGAGTGTTTGACAGCTACC
CYP19A2F3TCAGTGGAAGTGCTGATCGTCT
CYP19A2F4GAGTGTATTGGGATGGAAGGAA
CYP19A2F5AGAGTTGAAGATAGTGGAGGAG
CYP19A2R3CTGTCTGCCAGGTCTCAAAGTA
CYP19A2R4TAGCCTTCAAAGACTGAAACTG
CYP19A2R5CACTATATTTCAGAGCTGACTGG
CYP19A1F6CATACTCAGCAGGTCATCAGCG
CYP19A1R6TCTCATTGACAGGTACACCA
CYP19A2F6CAGAGGACAGTGGCGATCTGTG
CYP19A2R6CATTGAGTGGCACCCTGAGGAA
LHF1TCCTGGTGTGGACCCGACT
LHR1CGTTATGCTGCTATTTGTGG
β-actinF1 CGTACCACCGGAATTGTCA
β-actinR1 GTACCACCAGACAGCACAG
β-actinF2GCGTGACATCAAGGAGAAGC
β-actinR2CTCTGGGCAACGGAACCTCT

Cloning of cyp19a1a and cyp19a1b cDNAs

The initial fragments of cyp19a1a and cyp19a1b cDNAs were amplified with PCR from brain and ovary cDNAs respectively. The primers were CYP19F1 and CYP19R1 for cyp19a1a cDNA, and CYP19F1 and CYP19R2 for cyp19a1b cDNA. The brain and ovary cDNAs were transcribed from ricefield eel brain and ovary total RNA respectively, by ThermoScript RT System (Invitrogen) according to the manufacturer's instructions. PCR was performed in 25 μl final volume containing 2.5 μl 10× Ex Taq buffer, 2.5 mM MgCl2, 0.2 mM dNTP, 0.4 μM of each primer, and 1.25 U TaKaRa Ex Taq DNA Polymerase (TaKaRa, DaLian, China) and 0.5 μl of brain or ovary cDNA. After an initial 3-min denaturing step at 94 °C, 35 cycles of amplification were performed for 0.5 min at 94 °C, 0.5 min at 55 °C, and 1.5 min at 72 °C, and then followed by a final extension for 7 min at 72 °C. The target PCR products were gel purified using Gel Extraction System (Omega, USA) and cloned into pGEM-T Easy Vector (Promega). The plasmid DNA was sequenced with forward and reverse universal primers using the BigDye Terminator kit and an ABI Prism 3730 DNA sequencer (Perkin–Elmer, Wellesley, MA, USA).

After determining the nucleotide sequences of the initial fragments of the cyp19a1a and cyp19a1b cDNAs, we used the GeneRacer kit (Invitrogen) to isolate their 5′- and 3′-ends according to the manufacturer's instructions. The oligonucleotides were CYP19A1F1 and CYP19A1F2 for 3′RACE, and CYP19A1R1 and CYP19A1R2 for 5′RACE of cyp19a1a; CYP19A2F1 and CYP19A2F2 for 3′RACE, and CYP19A2R1 and CYP19A2R2 for 5′RACE of cyp19a1b. The PCR products were cloned into pGEM-T Easy Vector (Promega) and sequenced as described previously. The full-length cDNA sequences were obtained by combining the 3′- and 5′-end sequences.

Cloning of cyp19a1a and cyp19a1b genes

Genomic DNA was extracted from the liver of the female ricefield eel by phenol/chloroform method. About 100 ng of genomic DNA was subjected to PCR with three sets of primer pair CYP19A1F3 and CYP19A1R3, CYP19A1F4 and CYP19A1R4, and CYP19A1F5 and CYP19A1R5 for cyp19a1a gene, and another three sets of primer pair CYP19A2F3 and CYP19A2R3, CYP19A2F4 and CYP19A2R4, and CYP19A2F5 and CYP19A2R5 for cyp19a1b gene. These primers were designed according to the cDNA sequences of CYP19. The PCR products were cloned and their sequences were determined and combined to obtain the genomic DNA sequences containing the full coding regions of cyp19a1a (EU841366) and cyp19a1b (EU840259) respectively.

Sequence analysis

The deduced amino acid sequences of the ricefield eel cyp19a1a and cyp19a1b were compared with previously published sequences of some representative vertebrates. The percentage identity of amino acid sequences was calculated using the Megalign of the DNAstar software package (DNASTAR, Inc., Madison, WI, USA). The alignment of amino acids sequences were performed using the ClutalX1.81 software (Plate-Forme de Bio-Informatique, Illkirch Cedex, France). The phylogenetic tree was generated by the maximum parsimony method of PHYLIP software package (http://evolution.genetics.washington.edu/phylip.html) and visualized by TREEVIEW1.5 (Eisen M; http://rana.lbl.gov/eisen/?page-id=42). The bootstrap values were estimated by 1000 replications and given at each branch point.

The intron–exon boundaries as well as the intron sequences of the ricefield eel cyp19a1a and cyp19a1b were determined by comparing the genomic sequences and the cDNA sequences.

Northern blot analysis

Total RNA (30 μg) isolated from the hypothalamus, ovary, and liver of the female ricefield eel at stage MLV was size separated on a 1.5% formaldehyde agarose gel and transferred to a nylon membrane (Hybond-N+, Amersham Biosciences). The hybridization probes were a 1065 bp cDNA fragment for cyp19a1a (nt: 312–1376), and a 728 bp cDNA fragment for cyp19a1b (nt: 18–745). All probes were randomly labeled with [α-32P]dCTP using the Random Primer DNA Labeling kit (TaKaRa). Hybridization was performed using the Northern Max kit (Ambion, Austin, TX, USA). The membrane was hybridized overnight at 50 °C with the 32P-labeled cyp19a1b probe, washed twice with low stringency wash solution (equal to 2×SSC, 0.1% SDS) at 50 °C for 10 min, twice with high stringency wash solution (equal to 0.1×SSC, 0.1% SDS) at 50 °C for 15 min, and then exposed to a phosphor storage screen and visualized with a Typhoon 8600 Variable Mode Imager (Molecular Dynamics, Sunnyvale, CA, USA). The blot was then stripped with boiling solution (0.1% SDS), and the removal of the radioactive cyp19a1b probe was verified by exposing the stripped blot to the phosphor storage screen. After stripping, the same membrane was hybridized overnight at 50 °C with the 32P-labeled cyp19a1a probe, washed and exposed as described for cyp19a1b.

RT-PCR coupled with Southern blot analysis of tissue patterns of CYP19 mRNA expression

Total RNA (2 μg) isolated from different tissues of female (stage EV) or male ricefield eel was first treated with DNase I (Invitrogen, Amplification Grade, CA, USA) to remove any genomic DNA contamination. The RNA was then reverse transcribed using oligo(dT) primer and ThermoScript RT-PCR System (Invitrogen) according to the manufacturer's instructions. The integrity of all RNA samples was verified by the successful amplification of β-actin.

The first-strand reaction (0.5 μl) was amplified for each target gene using the Biometra TGRADIENT thermal cycler. PCR was performed in 15 μl final volume containing 1.5 μl 10× reaction buffer, 1.5 mM MgCl2, 0.2 mM dNTP, 0.2 μM of each primer, and 1.0 U Platinum Taq DNA Polymerase (Invitrogen). Water was used as a negative control in the RT-PCR. To detect mRNA expression in various tissues, the reaction mixture was heated at 94 °C for 2 min, followed by 34 cycles of amplification for CYP19, and 28 cycles for β-actin. The primers were CYP19A1F6 and CYP19A1R6 for cyp19a1a, CYP19A2F6 and CYP19A2R6 for cyp19a1b, and β-actinF1 and β-actinR1 for β-actin, which generated PCR products of 335, 157, and 484 bp respectively. The PCR products were separated on a 1.5% agarose gel and transferred onto a nylon membrane by the capillary method. The membrane was hybridized overnight at 48 °C with the same probes as used for the northern blot, followed by washing twice with low stringency wash solution at 48 °C for 10 min, with high stringency wash solution twice at 48 °C for 15 min, and then exposed to a phosphor storage screen and visualized with a Typhoon 8600 Variable Mode Imager (Molecular Dynamics). These experiments were repeated twice using samples from different individual fish at the same sexual stage, and similar results were obtained.

