Abstract
Communication between the immune and endocrine system is important for the control of inflammation that is primarily mediated through the hypothalamic–pituitary–adrenal axis. The innate immune system rapidly responds to pathogens by releasing complement proteins that include the anaphylatoxins C3a and C5a. We previously reported the existence of C3a receptors in the anterior pituitary gland and now describe the presence of C5a receptors in the gland. C5a and its less active derivative (C5adR) can bind to its own receptor and to another receptor called C5L2. Using RT-PCR and immunocytochemistry, C5a receptors and C5L2 were demonstrated in the rat anterior pituitary gland and in several rodent anterior pituitary cell lines. Western blotting analysis showed that C5a stimulated the phosphorylation of MAPK and AKT but not p38; C5adR on the other hand, had no effect on any of the signal molecules investigated. The effects of C5a and C5adR on the secretion of the inflammatory molecule, macrophage migration inhibitory factor (MIF) were investigated by ELISA. Both compounds showed a dose-dependent inhibition of MIF release, 30–40% inhibition at around 35–70 nM agonist with IC50 values of around 20 nM. C5a and C5adR also stimulated ACTH secretion (up to 25%) from AtT-20DV16 cells. These data show that functional C5a receptors (C5a and C5L2) are present in the anterior pituitary gland and they may play a role in dampening down inflammation by inhibiting the release of MIF and stimulating the release of ACTH.
Introduction
The hypothalamic–pituitary–adrenal (HPA) axis is a major regulator of immunity and inflammation via its secretion of glucocorticoids that suppress the immune activation of leukocytes and inhibit proinflammatory mediators. ACTH is the major regulator of glucocorticoids, yet during inflammation, cytokines such as IL1, IL6, tumour necrosis factor-α and leukaemia inhibitory factor are able to activate the HPA axis, and regulate the secretion of pituitary hormones that, in turn, modulate the function of immune cells (Besedovsky & del Ray 1996, Sternberg 1997). The crosstalk between the immune and endocrine systems is critically important for homeostatic control; dysregulation within this system has been implicated as a contributor to a wide range of acute and chronic inflammatory conditions including septic shock and rheumatoid arthritis (Chrousos 1995, Beishuizen et al. 2001, Polito et al. 2007). Such diseases are associated with increased cytokine production from immune cells leading to altered activity of the HPA axis (Spangelo & Gorospe 1995, Bijisma et al. 2005).
The innate immune system is also the source of the complement family of molecules that provide the principal effector mechanism of immunity (Gasque et al. 2000). Complement comprises a cascade of about 20 proteins that recognise and eliminate a variety of noxious substances and pathogens. When complement is activated, the components C3 and C5 are proteolytically cleaved to liberate the fragments C3a and C5a that are potent peptide anaphylatoxins and leukocyte chemoattractants that stimulate and modulate the inflammatory response by binding to specific receptors expressed on a wide variety of cell types (Hugli 1990, Monk et al. 2007). Both C3a and C5a are rapidly cleaved by serum carboxypeptidases to release the terminal arginine moiety; these desarginated (dR) have distinctly different patterns of activity from the parent molecules. C5adR has little proinflammatory activity (Bokisch & Muller-Eberhard 1970) due probably to its lower (100-fold less) binding affinity for the classical C5a receptor, C5aR (Burgi et al. 1994). Similarly C3adR has no detectable binding affinity for the C3a receptor, C3aR. In some assays, however, C3adR appears to have comparable activity to C3a where it has been shown to have anti- rather than proinflammatory properties (Kildsgaard et al. 2000). For example C3a and C3adR are equally effective in influencing IL6 secretion from human peripheral mononuclear cells and B cells from the tonsil (Fischer & Hugli 1997, Takabayashi et al. 1998). C3adR also stimulates triglycerol synthesis in human adipocytes by binding to a receptor that is distinct from C3aR (Cianflone et al. 1989).
