Abstract
Thyroid hormones (THs) regulate growth, morphological development, and migratory behaviors in teleost fish, yet little is known about the transcriptional dynamics of gene targets for THs in these taxa. Here, we characterized TH regulation of mRNAs encoding thyrotropin subunits and thyroid hormone receptors (TRs) in an adult teleost fish model, the fathead minnow (Pimephales promelas). Breeding pairs of adult minnows were fed diets containing 3,5,3′-triiodo-l-thyronine (T3) or the goitrogen methimazole for 10 days. In males and females, dietary intake of exogenous T3 elevated circulating total T3, while methimazole depressed plasma levels of total thyroxine (T4). In both sexes, this methimazole-induced reduction in T4 led to elevated mRNA abundance for thyrotropin β-subunit (tshβ) in the pituitary gland. Fish treated with T3 had elevated transcript levels for TR isoforms α and β (trα and trβ) in the liver and brain, but reduced levels of brain mRNA for the immediate-early gene basic transcription factor-binding protein (bteb). In the ovary and testis, exogenous T3 elevated gene transcripts for tshβ, glycoprotein hormone α-subunit (gphα), and trβ, while not affecting trα levels. Taken together, these results demonstrate negative feedback of T4 on pituitary tshβ, identify trα and trβ as T3-autoinduced genes in the brain and liver, and provide new evidence that tshβ, gphα, and trβ are THs regulated in the gonad of teleosts. Adult teleost models are increasingly used to evaluate the endocrine-disrupting effects of chemical contaminants, and our results provide a systemic assessment of TH-responsive genes during that life stage.
Introduction
The hypothalamic–pituitary–thyroid (HPT) axis regulates metabolism and growth, reproduction, and brain development in vertebrates. Similarly, in fish, thyroid hormones (THs) have been demonstrated to regulate growth (Huang et al. 1996, Power et al. 2001, Kang & Chang 2004), influence morphological development (Reddy & Lam 1992, Brown 1997, Tagawa & Aritaki 2005, Lema & Nevitt 2006), and mediate the transition from larval or juvenile forms in a similar manner to how THs regulate metamorphosis in amphibians (de Jesus et al. 1998, Trijuno et al. 2002, Shiao & Hwang 2006). In addition to their well-established roles in influencing growth and morphology, THs have been shown to promote neural stem cell proliferation in the olfactory system of salmon indicating a role for THs in neurogenesis (Lema & Nevitt 2004), and to mediate the rheotactic shifts and migratory behaviors of salmon and other diadromous fishes (McCormick et al. 1998, Edeline et al. 2005). THs also appear to influence reproductive function in teleost fish, since inhibition of endogenous TH production during the time of gonadal germ cell differentiation leads to an increased density of Sertoli and germ cells per cyst in the testis (Matta et al. 2002).
While these and other studies have established diverse roles for THs in the growth, development, and behavior of fish (reviewed by Power et al. 2001, Yamano 2005), little is known about gene targets for TH action in teleosts. Few TH-responsive genes have been detected in fish (Liu et al. 2000, Marchand et al. 2004, Manchado et al. 2009), yet the identification of these genes is crucial to understanding which molecular pathways mediate TH-regulated responses. Teleost fishes are now commonly used as vertebrate models for assessing the physiological and behavioral impacts of chemical contaminants, and the adults of several teleost species are used for screening the endocrine-disrupting effects of pollutants (Ankley & Johnson 2004, Ankley & Villeneuve 2006). As teleost models are increasingly employed to test for endocrine disruption of reproduction, brain development, and behavior, it has become clear that a detailed understanding of HPT axis regulation in teleosts is necessary to fully evaluate the thyroid-disrupting impacts of environmental chemicals (Brown et al. 2004, Crofton 2008). While several teleost models have been used to examine the effects of contaminants on thyroid status and function (Picard-Aitken et al. 2007, Lema et al. 2008a), our understanding of HPT regulation in teleosts – and of the molecular mechanisms by which THs regulate specific functions in target tissues – is presently insufficient to use teleost fishes to assess the impacts of chemicals disrupting the thyroid system (Brown et al. 2004, Blanton & Specker 2007).