In vitro incubation of pituitary glands with E2

The pituitary glands of the female ricefield eel (OM stage) were dissected and washed in M199 media (Sigma) on ice. Approximately five pituitary glands were placed in a 24-well tissue culture dish with 1 ml of M199 media (Sigma) containing 0.1 U/ml penicillin (Gibco) and 0.1 μg/ml streptomycin (Gibco), and then incubated at 25 °C in a humidified incubator under 5% CO2. E2 stock solutions were prepared in 100% ethanol at concentrations 103-fold higher than the final. After pre-incubation for about 6h, the pituitary glands were treated with E2 (1, 10, and 100 nM) or ethanol (0.1%, control group) for 24 h. Three replicates were made for each treatment. After completion of incubation, the pituitary glands were collected and total RNA were extracted with TRIzol reagent (Invitrogen) for real-time quantitative RT-PCR analysis of lhb mRNA expression.

Real-time quantitative PCR analysis of CYP19 and lhb mRNA expression

Real-time PCR analysis was established to quantify the mRNA expression levels of cyp19a1b in the brain and pituitary gland, and cyp19a1a in the ovary of the ricefield eel during ovarian development and sex change. The primers for real-time PCR analysis were CYP19A1F6 and CYP19A1R6 for cyp19a1a, CYP19A2F6 and CYP19A2R6 for cyp19a1b, LHF1 and LHR1 for lhb and β-actinF2 and β-actinR2 for β-actin.

The real-time PCR was performed on the Rotor-Gene 3000 detection system (Corbett Research, Sydney, Australia) in a volume of 20 μl containing 0.2 μM of each primer, 10 μl of 2×SYBR Green Master Mix (TOYOBO, Osaka, Japan), l μl of cDNA template which was transcribed from 1 μg total RNA using ThermoScript RT-PCR System (Invitrogen). The PCR cycling conditions were: 95 °C for 1 min; 40 cycles of 95 °C for 15 s, 55 °C for 15 s, 72 °C for 45 s; 85 °C for 20 s for signal collection in each cycle. To assess the specificity of the PCR amplification, a melt-curve analysis was performed at the end of the reaction by increasing temperature from 55 to 99 °C and held for 5 s at every increment of 1 °C, and a single peak was observed. Data were produced by the Rotor-gene version 6-0-22 software. Products were also visualized on an ethidium bromide-stained agarose gel, and a single band confirmed the specificity of the PCR amplification. Finally, PCR products were cloned and sequenced to further confirm their authenticities as gene-specific amplicons.

The quantification of the mRNA expression level was performed using a standard curve with tenfold serial of dilution of plasmid containing corresponding DNA fragments from 101 to 108 copies. The correlation coefficients and PCR efficiencies were not less than 0.997 and 80% respectively. To minimize variation due to the differences in RNA loading, each sample was normalized to the expression level of the house keeping gene β-actin, and the mRNA expression levels of target genes were presented as the copy number ratios to β-actin.

Statistical analysis

All data are presented as means±s.e.m. The statistical significant differences were analyzed by one-way ANOVA followed by the Duncan's multiple range test using the SPSS software package (SPSS, Inc., Chicago, IL, USA). Significance was set at P<0.05.

Results

Nucleotide and deduced amino acid sequences of cyp19a1a and cyp19a1b

The full-length cyp19a1a cDNA sequence (EU252487) obtained from the ricefield eel ovary consisted of 1828 bp including the poly (A) tail. This sequence included an open reading frame (ORF) of 1557 bp, a 54 bp 5′untranslated region (UTR) and a 199 bp 3′UTR. The ORF encoded a putative protein of 518 amino acids with a calculated molecular mass of about 58.3 kDa. The putative polyadenylation signal TATAAA was located 15 bases upstream the poly (A) tail.

The full-length cyp19a1b cDNA sequence (EU252488) obtained from the ricefield eel brain consisted of 2268 bp including the poly (A) tail. This sequence included an ORF of 1506 bp, a 215 bp 5′UTR and a 532 bp 3′UTR. The ORF encoded a putative protein of 501 amino acids with a calculated molecular mass of 56.6 kDa. The putative polyadenylation signal ATTAAA was located 12 bases upstream the poly (A) tail.

Amino acid sequence comparison

The deduced amino acid sequences of the ricefield eel cyp19a1a and cyp19a1b were aligned with other vertebrate CYP19 homologues (Fig. 1). Both cyp19a1a and cyp19a1b of the ricefield eel had the conserved putative function domains, namely the membrane spanning region, I-helix region, Ozol's peptide region, aromatase-specific region, and heme-binding region. The two ricefield eel CYP19 forms shared only 62.5% of overall amino acid sequence identity (Tables 2 and 3), but each isoform was 87.6 and 80.4% identical with the corresponding A1- or A2-isoform of grouper, a perciform fish, and around 64% with those of zebrafish, a cypriniform fish. The two ricefield eel CYP19 forms shared low but similar degrees of overall sequence identities with frog, Pleurodeles, chicken, mouse, and human CYP19 (49.9–55.4%), but high identities were evident in the putative function domains of all vertebrate CYP19.

Figure 1
Figure 1Figure 1Figure 1

Alignment (by ClustalX1.8) of ricefield eel cyp19a1a and cyp19a1b amino acid sequences with other vertebrate CYP19 forms. The identical, highly conserved, and less conserved amino acid residues were indicated by (*), (:), and (.) respectively. Regions of putative functional domains were in gray box and indicated by roman numerals and overlines with arrowheads (I, the membrane-spanning region; II, the I-helix region; III, Ozol's peptide region; IV, the aromatic region; V, the heme-binding region). The protein sequences were downloaded from Entrez (NCBI). For details, please refer to Fig. 2.

Citation: Journal of Endocrinology 199, 2; 10.1677/JOE-08-0303

Figure 2
Figure 2

Phylogenetic analysis of vertebrate CYP19. The phylogenetic tree was generated by the maximum parsimony method of PHYLIP software package and visually depicted by TREEVIEW1.5. The CYP19 from Drosophila melanogaster (CAA80549) served as an outgroup to root the tree. The bootstrap values (%) were given at each branch point. The protein sequences were downloaded from Entrez (NCBI).

Citation: Journal of Endocrinology 199, 2; 10.1677/JOE-08-0303

Table 2

Percent of overall and partial identities of the predicted amino acid sequence of cyp19a1b compared with CYP19 isolated from other vertebrates. The identity was calculated using MegAlign of DNAstar software package.

Overall identityMembrane spanning domainI-helix regionOzol's peptide regionAromatic regionHeme-binding region
Ricefield eel/A162.546.282.965.266.791.7
Grouper/A162.930.086.069.666.791.7
Grouper/A280.469.282.978.391.791.7
Zebrafish/A162.138.585.760.966.787.5
Zebrafish/A263.553.882.973.975.087.5
Frog53.430.868.669.675.079.2
Pleurodeles53.335.771.469.683.375.0
Chicken52.130.865.765.283.387.5
Mouse49.946.257.173.975.075.0
Human51.138.562.969.675.083.3
Table 3

Percent of overall and partial identities of the predicted amino acid sequence of cyp19a1a compared with CYP19 isolated from other vertebrates. The identity was calculated with MegAlign of DNAstar software package.

Overall identityMembrane spanning domainI-helix regionOzol's peptide regionAromatic regionHeme-binding region
Ricefield eel/A262.546.282.965.266.791.7
Grouper/A187.668.894.395.783.3100
Grouper/A261.150.088.678.366.783.3
Zebrafish/A164.046.797.178.366.795.8
Zebrafish/A258.726.788.678.383.379.2
Frog55.426.771.456.583.383.3
Pleurodeles52.550.065.756.583.370.8
Chicken51.940.068.647.883.383.3
Mouse51.740.062.960.983.375.0
Human52.340.065.760.983.379.2

Phylogenetic analysis

A phylogenetic tree of vertebrate CYP19 proteins (Fig. 2) was constructed by the maximum parsimony method of PHYLIP software package. This phylogenetic tree clearly segregated vertebrate CYP19 proteins into three branches, namely a teleost cyp19a1a branch, a teleost cyp19a1b branch, and a tetrapod CYP19 branch. The ricefield eel cyp19a1a and cyp19a1b belonged to the teleost cyp19a1a and cyp19a1b branches respectively, and were most closely related to the corresponding CYP19 isoforms of perciform fish.