C3aR is, as expected, expressed on cells of the myeloid lineage, yet expression is now also known to occur in the central nervous system and the pituitary and adrenal glands suggesting additional roles for maintaining homeostasis (Gasque et al. 1998, Francis et al. 2003). We have recently showed that C3a receptors are expressed in the majority of the cell types (corticotrophs, lactotrophs, somatotrophs, thyrotrophs and folliculostellate cells) within the anterior pituitary gland. C3a either in vivo or in vitro caused a rapid release of ACTH, prolactin and GH but not TSH. Surprisingly, C3adR showed similar activity but the inclusion of pertussis toxin inhibited the action of C3a but not that of C3adR, suggesting the latter may be working through a different, non-G protein coupled receptor (Francis et al. 2003).
Although we have demonstrated the presence of C3aR in the anterior pituitary gland there is no information on the expression of C5aR although C5a may also have a role in the activation of the HPA axis (Crane & Buller 2007). C5a, in addition to binding to the C5aR can also bind to an additional receptor, C5L2 that has been recently identified in human and rodent tissues (Cain & Monk 2002, Okinaga et al. 2003, Gao et al. 2005, Chen et al. 2007). C5L2 is also a seven transmembrane domain receptor but appears to be unable to signal through G proteins due to the absence of key G protein-coupling motifs, such as the replacement of leucine by arginine in the so-called DRY motif at the intracellular face of the third transmembrane domain. Human C5L2 binds to both C5a and C5adR with high affinity but rodent C5L2 appears to preferentially bind to C5adR. Conflicting reports of the binding of C3a or C4a to C5L2 remain to be resolved (Cain & Monk 2002, Okinaga et al. 2003) and the precise role of this receptor is still unknown; it may serve as a decoy receptor for the removal of excess C5a/C5adR, as has been observed in sepsis patients or it may serve as a mediator of acylation-stimulating protein (C3adR) stimulation of triglyceride synthesis (Kalant et al. 2005).
In this report, we show that rat anterior pituitary and several anterior pituitary cell lines express both the C5aR and C5L2. C5a but not C5adR stimulated the activation of signalling molecules ERK/MAPK and AKT. On the other hand, C5a and C5adR both inhibited the secretion of the inflammatory molecule, macrophage migration inhibitory factor (MIF) yet stimulated the secretion of ACTH. These data suggest that C5a and C5adR may act to dampen down inflammatory responses by stimulating the anterior pituitary gland and activating the adrenal gland and inhibiting the secretion of MIF.
Materials and Methods
Cell culture materials and reagents were obtained from Invitrogen, Autogen Bioclear (Calne, UK), Sarstedt Ltd (Leicester, UK) and Sigma–Aldrich. Rat anterior pituitary tissue was taken from male Wistar rats (150–200 g) after cervical dislocation. Rodent pituitary GH3 (GH and prolactin secreting), MMQ (prolactin secreting; Judd et al. 1988), RC-4B/C (pituitary adenoma producing gonadotrophin and prolactin; Berault et al. 1990, Hurbain-Kosmath et al. 1990, Polkowska et al. 1991) and AtT-20DV16 (corticotrophin secreting) cell lines are in-house and TtT/GF (folliculostellate) cells were kindly provided by Professor Kinji Inoue (Department of Regulation Biology, Saitama University, Urawa, Japan). Recombinant mouse and rat C5a and C5adR were prepared in-house and described previously (Paczkowski et al. 1999). Specific polyclonal antisera to the C5a receptor and to mouse and rat C5L2 were prepared in-house, as described (Kalant et al. 2005). Co-incubation of the antisera with the appropriate C5a or C5L2 peptides that had been used to immunise the rabbits, markedly reduced their binding capacity to cells. Human/rat CRH was from Sigma–Aldrich. Vectastain ABC kits (Vector Laboratories, Peterborough, UK) were used for immunocytochemistry. Molecular biology reagents, except TRIzol (from Invitrogen), were obtained from Promega. Western blotting reagents were from GE Healthcare (Chalfont St Giles, UK).
Cell culture
GH3, and MMQ cells were cultured in Ham's F12, 15% (v/v) horse serum and 2.5% (v/v) foetal bovine serum (FBS) and TtT/GF and AtT-20DV16 in respectively DMEM 10% (v/v) heat-inactivated (HI) FBS and DMEM 10% (v/v) FBS. RC-4B/C cells were cultured in DMEM/αMEM (1:1) and 10% (v/v) HI FBS. For immunocytochemistry, cells were cultured on ‘Thermanox’ coverslips (Invitrogen). For experimental purposes MMQ cells were seeded into poly-l-lysine (70–150 kDa, 0.1 mg/ml) coated dishes or coverslips.