In this study, we examined TH regulation of mRNAs encoding several known or putative TH-responsive genes in the tissues of the adult fathead minnow (Pimephales promelas). The fathead minnow is commonly used as an adult teleost model for assessing the toxic and endocrine-disrupting effects of chemical pollutants (USEPA 2002, Ankley & Villeneuve 2006), yet TH-regulated gene targets have not been described in this species. Specifically, we examined TH regulation of mRNAs for thyrotropin β-subunit (tshβ) and glycoprotein hormone α-subunit (gphα) – which encodes the two protein subunits of the functional thyrotropin (Tsh) hormone – in the pituitary and gonads. We also examined the TH regulation of gene transcripts for the thyroid hormone receptors (TRs) α and β (trα and trβ) in the brain, liver, and gonads, as well as transcript for basic transcription element-binding protein (bteb) in the brain. The bteb gene encodes a zinc-fingered transcription factor that binds GC-box domains to regulate TH-mediated gene transcription. Previously, bteb has been shown to be TH regulated in the brain of mice (Denver et al. 1999) and in the brain, intestine, and tail of Xenopus (Furlow & Kanamori 2002, Hoopfer et al. 2002), but it has not been tested whether bteb is TH regulated in the neural tissues of adult teleosts.
Materials and Methods
Animals and housing
Fathead minnow (P. promelas) adults (mean body mass: 2.92±0.15 g; mean fork length: 57.74±0.89 mm) were obtained from Environmental Consulting & Testing (Superior, WI, USA) and held in 185 l, flow-through (0.5 l/min) aquaria prior to commencing the experiment. Minnows were maintained under a 16:8 L/D photoperiod with water quality parameters of 24–26 °C, 6.6–7.4 mg/l dissolved oxygen, and 8.1–8.3 pH for the duration of the experiment. All animals were maintained in accordance with established guidelines of the Institutional Animal Care and Use Committee of Battelle.
Dietary methimazole and T3 treatments
Methimazole and 3,5,3′-triiodo-l-thyronine (T3; Sigma) were administered to breeding pairs of adult minnows using a commercial fish pellet diet (BioDiet Grower pellets, BioOregon, Warrenton, OR, USA). Methimazole (125 mg) and T3 (5 mg) were dissolved in alkaline ethanol solution (33 ml 95% ethanol and 12 ml 0.1% NaOH), and sprayed on the pellet feed (50 g) using a Badger 350 air brush (Badger Air-Brush Co., Franklin Park, IL, USA) with nitrogen as a vehicle. Pellet feed for the control treatment was sprayed with alkaline ethanol solution only.
Adult fathead minnows were placed in 38 l aquaria, with one adult male and one adult female per aquarium (n=8–16 pairs per treatment group). Each aquarium also contained a 10.2 cm diameter clay pot that was split longitudinally to provide spawning substrate for the pair. Minnow pairs were fed methimazole, T3, or control pellet feed (0.3 g/pair per day) once per day between 0900 and 1100 h for 10 days, to generate approximate doses of methimazole (0.75 mg/pair per day) and T3 (0.03 mg/pair per day) comparable with those used previously with coho salmon (Oncorhynchus kisutch; Larsen et al. 1997). Each pair was also given two additional feedings of frozen Artemia brine shrimp twice per day, between the hours of 1400–1500 and 1700–1800. Spawning activity during the 10-day period was monitored each morning ∼3 h after the start of the light photoperiod by checking the spawning clay pot substrate and counting the number of eggs present.
After the 10 days of dietary exposure to methimazole or T3, minnows were euthanized (tricaine methanesulfonate, MS222; Argent Chemical, Redmond, WA, USA), and body mass (g) and fork length (mm) measured. Plasma was collected, and the pituitary gland, brain, liver, and gonads were dissected. The gonads were weighed separately to determine gonadosomatic index (GSI) as calculated by the following formula: (tissue mass/(body mass−tissue mass))×100. The pituitary, brain, liver, and one gonad were frozen rapidly in liquid nitrogen. All tissues were stored at −80 °C. The other gonad was immersed in Bouin's fixative for histological staging.