Genomic organization of cyp19a1a and cyp19a1b genes

The ricefield eel cyp19a1a gene consisted of nine exons and eight introns, and cyp19a1b gene consisted of ten exons and nine introns (Fig. 3). Most of the intron–exon boundaries follow the consensus sequence of GT/AG for splicing donor and acceptor sites, except three in cyp19a1b gene. The genomic structures of the ricefield eel cyp19a1a and cyp19a1b gene were almost the same as those of tilapia, and also conserved when compared with those of zebrafish (Fig. 3). The initiation codon was located in the exon1 for cyp19a1a, and in the exon2 for cyp19a1b, which is also conserved among these fish.

Figure 3
Figure 3

The schematic showing the relative positions of introns and exons of teleost CYP19 genes. The exons are boxed and indicated by roman numerals at the bottom, and the introns are depicted by lines. The translated exons are shaded. The genomic structure was determined by comparing the sequences of the corresponding cDNA and genomic DNA, and the sequences of tilapia and zebrafish were downloaded from Entrez (NCBI): Nile tilapia cyp19a1a gene (AF472620) and cDNA(U72071), Nile tilapia cyp19a1b gene (AF472621) and cDNA(AF295761); Zebrafish cyp19a1a gene (NM131154) and cDNA(NC007129), Zebrafish cyp19a1b gene (NM131642) and cDNA(NC007136).

Citation: Journal of Endocrinology 199, 2; 10.1677/JOE-08-0303

Tissue-specific and sexual dimorphic expression of cyp19a1a and cyp19a1b genes

With northern blot analysis (Fig. 4), the expression of cyp19a1a was detected in the ovary but not in the hypothalamus and liver, while the expression of cyp19a1b was detected in the hypothalamus but not in the ovary and liver of the female ricefield eel. The tissue patterns of cyp19a1a and cyp19a1b mRNA expression were further analyzed in both the female and male ricefield eel with RT-PCR coupled with Southern blot (Fig. 5). The cyp19a1a was expressed predominantly in the gonads of both sexes, and gel image indicated that the expression level in the ovary was higher than that in the testis. The expression of cyp19a1a gene was detected at very low levels in the olfactory bulb and telencephalon of the female, and in the pituitary and optic tectum-thalamus of the male, but no signals were detected in other tissues examined in both sexes.

Figure 4
Figure 4

Northern blot analysis of cyp19a1a and cyp19a1b mRNA. Total RNA (30 μg) from the hypothalamus (Hy), ovary (Ov), and liver (Li) of female ricefield eel was separated on a 1% agarose gel (A), and hybridized with a cyp19a1a cDNA probe (B), or with a cyp19a1b cDNA probe (C) randomly labeled with [α-32P]dCTP. The positions of 18S and 28S RNA were indicated by arrows and used as markers.

Citation: Journal of Endocrinology 199, 2; 10.1677/JOE-08-0303

Figure 5
Figure 5

Tissue distribution of cyp19a1a and cyp19a1b in the female (A) and male (B) ricefield eel as analyzed by RT-PCR coupled with Southern blot. Ob, olfactory bulb; Te, telencephalon; Hy, hypothalamus; Ot, optic tectum-thalamus; Ce, cerebellum; Mo, medulla oblongata; Pi, pituitary; Ov, ovary; Ts, testis; Mu, muscle; Sp, spleen; Pa, pancreas; He, heart; Li, liver; Ki, kidney; In, intestines; Bl, blood; RT−, RT minus; NC, negative control.

Citation: Journal of Endocrinology 199, 2; 10.1677/JOE-08-0303

The cyp19a1b was expressed in all the tissues examined in males, but only in the brain and pituitary in females. In the male, expression of cyp19a1b was detected at higher levels in the olfactory bulb, telencephalon, hypothalamus, optic tectum-thalamus, medulla oblongata, and pituitary, but at lower levels in the cerebellum, testis, spleen, pancreas, heart, liver, and kidney, and at very low levels in the muscle, intestines, and blood. In the female, expression of cyp19a1b was detected at higher levels in the telencephalon, hypothalamus, optic tectum-thalamus, and pituitary, and at lower levels in the olfactory bulb, cerebellum, and medulla oblongata, but barely detectable or undetectable in other tissues.

mRNA expression of cyp19a1a and cyp19a1b during ovarian development

Real-time PCR analysis was employed to quantify the mRNA expression levels of cyp19a1a in the ovary, and cyp19a1b in the hypothalamus (including optic tectum-thalamus) and pituitary during ovarian development (Fig. 6). In the ovary, the relative mRNA levels of cyp19a1a were low at PV and EV stages, but increased significantly at the vitellogenic stage, and then decreased significantly at mature stage. In the hypothalamus, the relative mRNA levels of cyp19a1b were maintained at similar levels from previtellogenic to vitellogenic stages, but decreased significantly when oocytes became mature. In the pituitary, the relative mRNA levels of cyp19a1b were also maintained at similar levels from previtellogenic to vitellogenic stages, but increased significantly when oocytes get mature.

Figure 6
Figure 6

Relative mRNA levels of CYP19 in the ricefield eel during ovarian development. (A) cyp19a1a in the ovary; (B) cyp19a1b in the hypothalamus (including optic tectum-thalamus); and (C) cyp19a1b in the pituitary. PV, previtellogenic stage; EV, early vitellogenic stage; MLV, mid- to late-vitellogenic stage; OM, oocyte at mature stage. The mRNA expression levels of CYP19 were determined by real-time RT-PCR. Each bar represents the mean of normalized expression levels of replicates (n=5). Means marked with different letters are significantly different (P<0.05).

Citation: Journal of Endocrinology 199, 2; 10.1677/JOE-08-0303

To examine the possible hypophyseal effects of locally produced estrogens on lhb mRNA expression the in vitro incubated pituitary glands of mature female ricefield eel were treated with E2 of different concentrations. Results showed that E2 greatly stimulated hypophyseal lhb mRNA expression in a dose-dependant manner (Fig. 7). The expression level was increased about fourfold at a lower concentration (1 nM), and about six- to sevenfold at higher concentrations (10 and 100 nM).

Figure 7
Figure 7

The effects of E2 on lhb mRNA expression in the in vitro incubated pituitary of ricefield eel. The pituitary glands were taken from mature female ricefield eel and incubated for 24 h in the presence or absence (control, containing 0.1% ethanol) of E2 (concentration at 1, 10, and 100 nM). The mRNA expression levels of lhb were determined by real-time RT-PCR. Each bar represents the mean of normalized expression levels of replicates (n=3). Means marked with different letters are significantly different (P<0.05).

Citation: Journal of Endocrinology 199, 2; 10.1677/JOE-08-0303

mRNA expression of cyp19a1a and cyp19a1b during natural sex change

The relative mRNA expression levels of cyp19a1a in the gonad, and cyp19a1b in the hypothalamus and pituitary during natural sex change were also determined with real-time PCR analysis (Fig. 8). In the gonad, the expression levels of cyp19a1a were decreased continuously and significantly from female phase, through intersexual phases, to male phase. In the hypothalamus, the mRNA expression levels of cyp19a1b peaked at the IE phase, but there were no significant differences among other phases. In the pituitary, the relative mRNA expression levels of cyp19a1b were significantly decreased at the intersexual phases, but increased significantly at the male phase when compared with the intersexual phase. However, the expression level of cyp19a1b at the male phase was still significantly lower than that at the female phase.

Figure 8
Figure 8

Relative mRNA levels of CYP19 in the ricefield eel during the natural sex change. (A) cyp19a1a in the gonad; (B) cyp19a1b in the hypothalamus; and (C) cyp19a1b in the pituitary. F, the female stage; IE, the early intersexual stage; IM, the middle intersexual stage; IL, the late intersexual stage; M, the male stage. The mRNA expression levels of CYP19 were determined by real-time RT-PCR. Each bar represents the mean of normalized expression levels of replicates (n=4–5). Means marked with different letters are significantly different (P<0.05).

Citation: Journal of Endocrinology 199, 2; 10.1677/JOE-08-0303

Discussion

Our present study identified cDNAs encoding two different cytochrome P450 aromatases, namely cyp19a1a and cyp19a1b, in the ricefield eel, which concurs with the fact that most teleosts have two CYP19 genes, namely cyp19a1a and cyp19a1b (Piferrer & Blázquez 2005), and contradicts the previous report of only one form of CYP19 gene in this fish (Yu et al. 2008). The cyp19a1a identified in the present study shared 97.8% homology at the nucleotide level and 97.7% homology at the amino acid level with the previously reported one (Yu et al. 2008), having a total of 46 different nucleotides and 12 different amino acids, and these sequence differences could be probably due to the different geographical populations of the fish used, South China (Guangdong) in the present study and East China (Jiangsu) in the previous study. Phylogenetic analysis showed that the ricefield eel cyp19a1a and cyp19a1b were clustered with teleost cyp19a1a and cyp19a1b respectively. Multiple amino acid sequence alignments showed that both CYP19 proteins contained the putative functional domains as other vertebrate CYP19, including the membrane-spanning region, I-helix region, Ozol's peptide region, the aromatic region, and the heme-binding region. As in the orange-spotted grouper (Zhang et al. 2004), the homology between the two forms of ricefield eel CYP19 was lower than the homology of each isoform with the corresponding forms of other teleosts. The two forms of ricefield eel CYP19 were more closely related to the corresponding forms of perciform fishes, conforming to the lineage relationship.