Immunocytochemistry
Immunocytochemical procedures were carried out on paraformaldehyde fixed rat pituitary tissue and acetone-fixed anterior pituitary cell-line monolayers. Antigen retrieval in paraformaldehyde-fixed tissue sections was performed by heating in 10 mM citrate buffer pH6 for 30 min in a microwave oven. Incubations with specific antisera (in house) were carried out either overnight at 4 °C or for 1 h. at room temperature (in the case of β-actin, (from Santa Cruz Biotechnology, Santa Cruz, CA, USA)) at the following concentrations: anti-C5a receptor (1:200), affinity purified anti-mouse and anti-rat C5L2 (respectively 0.1 and 0.04 mg/ml) and β-actin (1:2000). Sections were then incubated for 90 min in the appropriate second antibody coupled to biotin and then visualised with streptavidin–fluorescein. Nuclei were stained with DAPI. For negative controls, non-immune sera were used in place of the specific antisera.
RT-PCR
Total cellular RNA was prepared using TRIzol reagent and treated with RQ1 ribonuclease-free DNase. 0.2 μg RNA was reverse transcribed using oligodeoxythymidilic acid [oligo(dT)15] for 1 h at 37 °C and the cDNA generated was subjected to PCR amplification using primers specific for rat and mouse C5a receptor, C5L2 and MIF. Primer sequences (shown in Table 1) were designed using the Primer 3 software programme and gene sequences obtained from GenBank. For the PCR 30–40 cycles were carried out as follows: 94, 65 and 72 °C for respectively 30 s, 1 min and 1 min and a final extension step of 72 °C for 10 min. Amplified products were electrophoresed in 2% (w/v) agarose and visualised with ethidium bromide.
Primer sequences for rat and mouse (Mo) C5a receptor, C5L2 and MIF
| Primer sequence (5′–3′) | Amplicon (bp) | Accession numbers | |
|---|---|---|---|
| Target | |||
| Rat/Mo.C5aR | |||
| F | AGCATTGCTCCTCACCATTC | 248 | Y09613 (rat) |
| R | TCACCACTTTGAGCGTCTTG | NM007577 (mo) | |
| Rat C5L2 | |||
| F | TTGCAGTGGCTTCTTCACAC | 192 | AY600435 |
| R | GATACCTTGGTCACGGCACT | ||
| Mo.C5L2 | |||
| F | TTTGCTGGACCCCTTATCAC | 244 | AK053187 |
| R | GATACCTTGGTCACCGCACT | ||
| Rat MIF | |||
| F | CCATGCCTATGTTCATCGTG | 242 | U62326 |
| R | CAGCAGCTTGCTGTAGTTGC | ||
| Mo. MIF | |||
| F | GTGCCAGAGGGGTTTCTGT | 206 | U20156 |
| R | AGGCCACACAGCAGCTTACT | ||
Western blotting analysis
Western blotting analysis was used to investigate the effect of C5a and C5adR on the phosphorylation of p44/42 MAPK, p38 MAPK and AKT in GH3, MMQ and TtT/GF cells. The cells were plated out at a density of 1 (GH3 and MMQ) and 0.5×106 (TtT/GF) cells/well in six-well multidishes and incubated overnight. The serum containing media were replaced with serum-free media, again overnight, and then for a further 3 h with fresh serum-free media. Cells were exposed to 70 nM C5a or C5adR for 0, 1, 5, 15, 30 and 60 min, rinsed 3× with 1 mM sodium orthovanadate in PBS and then lysed in 200 μl RIPA buffer containing 1 mM sodium orthovanadate, 0.1 mg/ml phenylmethylsulphonyl fluoride and chymostatin, leupeptin, antipain and pepstatin A (all at 10 μg/ml). Lysates after centrifugation were stored at −80 °C. Fifteen micro litre aliquots from each treatment were mixed with an equal volume of electrophoresis buffer, boiled and electrophoresed in 10% (w/v) polyacrylamide. Proteins were transferred onto PVDF membranes and incubated overnight at 4 °C with antisera to the phosphorylated and total forms of p44/42 MAPK and AKT (Cell Signaling Technology, Beverley, MA, USA) and p38 (Santa Cruz Biotechnology). Antisera were used at the concentrations indicated in the data sheets. Secondary anti-rabbit IgG conjugated to HRP, at 1:5000, were applied for 1 h at room temperature and proteins were visualised with ECL Plus reagent.