T4 and T3 RIAs
Plasma concentrations of thyroxine (T4) and T3 were measured by RIA as described previously (Dickhoff et al. 1982). Anti-l-T4 serum (1:4000) and anti-l-T3 serum (1:10 000) were obtained from Accurate Chemical & Scientific Corp. (Westbury, NY, USA). The intra-assay coefficient of variation was 4.52% for the T4 assay and 4.77% for the T3 assay. Serial dilutions of plasma were parallel to the standard curve for both assays.
Reverse transcription
Total RNA was extracted from the pituitary using the MiniPrep RNeasy Kit (Qiagen, Inc.), and from the brain, liver, and gonads using Tri-Reagent (Molecular Research Center, Cincinnati, OH, USA). Extracted RNA was quantified by spectrophotometry (NanoDrop Technologies, Wilmington, DE, USA), and diluted to 15 ng/μl. Total RNA was reverse transcribed (RT) in 15 μl reactions containing 3.0 μl 5×buffer and 1.5 μl of 0.1 M dithiothreitol (Invitrogen), 0.75 μl dNTP (stock of 10 mM each of dCTP, dGTP, dTTP, and dATP) and 0.255 μl random hexamer (500 ng/μl stock, Promega), 0.3 μl RNase inhibitor (20 U/μl, Applied Biosystems, Inc., Foster City, CA, USA), 0.1875 μl Superscript II Reverse Transcriptase (200 U/μl, Invitrogen), 6.0375 μl ddH2O (nuclease-free water, Sigma), and 3.0 μl of total RNA template (15 ng/μl). All RT reactions were performed in 96-well plates on a thermal cycler (iCycler, Bio-Rad Laboratories Inc.) under a thermal profile of 25 °C for 10 min, 48 °C for 60 min, and 95 °C for 5 min.
Real-time quantitative RT-PCR assays
Primers and Taqman probes for real-time quantitative RT-PCR assays were designed to tshβ (Genbank accession no. DQ677879; Lema et al. 2008b), gphα (Genbank accession no. DQ256072; Villeneuve et al. 2007), trα (Genbank accession no. DQ074645) and trβ (Genbank accession no. AY533142; Filby & Tyler 2007), and bteb (Genbank accession no. EF432310; Lema et al. 2008a) from fathead minnow (Table 1). Primers and probes for all quantitative RT-PCRs were designed using Primer Express software (ABI) and synthesized by Integrated DNA Technologies (Coralville, IA, USA).
Nucleotide sequences for primers and Taqman probes used in quantitative real-time reverse transcription-PCR
| Primer or probe | Sequence | Amplicon size (bp) | PCR efficiency (average) | |
|---|---|---|---|---|
| Transcript | ||||
| tshβ | Forward primer (5′–3′) | GGTGCAGCCTCTCTGAACCA | 73 | 2.0022 |
| Probe (5′–3′) | AACGAGGACCCACCAACTCCTTCACA | |||
| Reverse primer (5′–3′) | CTTCTGCTTCTCCAGGGACAGT | |||
| gphα | Forward primer (5′–3′) | CACCCCTGAGGTCCAAGAAA | 72 | 2.0373 |
| Probe (5′–3′) | CCATGCTCGTTCCCAAAAATATCACATCA | |||
| Reverse primer (5′–3′) | TGGCAACACAGCATGTAGCTT | |||
| trα | Forward primer (5′–3′) | TGCAGGCTGTACTCCTCATGA | 83 | 2.0360 |
| Probe (5′–3′) | AGATCGTTCTGGACTGACATGTGTGGAAAAGAT | |||
| Reverse primer (5′–3′) | CAGGTACGTCTCCTGACACTTCTC | |||
| trβ | Forward primer (5′–3′) | TTGCTCCAAGCCGTGATTCT | 74 | 2.0477 |
| Probe (5′–3′) | CTTTCCTCTGATCGTCCAGGTTTAACGAGC | |||
| Reverse primer (5′–3′) | TGACAACGCTCTATCCGCTCTA | |||
| bteb | Forward primer (5′–3′) | CAAACCGGCGTAAAGGAAAA | 70 | 1.9880 |
| Probe (5′–3′) | CGGGAGAAATGCAGGGTGAAAAGGAC | |||
| Reverse primer (5′–3′) | CATGCAGTCTGTCACAGTTCCA |
Quantitative RT-PCRs were run in 25 μl volumes with each reaction containing 12.5 μl Master Mix (ABI Universal MasterMix Reagent), 0.5 μl forward primer (45 μM), 0.5 μl reverse primer (45 μM), 0.5 μl probe (10 μM), 8.0 μl ddH2O (nuclease-free water, Sigma), and 3.0 μl of RT cDNA template. Reactions were run on an ABI 7700 Sequence Detector under a PCR thermal profile of 50 °C for 2 min, 95 °C for 10 min, and then 40–45 cycles of 95 °C for 15 s and 60 °C for 1 min. All samples for each gene were run on a single 96-well plate. For each gene measured, we tested for DNA contamination by analyzing total RNA samples that were not RT; no amplification was observed in any of these samples over 45 cycles. Serial dilution of a