The presence of two CYP19 genes in the ricefield eel was further confirmed by the isolation of corresponding genomic DNA sequences. In contrast to seven introns in cyp19a1a gene reported previously (Yu et al. 2008), our present results showed that the genomic structures of CYP19 genes in the ricefield eel are well conserved when compared with other teleost fishes including tilapia and zebrafish, namely eight introns and nine exons in cyp19a1a, and nine introns and ten exons in cyp19a1b. The genomic structures of ricefield eel cyp19 genes in the present study were further confirmed by the cloning of cyp19 genes from the fish caught in the wild of Taishan, Guangdong Province, and cultured in Hunan Province of P R China (data not shown).

It has been shown that two cyp19 genes in teleosts were differentially expressed, with cyp19a1a mainly expressed in the ovary and cyp19a1b in the brain (Zhang et al. 2004, Piferrer & Blázquez 2005). Similarly, northern blot detected the expression of cyp19a1b in the hypothalamus rather than the ovary and liver, and the expression of cyp19a1a in the ovary rather than the brain, suggesting that two cyp19 genes of the ricefield eel were also differentially expressed in these tissues. Interestingly, three transcripts were detected for cyp19a1b in the hypothalamus of the ricefield eel by northern blot, which were about 7.0, 4.0, and 1.7 kb in sizes respectively. In tilapia, two transcripts of 6.2 and 4.4 kb were also detected for cyp19a1b in the brain by northern blot (Chang et al. 2005). However, the biological significances and mechanisms of multiple cyp19a1b transcripts in these fish remain to be elucidated.

The tissue patterns of CYP19 mRNA expression in the ricefield eel were further analyzed by RT-PCR and results showed differential expression of both CYP19 genes in more extensive tissues of both sexes. The mRNA expression of cyp19a1a was primarily restricted to the gonads, with a higher level in the ovary than in the testis as indicated by gel images, but barely detectable or undetectable in the extragonadal tissues examined, which suggests that cyp19a1a may be primarily involved in the gonadal differentiation and development in the ricefield eel. This tissue expression pattern was in striking contrast to what has been reported in the previous study, where the expression of cyp19a1a was not only detected in the gonad, but also in the brain, liver, and pituitary, and even the expression level was higher in the brain than the gonad (Yu et al. 2008). The exact reasons for these discrepancies are not clear at present, which could be due to different genetic backgrounds of this fish from different geographical locations.

In addition to the hypothalamus, cyp19a1b was shown to be abundantly expressed in the pituitary gland, telecephalon, and optic tectum-thalamus of both sexes of the ricefield eel by RT-PCR analysis. This regional expression pattern of cyp19a1b in the brain appeared to be common in the teleost fish (Kazeto & Trant 2005), and was implicated in the control of reproductive activities (González & Piferrer 2003). However, the extraneural expression of cyp19a1b in the ricefield eel exhibited an obvious sexual dimorphism. In the female, the expression of cyp19a1b was not detected in tissues other than the brain and pituitary gland, whereas in the male, the expression of cyp19a1b was detected in all the tissues examined. By contrast, Atlantic halibut cyp19a1b was ubiquitously expressed in the adult male and female without sexual dimorphism (van Nes et al. 2005). Whether the extraneural expression of cyp19a1b in the male ricefield eel is of any physiological relevancy, and how it is regulated remains to be identified.

The mRNA expression of both cyp19a1a and cyp19a1b was detected in the testis of the ricefield eel. Overlapped expression of both CYP19 genes were also observed in the testis of other teleosts, such as zebrafish (Sawyer et al. 2006) and wrasse (Choi et al. 2005). In mammals, it has been shown that estrogen is essential for spermatogenesis and male fertility (O'Donnell et al. 2001, Carreau et al. 2003). It is possible that the expression of CYP19 genes and thus production of estrogen are also important for the reproduction of male teleosts. Consistent with this hypothesis, the expression of estrogen receptors were found in the testis of teleosts, such as rainbow trout (Nagler et al. 2007) and zebrafish (Menuet et al. 2002). The overlapped expression of both CYP19 genes in the testis of the ricefield eel may offer a more refined regulation of testicular estrogen production, and thus male reproductive function.

Real-time PCR analysis showed that the mRNA expression level of cyp19a1a was significantly increased in the ovary of the ricefield eel during vitellogenesis, but then decreased significantly at mature stage. The similar patterns of cyp19a1a expression during oogenesis were also observed in red seabream (Gen et al. 2001) and gobiid fish (Kobayashi et al. 2004). The increase of ovarian cyp19a1a expression during vitellogenesis is in agreement with the role of gonadal estrogen in stimulating the hepatic synthesis of vitellogenin in teleosts (Nagahama 1994). It is generally believed that the maturation of post-vitellogenic oocyte in teleosts is induced by maturation-inducing hormone (MIH), presumably 17α, 20β-dihydroxy-4-pregnane-3-one in some teleosts, and the steroidogenic shift from E2 to 17α, 20β-dihydroxy-4-pregnane-3-one is a prerequisite for the oocyte to undergo maturation (Senthilkumaran et al. 2004). The down-regulation of ovarian cyp19a1a expression in the ricefield eel at the mature stage was in agreement with this steroidogenic shift; however, the mechanism remains to be identified.

It is interesting to note that the expression levels of cyp19a1b in the pituitary was significantly increased at the mature stage when compared with MLV stage in the ricefield eel, suggesting that locally synthesized E2 in the pituitary may play a role in the oocyte final maturation. In catfish, a preovulatory induction of cyp19a1b in the pituitary was also detected, and suggested to be involved in the regulation of lhb subunit expression (Kazeto & Trant 2005). A half-site estrogen response element (ERE) is present in the promoter of lhb subunit (Yaron et al. 2001), and LH was shown to play a central role in the maturation of post-vitellogenic oocytes in lower vertebrates (Nagahama 1997). Based on these lines of evidence, it could be hypothesized that increased expression of cyp19a1b in the pituitary of the ricefield eel at mature stage might raise the local level of E2, which in turn increases the expression of lhb subunit, and LH promotes the final maturation of oocytes. In support of this hypothesis, it was observed that E2 up-regulated hypophyseal lhb subunit mRNA expression dose dependently in vitro in the female ricefield eel.

In the brain, however, the expression levels of cyp19a1b were significantly decreased at the mature stage when compared with MLV stage in the ricefield eel. This is in contrast to what has been reported in catfish, where the transcript abundance of cyp19a1b in the brain was significantly increased at the preovulatory stage (Kazeto & Trant 2005). In the protogynous wrasse, the expression of cyp19a1b in the brain was also gradually increased along reproductive seasons (Choi et al. 2005). It seems that the regulation of cyp19a1b gene in the brain of the ricefield eel is unique when compared with other teleosts. Consistent with this, we have found a mutated ERE (RGATCAnnnTGACCA instead of RGGTCAnnnTGACCY) in the 5′ flanking sequence of the ricefield eel cyp19a1b (unpublished data), while in other teleosts, this ERE site is perfectly conserved (Forlano et al. 2006).

Aromatase has been implicated on sex differentiation in non-mammalian vertebrates, such as fish, amphibians, reptiles, and birds (Piferrer & Blázquez 2005). Inhibition of aromatase activity has been shown to induce sex change from female to male in the protogynous honeycomb grouper (Bhandari et al. 2004, 2005) and the bidirectional sex-changing fish (Kroon et al. 2005). However, it is not clear whether only gonadal aromatase or both gonadal and brain aromatases were involved in these processes. To further clarify the involvement of CYP19 genes in the sex change of fish, the mRNA expression of cyp19a1a in the gonad and cyp19a1b in the brain and pituitary of the ricefield eel during natural sex change was examined using real-time PCR analysis. The gonadal mRNA level of cyp19a1a was continuously decreased from female phase, through intersexual phases, to male phase. These results are in agreement with the changes of gonadal cyp19a1a expression during MT-induced sex change from female to male in the orange-spotted grouper (Zhang et al. 2007), suggesting that the down-regulation of gonadal cyp19a1a gene is involved in the natural sex change of the ricefield eel.