Macrophage MIF
MIF secretion was measured in GH3, MMQ, TtT/GF and AtT-20DV16 cells after exposure to rat or mouse C5a, as appropriate. C5adR was also used in some experiments. Briefly, cells (GH3 and MMQ, 0.15×106 cells/cm2, AtT-20DV16 and TtT/GF, 0.2×106 cells/cm2) were plated into 48 well multidishes in their respective culture media for 48 h and then exposed to C5a or C5adR (7, 35 and 70 nM) in media (0.15 ml) containing 1% FCS for 1 h. Conditioned media was centrifuged to remove cell debris and stored at −20 °C. MIF was determined by ELISA (R&D Systems, Abingdon, UK).
ACTH
ACTH secretion was measured in AtT-20DV16 cells (0.025×106/cm2) treated with C5a, C5adR and CRH for 1 h as for the MIF experiments. ACTH was measured by RIA (Peninsula Laboratories, San Carlos, CA, USA).
Statistical analysis
Experiments were performed 2–4 times (n) with six replicates for each treatment. Results are expressed as mean±s.e.m. and compared by ANOVA and the Tukey multiple comparison test. P<0.05 is deemed to be significant.
Results
Expression of C5a and C5L2 receptors
Immunostaining for the C5a receptor and for C5L2 showed strong expression in the rat anterior pituitary gland; C5a receptor but not C5L2 positive cells were also present in the intermediate and posterior lobes (Figs 1 and 2). There was also clear cytoplasmic staining for the C5a receptor and C5L2 in all of the pituitary associated cell lines tested (Figs 1 and 2) demonstrating wide distribution within different pituitary (corticotrophs, lactotrophs/somatotrophs and folliculostellate) cell types. The specificity of staining with C5L2 anti-sera was confirmed by co-incubation with the immunising peptides, which considerably reduced the level of antibody binding to the pituitary cell lines. RT-PCR studies (Fig. 3) demonstrated the presence of C5a receptor and C5L2 mRNA in pituitary cells and cell lines consistent with the immunocytochemistry findings. All amplicons were of the expected size and sequencing confirmed their identities (not shown).
C5aR immunostaining in (A) rat pituitary, (B) AtT-20DV16, (C) GH3 and (D) RC4/B anterior pituitary cell lines (×100). A negative control with non-immune rabbit serum (1:50) is shown in (D). (Ant, anterior lobe; Int, intermediate lobe; Post, posterior lobe). Full colour version of this figure available via
Citation: Journal of Endocrinology 199, 3; 10.1677/JOE-08-0110
C5L2 immunostaining in (A) rat pituitary, (B) MMQ, (C) GH3 and (D) TtT/GF anterior pituitary cell lines (×100). A negative control with non-immune rabbit serum (1:50) is shown in (D). (Ant, anterior lobe; Int, intermediate lobe; Post, posterior lobe). Full colour version of this figure available via
Citation: Journal of Endocrinology 199, 3; 10.1677/JOE-08-0110
Detection of C5aR and C5L2 mRNA by RT-PCR in anterior pituitary cells. (Pit, rat anterior pituitary; GH, rat GH3; MM, rat MMQ; AtT, mouse AtT-20DV16; TtT, mouse TtT/GF cells). The 100 bp ladder is shown on the left.
Citation: Journal of Endocrinology 199, 3; 10.1677/JOE-08-0110
Activation of signal molecules
To test whether the C5a receptor is functional, the effect of C5a and C5adR on the phosphorylation of p44/42 MAPK (T202/Y204), p38 and AKT (Ser 473) was investigated in TtT/GF, MMQ and GH3 cells. Figure 4A shows the time-course effect of rat C5a on p44/42 phosphorylation and total p44/42 in MMQ cells; phosphorylated p44/42 was detectable after 15 min and reached a plateau after 30 min of exposure. Similar findings were found in both the GH3 and TtT/GF cell lines (data not shown). C5adR, over the same time frame had no effect on p44/42 phosphorylation. C5a but not C5adR had similar effects on AKT phosphorylation with similar plateau time points of 30 min in both MMQ and TtT/GF cells (Fig. 4B). There was no clear effect of C5a on p38 MAPK phosphorylation in any of the cell lines (data not shown).
Western blotting analysis of (A) phosphorylated (P) and total (T) p44/42 MAPK and (B) phosphorylated (P) and total AKT (T) in MMQ cells after incubation for up to 1 h. with 70 nM rat C5a. (Cell lysates were electrophoresed in 10% acrylamide and probed with antisera to phosphorylated and total forms of p44/42 MAPK and AKT). A representative blot (of three experiments) is shown.
Citation: Journal of Endocrinology 199, 3; 10.1677/JOE-08-0110
MIF secretion
The anterior pituitary gland is a major source of MIF and its expression has been demonstrated in corticotrophs and thyrotrophs. We have used RT-PCR to show that MIF is synthesised in many cell types within the anterior pituitary gland; these include lactotrophs/somatotrophs and folliculostellate cells (Fig. 5). Both C5a and C5adR inhibited, in a dose-related manner, the secretion of MIF in MMQ, GH3 and AtT-20DV16 cells over a 1 h incubation time period (Fig. 6). MIF secretion was inhibited by 30–40% in the presence of 35–70 nM C5a or C5adR with IC50 values of around 20 nM. Interestingly, C5adR was at least as potent as C5a in this assay. No significant inhibitory or stimulatory effects were observed beyond 1 h. We were unable to carry out these experiments in TtT/GF cells as basal levels of secreted MIF were very low and barely detectable in our ELISA system.
Detection of MIF mRNA by RT-PCR in anterior pituitary cells. (Pit, rat anterior pituitary; GH, rat GH3; MM, rat MMQ; RC, rat RC4/B; AtT, mouse AtT-20DV16; TtT, mouse TtT/GF cells). The 100 bp ladder is shown on the left.
Citation: Journal of Endocrinology 199, 3; 10.1677/JOE-08-0110
Effect of C5a and C5adR on the secretion of MIF from (A) GH3, (B) AtT-20DV16 and (C) MMQ cells. (Replicate cultures (six in each experiment) were treated with recombinant rat or mouse C5a or C5adR for 1 h; MIF was measured by ELISA in the conditioned media). N=2–4. *P<0.05, **P<0.01, ***P<0.001 when compared with the respective basal (in the absence of agonist) value.
Citation: Journal of Endocrinology 199, 3; 10.1677/JOE-08-0110
ACTH secretion
The corticotroph tumour cell line AtT-20DV16 was used to assess the effect of murine C5a and C5adR on ACTH secretion. The natural agonist for ACTH secretion, CRH, was used for comparison. Figure 7 shows that both C5a and C5adR slightly stimulated (up to 25%) ACTH secretion over the 1 h time period, these effects were however, comparable with that for CRH (up to 40%) at similar concentrations.
Effect of C5a, C5adR and CRH on the secretion of ACTH from AtT-20DV16 cells. (Replicate cultures (four in each experiment) were treated with recombinant mouse C5a and C5adR or rat CRH for 1 h; ACTH was measured by RIA in the conditioned media). N=2 and 3. *P<0.05, **P<0.01, when compared with the basal (in absence of agonist) value.
Citation: Journal of Endocrinology 199, 3; 10.1677/JOE-08-0110
Discussion
The process of inflammation leads to rapid activation of the complement system and release of two anaphylatoxin molecules C3a and C5a. C3a and C5a mediate their actions via specific receptors; these actions include chemotaxis of neutrophils, eosinophils and monocytes and smooth muscle contraction and vasodilatation (Monsinjon et al. 2003). Recent studies however, have shown that C3aR and C5aR expression is much more widespread and C5aR are now known to be expressed on endothelial and epithelial cells as well as in non-myeloid cells of the liver, lung and brain (Monsinjon et al. 2003). C3aR also have a similar distribution and in addition have also been described in the adrenal and pituitary gland (Francis et al. 2003, Monsinjon et al. 2003). We have recently shown that both C3a and C3adR are functionally active in the anterior pituitary gland by virtue of its stimulatory actions on hormone secretion and involvement in immunoprotection (Francis et al. 2003). The use of cell lines, in our current experiments, show that C5aR, perhaps not unexpectedly, is expressed in corticotrophs, lactotrophs, somatotrophs, gonadotrophs and folliculostellate cells. The second C5a receptor, C5L2 had a similar distribution to the C5aR but the C5L2 was not detectable (at least by immunocytochemistry) in the intermediate or posterior lobes. Immunostaining for C5aR and C5L2 appeared to be both surface and cytoplasmic. In the case of C5aR, this is rather surprising as it is known to be primarily located at the cell surface whereas C5L2 is known to be primarily intracellular (manuscript in preparation).