It was demonstrated for the first time that the expression of cyp19a1b in the pituitary varied significantly during natural sex change of the ricefield eel, with highest levels at female phase, lowest levels at intersexual phases. The pituitary is an important component of reproductive endocrine axis in vertebrates and produces two gonadotropins, LH and follicle-stimulating hormone, which play central roles in gonadal development. It has been shown that mammalian LH induces a precocious sex change of the ricefield eel at the postspawning stage (Yeung et al. 1993), suggesting that the pituitary gonadotropins may be involved in the natural sex change of the ricefield eel. As stated above, locally synthesized E2 in the pituitary may regulate the production of LH, and thus may be involved indirectly in the sex change of the ricefield eel. However, the exact roles and mechanisms of locally synthesized E2 in the pituitary of the ricefield eel during sex change need further study.

During the natural sex change of the ricefield eel, the expression levels of cyp19a1b in the hypothalamus peaked at the IE phase. Similarly, a transient increase in the expression level of cyp19a1b gene in the hypothalamus at intersexual phase was also observed during MT-induced sex change of the orange-spotted grouper, a protogynous sex-changing fish (Zhang et al. 2004). In mammals, it has been shown that the conversion of androgens to estrogens in the brain is essential for brain sexual differentiation toward male pattern and activation of male sexual behavior (Lephart 1996, Balthazart & Ball 1998). In male Poecilia reticulate, a teleost fish, inhibition of cytochrome p450 brain aromatase reduced two male-specific sexual behaviors (Hallgren et al. 2006). In this context, it can be hypothesized that the increased expression of cyp19a1b in the hypothalamus at the IE phase may play a role in masculinizing the brain of the ricefield eel during sex change from female to male, which awaits further study.

In summary, cyp19a1a and cyp19a1b were differentially expressed in the gonad and brain of the ricefield eel, and the tissue distribution of cyp19a1b exhibited a novel sexual dimorphism. Both cyp19a1a and cyp19a1b may be involved in the ovarian development and natural sex change of the ricefield eel via the hypothalamus–pituitary–gonadal axis, but their exact roles remain to be identified.

Declaration of interest

The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.

Funding

This work was supported by the Natural Science Foundation of China (30570228 to Lihong Zhang, and 30471346 and 30771651 to Weimin Zhang).

Acknowledgements

We thank Yifan Deng and Jingjing Huang for their assistance in the preparation of tissue samples.

References

  • Balthazart J & Ball GF 1998 New insights into the regulation and function of brain estrogen synthase (aromatase). Trends in Neuroscience 21 243249.

    • Search Google Scholar
    • Export Citation
  • Bhandari RK, Higa M, Nakamura S & Nakamura M 2004 Aromatase inhibitor induces complete sex change in the protogynous honeycomb grouper (Epinephelus merra). Molecular Reproduction and Development 67 303307.

    • Search Google Scholar
    • Export Citation
  • Bhandari RK, Alam MA, Higa M, Soyano K & Nakamura M 2005 Evidence that estrogen regulates the sex change of honeycomb grouper (Epinephelus merra), a protogynous hermaphrodite fish. Journal of Experimental Zoology. Part A, Comparative Experimental Biology 303 497503.

    • Search Google Scholar
    • Export Citation
  • Blázquez M & Piferrer F 2004 Cloning, sequence analysis, tissue distribution, and sex-specific expression of the neural form of P450 aromatase in juvenile sea bass (Dicentrarchus labrax). Molecular and Cellular Endocrinology 219 8394.

    • Search Google Scholar
    • Export Citation
  • Carreau S, Lambard S, Delalande C, Denis-Galeraud I, Bilinska B & Bourguiba S 2003 Aromatase expression and role of estrogens in male gonad: a review. Reproductive Biology and Endocrinology 1 3540.

    • Search Google Scholar
    • Export Citation
  • Chan ST & Phillips JG 1967 The structure of the gonad during natural sex reversal in Monopterus albus ((Pisces: Teleostei). Journal of Zoology 151 129141.

    • Search Google Scholar
    • Export Citation
  • Chan ST, O W-S, Tang F & Lofts B 1972 Biopsy studies on the natural sex reversal in Monopterus albus (Pisces: Teleostei). Journal of Zoology 167 415421.

    • Search Google Scholar
    • Export Citation
  • Chang X, Kobayashi T, Senthilkumaran B, Kobayashi-Kajura H, Sudhakumari CC & Nagahama Y 2005 Two types of aromatase with different encoding genes, tissue distribution and developmental expression in Nile tilapia (Oreochromis niloticus). General and Comparative Endocrinology 141 101115.

    • Search Google Scholar
    • Export Citation
  • Choi I, Troyer DL, Cornwell DL, Kirby-Dobbels KR, Collante WR & Simmen FA 1997 Closely related genes encode developmental and tissue isoforms of porcine cytochrome P450 aromatase. DNA and Cell Biology 16 769777.

    • Search Google Scholar
    • Export Citation
  • Choi JY, Park JG, Jeong HB, Lee YD, Takemura A & Kim SJ 2005 Molecular cloning of cytochrome P450 aromatases in the protogynous wrasse, Halichoeres tenuispinis. Comparative Biochemistry and Physiology. Part B, Biochemistry and Molecular Biology 141 4959.

    • Search Google Scholar
    • Export Citation
  • Devlin RH & Nagahama Y 2002 Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences. Aquaculture 208 191364.

    • Search Google Scholar
    • Export Citation
  • Forlano PM, Schlinger BA & Bass AH 2006 Brain aromatase: new lessons from non-mammalian model systems. Frontiers in Neuroendocrinology 27 247274.

    • Search Google Scholar
    • Export Citation
  • Gen K, Okuzawa K, Kumakura N, Yamaguchi S & Kagawa H 2001 Correlation between messenger RNA expression of cytochrome P450 aromatase and its enzyme activity during oocyte development in the red seabream (Pagrus major). Biology of Reproduction 65 11861194.

    • Search Google Scholar
    • Export Citation
  • González A & Piferrer F 2003 Aromatase activity in the European sea bass (Dicentrarchus labrax L.) brain. Distribution and changes in relation to age, sex, and the annual reproductive cycle. General and Comparative Endocrinology 132 223230.

    • Search Google Scholar
    • Export Citation
  • Graddy LG, Kowalski AA, Simmen FA, Davis SL, Baumgartner WW & Simmen RC 2000 Multiple isoforms of porcine aromatase are encoded by three distinct genes. Journal of Steroid Biochemistry and Molecular Biology 73 4957.

    • Search Google Scholar
    • Export Citation
  • Greytak SR, Champlin D & Callard GV 2005 Isolation and characterization of two cytochrome P450 aromatase forms in killifish (Fundulus heteroclitus): differential expression in fish from polluted and unpolluted environments. Aquatic Toxicology 71 371389.

    • Search Google Scholar
    • Export Citation
  • Guiguen Y, Baroiller JF, Ricordel MJ, Iseki K, Mcmeel OM, Martin SA & Fostier A 1999 Involvement of estrogens in the process of sex differentiation in two fish species: the rainbow trout (Oncorhynchus mykiss) and a tilapia (Oreochromis niloticus). Molecular Reproduction and Development 54 154162.

    • Search Google Scholar
    • Export Citation
  • Hallgren SL, Linderoth M & Olsén KH 2006 Inhibition of cytochrome p450 brain aromatase reduces two male specific sexual behaviours in the male Endler guppy (Poecilia reticulata). General and Comparative Endocrinology 147 323328.

    • Search Google Scholar
    • Export Citation
  • Kazeto Y & Trant JM 2005 Molecular biology of channel catfish brain cytochrome P450 aromatase (CYP19A2): cloning, preovulatory induction of gene expression, hormonal gene regulation and analysis of promoter region. Journal of Molecular Endocrinology 35 571583.

    • Search Google Scholar
    • Export Citation
  • Kishida M & Callard GV 2001 Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology 142 740750.

    • Search Google Scholar
    • Export Citation
  • Kobayashi Y, Kobayashi T, Nakamura M, Sunobe T, Morrey CE, Suzuki N & Nagahama Y 2004 Characterization of two types of cytochrome P450 aromatase in the serial-sex changing gobiid fish, Trimma okinawae. Zoological Science 21 417425.