The C5aR can transduce signals via phosphorylation of p44/42 MAPK, AKT and p38 MAPK (Monsinjon et al. 2003, Chiou et al. 2004, Riedemann et al. 2004a). Our data are consistent with these findings and also indicate that C5adR is not an activator of these signals, presumably due to its low activity at the C5aR. On the other hand, both C5a and C5adR inhibited the secretion of MIF from pituitary cells with similar potencies. Other researchers have shown that C5a stimulates the secretion of MIF from eosinophils (Rossi et al. 1998) and neutrophils (Riedemann et al. 2004b). The inhibitory actions on MIF secretion that we observed were likely to be due to effects on preformed MIF rather than on MIF gene transcription. The presence of MIF in unstimulated pituitary cells suggests there must be some storage in the cytoplasm and this has also been observed in neutrophils (Riedemann et al. 2004b). Similarly, in eosinophils, phorbol myristate acetate stimulated MIF release is only inhibited 50% by prior incubation with cycloheximide (Rossi et al. 1998) suggesting that some MIF is pre-made and stored for rapid release.
C5a and C5adR also stimulated ACTH secretion to a similar level to that seen when similar concentrations of CRH were used. This suggests that anaphylatoxin activation of the anterior pituitary gland can independently lead to a release of corticosteroids from the adrenal gland. It is also conceivable that anaphylatoxin molecules may act in concert with other ACTH-releasing molecules from the anterior pituitary gland to regulate the release of corticosteroids and to dampen down stress and inflammation.
Apart from the inflammatory actions of C5a and C3a, there have been several reports on all three receptors also having an anti-inflammatory role (Kildsgaard et al. 2000, Bhatia et al. 2001, Gavrilyuk et al. 2005, Gerard et al. 2005, Chen et al. 2007, Crane & Buller 2007); this is consistent with their presence in the HPA axis and its regulation of inflammation and immunity. The anti-inflammatory properties of C3a and C5a may be due, at least in part, to interactions with cytokines and chemokines (Kohl 2001, Guo & Ward 2005). Our findings on ACTH and MIF secretion further support an anti-inflammatory role for C5a and C5adR in the anterior pituitary gland. The mechanism of action of C5adR in our experiments, however, is not known and needs further investigation. Nevertheless, the presence of C5a receptors in the anterior pituitary gland further supports interactive communication between the immune and endocrine systems.
Declaration of interest
The authors declare there is no conflict of interest that would prejudice the article's impartiality.
Funding
This research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.
Acknowledgements
The authors would like to thank Professor M F Scanlon, (Centre for Endocrine and Diabetes Sciences, School of Medicine, Cardiff University) for his continual interest and support.
References
Beishuizen A, Thijs L, Haanen C & Vermes I 2001 Macrophage migration inhibitory factor and hypothalamo-pituitary–adrenal function during critical illness. Journal of Clinical Endocrinology and Metabolism 86 2811–2816.
Berault A, Noel N, Hurbain-Kosmath I, Polkowska J, Bohin A, Leiter EH & Jutisz M 1990 Characterisation of gonadotropic cells in a new pituitary tumour cell line. Annales d'Endocrinologie 51 82–88.
Besedovsky HO & del Ray A 1996 Immune–neuro-endocrine actions: facts and hypotheses. Endocrine Reviews 17 64–102.
Bhatia M, Saluja AK, Singh VP, Frossard JL, Lee HS, Bhagat L, Gerard C & Steer ML 2001 Complement factor C5a exerts an anti-inflammatory effect in acute pancreatitis and associated lung injury. American Journal of Physiology. Gastrointestinal and Liver Physiology 280 G974–G978.
Bijisma JW, Cutolo M, Straub RH & Masi AT (Eds) 2005 Clinical aspects of immune neuroendocrine mechanisms in rheumatic diseases. (Rheumatic Diseases of North America) vol 31, Philadelphia: Saunders..
Bokisch VA & Muller-Eberhard HJ 1970 Anaphylatoxin inactivator of human plasma: its isolation and characterization as a carboxypeptidase. Journal of Clinical Investigation 49 2427–2436.
Burgi B, Brunner T & Dahinden CA 1994 The degradation product of the anaphylatoxin C5adesArg retains basophil activating properties. European Journal of Immunology 24 1583–1589.
Cain SA & Monk PN 2002 The orphan receptor C5L2 has high affinity binding sites for complement fragments C5a and C5adesArg. Journal of Biological Chemistry 277 7165–7169.
Chen N-J, Mirtsos C, Suh D, Lu Y-C, Lin W-J, McKerlie C, Lee T, Baribault H, Tian H & Yeh W-C 2007 C5L2 is critical for the biological activities of C5a and C3a. Nature 446 203–207.
Chiou WF, Tsai HR, Yang LM & Tsai WJ 2004 C5a differentially stimulates the ERK1/2 and p38 MAPK phosphorylation through independent signaling pathways to induced chemotactic migration in RAW264.7 macrophages. International Immunopharmacology 4 1329–1341.
Chrousos GP 1995 The hypothalamic–pituitary–adrenal axis and immune mediated inflammation. New England Journal of Medicine 332 1351–1362.
Cianflone KM, Sniderman AD, Walsh MJ, Vu HT, Gagnon J & Rodriguez MA 1989 Purification and characterization of acylation stimulating protein. Journal of Biological Chemistry 264 426–430.
Crane JW & Buller KM 2007 Systemic blockade of complement C5a receptors reduces lipopolysacharride-induced responses in the paraventricular nucleus and the central amygdale. Neuroscience Letters 424 10–15.
Fischer WH & Hugli TE 1997 Regulation of B cell functions by C3a and C3adesArg: suppression of TNF-α, IL-6 and the polyclonal immune response. Journal of Immunology 159 4279–4286.
Francis K, Lewis BM, Akatsu H, Monk PN, Cain SA, Scanlon MF, Morgan BP, Ham J & Gasque P 2003 Complement C3a receptors in the pituitary gland: a novel pathway by which an innate immune molecule releases hormones involved in the control of inflammation. FASEB Journal 17 2266–2268.
Gao H, Neff TA, Guo R-F, Spweyer CL, Sarma JY, Tomlins S, Man Y, Riedemann NC, Hoesel LM & Younkin E et al. 2005 Evidence for a functional role of the second C5a receptor C5L2. FASEB Journal 19 1003–1005.
Gasque P, Singhrao SK, Neal JW, Wang P, Sayah S, Fontaine M & Morgan BP 1998 The receptor for complement anaphylatoxin C3a is expressed by myloid cells and non-myloid cells in inflamed human central nervous system: analysis in multiple sclerosis and bacterial meningitis. Journal of Immunology 160 3543–3554.
Gasque P, Dean YD, McGreal EP, Van Beck J & Morgan BP 2000 Complement components of the innate immune system in health and disease in the CNS. Immunopharmacology 49 171–186.
Gavrilyuk V, Kalinin S, Hilbush BS, Middlecamp A, McGuire S, Pelligrino D, Weinberg G & Feinstein DL 2005 Identification of complement 5a-like receptor (C5L2) from astrocytes: characterization of anti-inflammatory properties. Journal of Neurochemistry 92 1140–1149.
Gerard NP, Lu B, Lui P, Craig S, Fujiwara Y, Okinaga S & Gerard C 2005 An anti-inflammatory function for the complement anaphylatoxin C5a-binding protein, C5L2. Journal of Biological Chemistry 280 39677–39680.
Guo RF & Ward PA 2005 Role of C5a in inflammatory responses. Annual Review of Immunology 23 821–852.
Hugli TE 1990 Structure and function of the C3a anaphylatoxin receptor. Current Topics in Microbiology and Immunology 153 181–208.