    • Search Google Scholar
    • Export Citation
  • Kroon FJ & Liley NR 2000 The role of steroid hormones in protogynous sex change in the Blackeye goby, Coryphopterus nicholsii (Teleostei: Gobiidae). General and Comparative Endocrinology 118 273283.

    • Search Google Scholar
    • Export Citation
  • Kroon FJ, Munday PL, Westcott DA, Hobbs JP & Liley NR 2005 Aromatase pathway mediates sex change in each direction. Proceedings. Biological Sciences/The Royal Society 272 13991405.

    • Search Google Scholar
    • Export Citation
  • Kwon JY, McAndrew BJ & Penman DJ 2001 Cloning of brain aromatase gene and expression of brain and ovarian aromatase genes during sexual differentiation in genetic male and female Nile tilapia Oreochromis niloticus. Molecular Reproduction and Development 59 359370.

    • Search Google Scholar
    • Export Citation
  • Lee YH, Lee FY, Yueh WS, Tacon P, Du JL, Chang CN, Jeng SR, Tanaka H & Chang CF 2000 Profiles of gonadal development, sex steroids, aromatase activity, and gonadotropin II in the controlled sex change of protandrous black porgy, Acanthopagrus schlegeli Bleeker. General and Comparative Endocrinology 119 111120.

    • Search Google Scholar
    • Export Citation
  • Lee YH, Du JL, Yueh WS, Lin BY, Huang JD, Lee CY, Lee MF, Lau EL, Lee FY, Morrey C, Nagahama Y & Chang CF 2001 Sex change in the protandrous black porgy, Acanthopagrus schlegeli: a review in gonadal development, estradiol, estrogen receptor, aromatase activity and gonadotropin. Journal of Experimental Zoology 290 715726.

    • Search Google Scholar
    • Export Citation
  • Lephart ED 1996 A review of brain aromatase cytochrome P450. Brain Research. Brain Research Reviews 22 126.

  • Menuet A, Pellegrini E, Anglade I, Blaise O, Laudet V, Kah O & Pakdel F 2002 Molecular characterization of three estrogen receptor forms in zebrafish: binding characteristics, transactivation properties, and tissue distributions. Biology of Reproduction 66 18811892.

    • Search Google Scholar
    • Export Citation
  • Nagahama Y 1994 Endocrine regulation of gametogenesis in fish. International Journal of Developmental Biology 38 217219.

  • Nagahama Y 1997 17-alpha, 20 beta-dihydroxy-4-pregnen-3-one, a maturation- inducing hormone in fish oocytes: mechanisms of synthesis and action. Steroids 62 190196.

    • Search Google Scholar
    • Export Citation
  • Nagler JJ, Cavileer T, Sullivan J, Cyr DG & Rexroad C III 2007 The complete nuclear estrogen receptor family in the rainbow trout: discovery of the novel ERalpha2 and both ERbeta isoforms. Gene 392 164173.

    • Search Google Scholar
    • Export Citation
  • van Nes S, Moe M & Andersen Ø 2005 Molecular characterization and expression of two cyp19 (P450 aromatase) genes in embryos, larvae, and adults of Atlantic halibut (Hippoglossus hippoglossus). Molecular Reproduction and Development 72 437449.

    • Search Google Scholar
    • Export Citation
  • O'Donnell L, Robertson KM, Jones ME & Simpson ER 2001 Estrogen and spermatogenesis. Endocrine Reviews 22 289318.

  • Piferrer F & Blázquez M 2005 Aromatase distribution and regulation in fish. Fish Physiology and Biochemistry 31 215226.

  • Sawyer SJ, Gerstner KA & Callard GV 2006 Real-time PCR analysis of cytochrome P450 aromatase expression in zebrafish: gene specific tissue distribution, sex differences, developmental programming, and estrogen regulation. General and Comparative Endocrinology 147 108117.

    • Search Google Scholar
    • Export Citation
  • Senthilkumaran B, Yoshikuni M & Nagahama Y 2004 A shift in steroidogenesis occurring in ovarian follicles prior to oocyte maturation. Molecular and Cellular Endocrinology 215 1118.

    • Search Google Scholar
    • Export Citation
  • Simpson ER 2003 Sources of estrogen and their importance. Journal of Steroid Biochemistry and Molecular Biology 86 225230.

  • Tanaka M, Telecky TM, Fukada S, Adachi S, Chen S & Nagahama Y 1992 Cloning and sequence analysis of the cDNA encoding P-450 aromatase (P450arom) from a rainbow trout (Oncorhynchus mykiss) ovary; relationship between the amount of P450arom mRNA and the production of oestradiol-17 beta in the ovary. Journal of Molecular Endocrinology 8 5361.

    • Search Google Scholar
    • Export Citation
  • Tchoudakova A & Callard GV 1998 Identification of multiple CYP19 genes encoding different cytochrome P450 aromatase isozymes in brain and ovary. Endocrinology 139 21792189.

    • Search Google Scholar
    • Export Citation
  • Valle LD, Ramina A, Vianello S, Belvedere P & Colombo L 2002 Cloning of two mRNA variants of brain aromatase cytochrome P450 in rainbow trout (Oncorhynchus mykiss Walbaum). Journal of Steroid Biochemistry and Molecular Biology 82 1932.

    • Search Google Scholar
    • Export Citation
  • Wong TT, Ijiri S & Zohar Y 2006 Molecular biology of ovarian aromatase in sex reversal: complementary DNA and 5′-flanking region isolation and differential expression of ovarian aromatase in the gilthead seabream (Sparus aurata). Biology of Reproduction 74 857864.

    • Search Google Scholar
    • Export Citation
  • Yaron Z, Gur G, Melamed P, Rosenfeld H, Levavi-Sivan B & Elizur A 2001 Regulation of gonadotropin subunit genes in tilapia. Comparative Biochemistry and Physiology. Part B, Biochemistry and Molecular Biology 129 489502.

    • Search Google Scholar
    • Export Citation
  • Ye D, Lv D, Song P, Peng M, Chen Y, Guo M, Yang Q & Hu Y 2007 Cloning and characterization of a rice field eel vasa-like gene cDNA and its expression in gonads during natural sex transformation. Biochemical Genetics 45 211224.

    • Search Google Scholar
    • Export Citation
  • Yeung WS, Chen H & Chan ST 1993 Effects of LH and LHRH-analog on gonadal development and in vitro steroidogenesis in the protogynous Monopterus albus. General and Comparative Endocrinology 89 323332.

    • Search Google Scholar
    • Export Citation
  • Yu JH, Tang YK & Li JL 2008 Cloning, structure, and expression pattern of the P-450 aromatase gene in rice field eel (Monopterus albus). Biochemical Genetics 46 267280.

    • Search Google Scholar
    • Export Citation
  • Zhang Y, Zhang W, Zhang L, Zhu T, Tian J, Li X & Lin H 2004 Two distinct cytochrome P450 aromatases in the orange-spotted grouper (Epinephelus coioides): cDNA cloning and differential mRNA expression. Journal of Steroid Biochemistry and Molecular Biology 92 3950.

    • Search Google Scholar
    • Export Citation
  • Zhang W, Zhang Y, Zhang L, Zhao H, Li X, Huang H & Lin H 2007 The mRNA expression of P450 aromatase, gonadotropin beta-subunits and FTZ-F1 in the orange-spotted grouper (Epinephelus coioides) during 17 alpha-methyltestosterone -induced precocious sex change. Molecular Reproduction and Development 74 665673.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 492 99 3
PDF Downloads 625 50 1
  • View in gallery View in gallery View in gallery

    Alignment (by ClustalX1.8) of ricefield eel cyp19a1a and cyp19a1b amino acid sequences with other vertebrate CYP19 forms. The identical, highly conserved, and less conserved amino acid residues were indicated by (*), (:), and (.) respectively. Regions of putative functional domains were in gray box and indicated by roman numerals and overlines with arrowheads (I, the membrane-spanning region; II, the I-helix region; III, Ozol's peptide region; IV, the aromatic region; V, the heme-binding region). The protein sequences were downloaded from Entrez (NCBI). For details, please refer to Fig. 2.

  • View in gallery

    Phylogenetic analysis of vertebrate CYP19. The phylogenetic tree was generated by the maximum parsimony method of PHYLIP software package and visually depicted by TREEVIEW1.5. The CYP19 from Drosophila melanogaster (CAA80549) served as an outgroup to root the tree. The bootstrap values (%) were given at each branch point. The protein sequences were downloaded from Entrez (NCBI).