Hurbain-Kosmath I, Berault A, Noel N, Polkowska J, Bohin A, Jutisz M, Leiter EH, Beamer WG, Bedigian HG & Davisson MT 1990 Gonadotrophs in a novel rat pituitary tumor cell line, RC-4B/C. Establishment and partial characterization of the cell line. In Vitro Cellular and Developmental Biology 26 431–440.
Judd AM, Login IS, Kovacs K, Ross PC, Spangelo BL, Jarvis WD & MacLeod RM 1988 Characterization of the MMQ cell, a prolactin-secreting clonal cell line that is responsive to dopamine. Endocrinology 123 2341–2350.
Kalant D, MacLaren R, Cui W, Samanta R, Monk PN, Laporte SA & Cianflone K 2005 C5L2 is a functional receptor for acylation-stimulating protein. Journal of Biological Chemistry 280 23936–23944.
Kildsgaard J, Hollman TJ, Matthews KW, Bian K, Murad F & Wetsel RA 2000 Cutting edge: targeted disruption of the C3a receptor gene demonstrates a novel protective anti-inflammatory role for C3a in endotoxin shock. Journal of Immunology 165 5406–5409.
Kohl J 2001 Anaphylatoxins and infectious and non-infectious inflammatory diseases. Molecular Immunology 38 175–187.
Monk PN, Scola A-M, Madala P & Fairlie DP 2007 Function, structure and therapeutic potential of complement C5a receptors. British Journal of Pharmacology 152 429–448.
Monsinjon T, Gasque P, Chan P, Ischenko A, Brady JJ & Fontaine M 2003 Regulation by complement C3a and C5a anaphylatoxins of cytokine production in human umbilical vein endothelial cells. FASEB Journal 17 1003–1014.
Okinaga S, Slattery D, Humbles A, Zsengeller Z, Morteau O, Kinrade MB, Brodbeck RM, Krause J, Choe HY & Gerard NP et al. 2003 C5L2, a nonsignaling C5a binding protein. Biochemistry 42 9406–9415.
Paczkowski NJ, Finch AM, Whitmore JB, Short AJ, Wong AK, Monk PN, Cain SA, Fairlie DP & Taylor SM 1999 Pharmacological characterization of antagonists of the C5a receptor. British Journal of Pharmacology 128 1461–1466.
Polito A, Aboab J & Annane D 2007 The hypothalamic–pituitary–adrenal axis in sepsis. Novartis Foundation Symposium 280 182–199.
Polkowska J, Berault A, Hurbain-Kosmath I, Jolly G & Jutisz M 1991 Bihormonal cells producing gonadotropins and prolactin in a rat pituitary tumor cell line (RC-4B/C). Neuroendocrinology 54 267–273.
Riedemann NC, Guo RF, Hollmann TJ, Gao H, Neff TA, Reuben JS, Speyer CL, Sarma JV, Wetsel RA & Zetoune FS et al. 2004a Regulatory role of C5a in LPS-induced IL-6 production by neutrophils during sepsis. FASEB Journal 18 370–372.
Riedemann NC, Guo RF, Gao H, Sun L, Hoesel M, Hollmann TJ, Wetsel RA, Zetoune FS & Ward PA 2004b Regulatory role of C5a on macrophage migration inhibitory factor release from neutrophils. Journal of Immunology 173 1355–1359.
Rossi AGC, Haslett N, Hirani AP, Greening I, Rahman CN, Metz R, Bucala RC & Donnelly SC 1998 Human circulating eosinophils secrete macrophage migration inhibitory factor (MIF): potential role in asthma. Journal of Clinical Investigation 101 2869–2874.
Spangelo PL & Gorospe WC 1995 Role of cytokines in the neuroendocrine–immune system axis. Frontiers in Neuroendocrinology 16 1–22.
Sternberg EM 1997 Neural–immune interactions in health and disease. Journal of Clinical Investigation 100 2641–2647.
Takabayashi T, Vannier E, Burke JF, Tompkins RG, Gelfand JA & Clark BD 1998 Both C3a and C3adesArg regulates interleukin-6 synthesis in human peripheral blood mononuclear cells. Journal of Infectious Diseases 177 1622–1628.