  • View in gallery

    The schematic showing the relative positions of introns and exons of teleost CYP19 genes. The exons are boxed and indicated by roman numerals at the bottom, and the introns are depicted by lines. The translated exons are shaded. The genomic structure was determined by comparing the sequences of the corresponding cDNA and genomic DNA, and the sequences of tilapia and zebrafish were downloaded from Entrez (NCBI): Nile tilapia cyp19a1a gene (AF472620) and cDNA(U72071), Nile tilapia cyp19a1b gene (AF472621) and cDNA(AF295761); Zebrafish cyp19a1a gene (NM131154) and cDNA(NC007129), Zebrafish cyp19a1b gene (NM131642) and cDNA(NC007136).

  • View in gallery

    Northern blot analysis of cyp19a1a and cyp19a1b mRNA. Total RNA (30 μg) from the hypothalamus (Hy), ovary (Ov), and liver (Li) of female ricefield eel was separated on a 1% agarose gel (A), and hybridized with a cyp19a1a cDNA probe (B), or with a cyp19a1b cDNA probe (C) randomly labeled with [α-32P]dCTP. The positions of 18S and 28S RNA were indicated by arrows and used as markers.

  • View in gallery

    Tissue distribution of cyp19a1a and cyp19a1b in the female (A) and male (B) ricefield eel as analyzed by RT-PCR coupled with Southern blot. Ob, olfactory bulb; Te, telencephalon; Hy, hypothalamus; Ot, optic tectum-thalamus; Ce, cerebellum; Mo, medulla oblongata; Pi, pituitary; Ov, ovary; Ts, testis; Mu, muscle; Sp, spleen; Pa, pancreas; He, heart; Li, liver; Ki, kidney; In, intestines; Bl, blood; RT−, RT minus; NC, negative control.

  • View in gallery

    Relative mRNA levels of CYP19 in the ricefield eel during ovarian development. (A) cyp19a1a in the ovary; (B) cyp19a1b in the hypothalamus (including optic tectum-thalamus); and (C) cyp19a1b in the pituitary. PV, previtellogenic stage; EV, early vitellogenic stage; MLV, mid- to late-vitellogenic stage; OM, oocyte at mature stage. The mRNA expression levels of CYP19 were determined by real-time RT-PCR. Each bar represents the mean of normalized expression levels of replicates (n=5). Means marked with different letters are significantly different (P<0.05).

  • View in gallery

    The effects of E2 on lhb mRNA expression in the in vitro incubated pituitary of ricefield eel. The pituitary glands were taken from mature female ricefield eel and incubated for 24 h in the presence or absence (control, containing 0.1% ethanol) of E2 (concentration at 1, 10, and 100 nM). The mRNA expression levels of lhb were determined by real-time RT-PCR. Each bar represents the mean of normalized expression levels of replicates (n=3). Means marked with different letters are significantly different (P<0.05).

  • View in gallery

    Relative mRNA levels of CYP19 in the ricefield eel during the natural sex change. (A) cyp19a1a in the gonad; (B) cyp19a1b in the hypothalamus; and (C) cyp19a1b in the pituitary. F, the female stage; IE, the early intersexual stage; IM, the middle intersexual stage; IL, the late intersexual stage; M, the male stage. The mRNA expression levels of CYP19 were determined by real-time RT-PCR. Each bar represents the mean of normalized expression levels of replicates (n=4–5). Means marked with different letters are significantly different (P<0.05).

  • Balthazart J & Ball GF 1998 New insights into the regulation and function of brain estrogen synthase (aromatase). Trends in Neuroscience 21 243249.

    • Search Google Scholar
    • Export Citation
  • Bhandari RK, Higa M, Nakamura S & Nakamura M 2004 Aromatase inhibitor induces complete sex change in the protogynous honeycomb grouper (Epinephelus merra). Molecular Reproduction and Development 67 303307.

    • Search Google Scholar
    • Export Citation
  • Bhandari RK, Alam MA, Higa M, Soyano K & Nakamura M 2005 Evidence that estrogen regulates the sex change of honeycomb grouper (Epinephelus merra), a protogynous hermaphrodite fish. Journal of Experimental Zoology. Part A, Comparative Experimental Biology 303 497503.

    • Search Google Scholar
    • Export Citation
  • Blázquez M & Piferrer F 2004 Cloning, sequence analysis, tissue distribution, and sex-specific expression of the neural form of P450 aromatase in juvenile sea bass (Dicentrarchus labrax). Molecular and Cellular Endocrinology 219 8394.

    • Search Google Scholar
    • Export Citation
  • Carreau S, Lambard S, Delalande C, Denis-Galeraud I, Bilinska B & Bourguiba S 2003 Aromatase expression and role of estrogens in male gonad: a review. Reproductive Biology and Endocrinology 1 3540.

    • Search Google Scholar
    • Export Citation
  • Chan ST & Phillips JG 1967 The structure of the gonad during natural sex reversal in Monopterus albus ((Pisces: Teleostei). Journal of Zoology 151 129141.

    • Search Google Scholar
    • Export Citation
  • Chan ST, O W-S, Tang F & Lofts B 1972 Biopsy studies on the natural sex reversal in Monopterus albus (Pisces: Teleostei). Journal of Zoology 167 415421.

    • Search Google Scholar
    • Export Citation
  • Chang X, Kobayashi T, Senthilkumaran B, Kobayashi-Kajura H, Sudhakumari CC & Nagahama Y 2005 Two types of aromatase with different encoding genes, tissue distribution and developmental expression in Nile tilapia (Oreochromis niloticus). General and Comparative Endocrinology 141 101115.

    • Search Google Scholar
    • Export Citation
  • Choi I, Troyer DL, Cornwell DL, Kirby-Dobbels KR, Collante WR & Simmen FA 1997 Closely related genes encode developmental and tissue isoforms of porcine cytochrome P450 aromatase. DNA and Cell Biology 16 769777.

    • Search Google Scholar
    • Export Citation
  • Choi JY, Park JG, Jeong HB, Lee YD, Takemura A & Kim SJ 2005 Molecular cloning of cytochrome P450 aromatases in the protogynous wrasse, Halichoeres tenuispinis. Comparative Biochemistry and Physiology. Part B, Biochemistry and Molecular Biology 141 4959.

    • Search Google Scholar
    • Export Citation
  • Devlin RH & Nagahama Y 2002 Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences. Aquaculture 208 191364.

    • Search Google Scholar
    • Export Citation
  • Forlano PM, Schlinger BA & Bass AH 2006 Brain aromatase: new lessons from non-mammalian model systems. Frontiers in Neuroendocrinology 27 247274.

    • Search Google Scholar
    • Export Citation
  • Gen K, Okuzawa K, Kumakura N, Yamaguchi S & Kagawa H 2001 Correlation between messenger RNA expression of cytochrome P450 aromatase and its enzyme activity during oocyte development in the red seabream (Pagrus major). Biology of Reproduction 65 11861194.

    • Search Google Scholar
    • Export Citation
  • González A & Piferrer F 2003 Aromatase activity in the European sea bass (Dicentrarchus labrax L.) brain. Distribution and changes in relation to age, sex, and the annual reproductive cycle. General and Comparative Endocrinology 132 223230.

    • Search Google Scholar
    • Export Citation
  • Graddy LG, Kowalski AA, Simmen FA, Davis SL, Baumgartner WW & Simmen RC 2000 Multiple isoforms of porcine aromatase are encoded by three distinct genes. Journal of Steroid Biochemistry and Molecular Biology 73 4957.

    • Search Google Scholar
    • Export Citation
  • Greytak SR, Champlin D & Callard GV 2005 Isolation and characterization of two cytochrome P450 aromatase forms in killifish (Fundulus heteroclitus): differential expression in fish from polluted and unpolluted environments. Aquatic Toxicology 71 371389.

    • Search Google Scholar
    • Export Citation
  • Guiguen Y, Baroiller JF, Ricordel MJ, Iseki K, Mcmeel OM, Martin SA & Fostier A 1999 Involvement of estrogens in the process of sex differentiation in two fish species: the rainbow trout (Oncorhynchus mykiss) and a tilapia (Oreochromis niloticus). Molecular Reproduction and Development 54 154162.

    • Search Google Scholar
    • Export Citation
  • Hallgren SL, Linderoth M & Olsén KH 2006 Inhibition of cytochrome p450 brain aromatase reduces two male specific sexual behaviours in the male Endler guppy (Poecilia reticulata). General and Comparative Endocrinology 147 323328.

    • Search Google Scholar
    • Export Citation
  • Kazeto Y & Trant JM 2005 Molecular biology of channel catfish brain cytochrome P450 aromatase (CYP19A2): cloning, preovulatory induction of gene expression, hormonal gene regulation and analysis of promoter region. Journal of Molecular Endocrinology 35 571583.

    • Search Google Scholar
    • Export Citation
  • Kishida M & Callard GV 2001 Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology 142 740750.

    • Search Google Scholar
    • Export Citation
  • Kobayashi Y, Kobayashi T, Nakamura M, Sunobe T, Morrey CE, Suzuki N & Nagahama Y 2004 Characterization of two types of cytochrome P450 aromatase in the serial-sex changing gobiid fish, Trimma okinawae. Zoological Science 21 417425.

    • Search Google Scholar
    • Export Citation
  • Kroon FJ & Liley NR 2000 The role of steroid hormones in protogynous sex change in the Blackeye goby, Coryphopterus nicholsii (Teleostei: Gobiidae). General and Comparative Endocrinology 118 273283.

    • Search Google Scholar
    • Export Citation
  • Kroon FJ, Munday PL, Westcott DA, Hobbs JP & Liley NR 2005 Aromatase pathway mediates sex change in each direction. Proceedings. Biological Sciences/The Royal Society 272 13991405.

    • Search Google Scholar
    • Export Citation
  • Kwon JY, McAndrew BJ & Penman DJ 2001 Cloning of brain aromatase gene and expression of brain and ovarian aromatase genes during sexual differentiation in genetic male and female Nile tilapia Oreochromis niloticus. Molecular Reproduction and Development 59 359370.

    • Search Google Scholar
    • Export Citation
  • Lee YH, Lee FY, Yueh WS, Tacon P, Du JL, Chang CN, Jeng SR, Tanaka H & Chang CF 2000 Profiles of gonadal development, sex steroids, aromatase activity, and gonadotropin II in the controlled sex change of protandrous black porgy, Acanthopagrus schlegeli Bleeker. General and Comparative Endocrinology 119 111120.

    • Search Google Scholar
    • Export Citation
  • Lee YH, Du JL, Yueh WS, Lin BY, Huang JD, Lee CY, Lee MF, Lau EL, Lee FY, Morrey C, Nagahama Y & Chang CF 2001 Sex change in the protandrous black porgy, Acanthopagrus schlegeli: a review in gonadal development, estradiol, estrogen receptor, aromatase activity and gonadotropin. Journal of Experimental Zoology 290 715726.

    • Search Google Scholar
    • Export Citation
  • Lephart ED 1996 A review of brain aromatase cytochrome P450. Brain Research. Brain Research Reviews 22 126.

  • Menuet A, Pellegrini E, Anglade I, Blaise O, Laudet V, Kah O & Pakdel F 2002 Molecular characterization of three estrogen receptor forms in zebrafish: binding characteristics, transactivation properties, and tissue distributions. Biology of Reproduction 66 18811892.

    • Search Google Scholar
    • Export Citation
  • Nagahama Y 1994 Endocrine regulation of gametogenesis in fish. International Journal of Developmental Biology 38 217219.

  • Nagahama Y 1997 17-alpha, 20 beta-dihydroxy-4-pregnen-3-one, a maturation- inducing hormone in fish oocytes: mechanisms of synthesis and action. Steroids 62 190196.

    • Search Google Scholar
    • Export Citation
  • Nagler JJ, Cavileer T, Sullivan J, Cyr DG & Rexroad C III 2007 The complete nuclear estrogen receptor family in the rainbow trout: discovery of the novel ERalpha2 and both ERbeta isoforms. Gene 392 164173.

    • Search Google Scholar
    • Export Citation
  • van Nes S, Moe M & Andersen Ø 2005 Molecular characterization and expression of two cyp19 (P450 aromatase) genes in embryos, larvae, and adults of Atlantic halibut (Hippoglossus hippoglossus). Molecular Reproduction and Development 72 437449.

    • Search Google Scholar
    • Export Citation
  • O'Donnell L, Robertson KM, Jones ME & Simpson ER 2001 Estrogen and spermatogenesis. Endocrine Reviews 22 289318.

  • Piferrer F & Blázquez M 2005 Aromatase distribution and regulation in fish. Fish Physiology and Biochemistry 31 215226.

  • Sawyer SJ, Gerstner KA & Callard GV 2006 Real-time PCR analysis of cytochrome P450 aromatase expression in zebrafish: gene specific tissue distribution, sex differences, developmental programming, and estrogen regulation. General and Comparative Endocrinology 147 108117.

    • Search Google Scholar
    • Export Citation
  • Senthilkumaran B, Yoshikuni M & Nagahama Y 2004 A shift in steroidogenesis occurring in ovarian follicles prior to oocyte maturation. Molecular and Cellular Endocrinology 215 1118.

    • Search Google Scholar
    • Export Citation
  • Simpson ER 2003 Sources of estrogen and their importance. Journal of Steroid Biochemistry and Molecular Biology 86 225230.

  • Tanaka M, Telecky TM, Fukada S, Adachi S, Chen S & Nagahama Y 1992 Cloning and sequence analysis of the cDNA encoding P-450 aromatase (P450arom) from a rainbow trout (Oncorhynchus mykiss) ovary; relationship between the amount of P450arom mRNA and the production of oestradiol-17 beta in the ovary. Journal of Molecular Endocrinology 8 5361.

    • Search Google Scholar
    • Export Citation
  • Tchoudakova A & Callard GV 1998 Identification of multiple CYP19 genes encoding different cytochrome P450 aromatase isozymes in brain and ovary. Endocrinology 139 21792189.

    • Search Google Scholar
    • Export Citation
  • Valle LD, Ramina A, Vianello S, Belvedere P & Colombo L 2002 Cloning of two mRNA variants of brain aromatase cytochrome P450 in rainbow trout (Oncorhynchus mykiss Walbaum). Journal of Steroid Biochemistry and Molecular Biology 82 1932.

    • Search Google Scholar
    • Export Citation
  • Wong TT, Ijiri S & Zohar Y 2006 Molecular biology of ovarian aromatase in sex reversal: complementary DNA and 5′-flanking region isolation and differential expression of ovarian aromatase in the gilthead seabream (Sparus aurata). Biology of Reproduction 74 857864.

    • Search Google Scholar
    • Export Citation
  • Yaron Z, Gur G, Melamed P, Rosenfeld H, Levavi-Sivan B & Elizur A 2001 Regulation of gonadotropin subunit genes in tilapia. Comparative Biochemistry and Physiology. Part B, Biochemistry and Molecular Biology 129 489502.

    • Search Google Scholar
    • Export Citation
  • Ye D, Lv D, Song P, Peng M, Chen Y, Guo M, Yang Q & Hu Y 2007 Cloning and characterization of a rice field eel vasa-like gene cDNA and its expression in gonads during natural sex transformation. Biochemical Genetics 45 211224.

    • Search Google Scholar
    • Export Citation
  • Yeung WS, Chen H & Chan ST 1993 Effects of LH and LHRH-analog on gonadal development and in vitro steroidogenesis in the protogynous Monopterus albus. General and Comparative Endocrinology 89 323332.

    • Search Google Scholar
    • Export Citation
  • Yu JH, Tang YK & Li JL 2008 Cloning, structure, and expression pattern of the P-450 aromatase gene in rice field eel (Monopterus albus). Biochemical Genetics 46 267280.

    • Search Google Scholar
    • Export Citation
  • Zhang Y, Zhang W, Zhang L, Zhu T, Tian J, Li X & Lin H 2004 Two distinct cytochrome P450 aromatases in the orange-spotted grouper (Epinephelus coioides): cDNA cloning and differential mRNA expression. Journal of Steroid Biochemistry and Molecular Biology 92 3950.

    • Search Google Scholar
    • Export Citation
  • Zhang W, Zhang Y, Zhang L, Zhao H, Li X, Huang H & Lin H 2007 The mRNA expression of P450 aromatase, gonadotropin beta-subunits and FTZ-F1 in the orange-spotted grouper (Epinephelus coioides) during 17 alpha-methyltestosterone -induced precocious sex change. Molecular Reproduction and Development 74 665673.

    • Search Google Scholar
    • Export Citation