single total RNA from the experiment was used as a standard curve reference, and correlation coefficients of the standard curves ranged from 0.98 to 1.00. PCR efficiencies for each gene were calculated from the standard curves using the following formula: E=10(−1/slope) (Rasmussen 2000) and are presented in Table 1. All standard curve samples were run in triplicate, while experimental samples themselves were not run in duplicate. Each run included duplicate samples lacking cDNA template to further check for DNA contamination during RNA preparation. As an internal reaction control for each gene of interest, we quantified transcript levels of 18s (QuantumRNA Universal 18s, ABI). Within each tissue, transcript levels of 18s were similar across all treatments and sexes. Transcript levels for genes of interest were calculated using the serially diluted standard curve and were expressed relative to 18s mRNA levels in the given sample. The relative level of gene transcript was then calculated by dividing the above values by the mean of the male control group (Pfaffl 2001). This calculation provides a clear representation of the relative changes in expression of each gene among treatments and sexes.
Gonad histology
Gonad samples were immersed in Bouin's fixative (24 h), transferred to 70% ethanol, dehydrated through a graded series of ethanol, embedded in paraffin, and sectioned longitudinally (5 μm). Gonad stages were quantified from three tissue sections from each gonad; the first section was collected approximately halfway through the tissue with two additional sections collected at subsequent 200 μm intervals. Sections were stained with hematoxylin and eosin, and gonadal stages of spermatogenesis and oogenesis were quantified by stereology as described previously (Leino et al. 2005).
Statistical analyses
Two-factor ANOVA models with treatment, sex, and treatment×sex interaction as factors were used to examine whether methimazole or exogenous T3 affected plasma total T4 and T3. For each tissue, we used two-factor ANOVAs with treatment and sex as factors to determine whether mRNA levels of tshβ and gphα in the pituitary gland, and of trα and trβ in the brain, liver, and gonad, varied by treatment and/or sex. When a significant effect of treatment was found, multiple pairwise comparisons were made between the control and each treatment using Dunnett's tests. Transcript and hormone values that failed to conform to the assumptions of normality were square root transformed prior to analysis. Sample values that exceeded three s.d.s from the mean were considered outliers and excluded.
One-factor ANOVA models were used to test for differences in spawning frequency and the mean number of eggs produced. We then used χ2 tests to compare the mean distribution of stages of spermatogenesis or oogenesis between treatments. Exact P values for the χ2 tests were obtained using StaTable 1.0.1 (Cytel Software Corp., Cambridge, MA, USA). To identify which stages were generating treatment differences, we conducted multiple pairwise comparisons (t-tests) between the control and each treatment within each stage class. Critical probability levels (α) for these t-tests were Bonferroni corrected for the total number of pairwise comparisons within a sex. The relationship between gonad staging and the time since last spawning was examined using ANCOVA models, as was the relationship between gonad staging and relative transcript abundance.
Results
Plasma THs
Plasma total T4 levels were reduced by methimazole in both sexes (Fig. 1A; treatment, P<0.0001; treatment×sex interaction, P=0.039). T4 levels also differed between the sexes, with males having higher levels than females (P=0.029). Dietary T3 intake elevated plasma total T3 in males and females (Fig. 1B; treatment, P<0.0001; treatment×sex interaction, P<0.0001), although males had greater levels of total T3 than females across all treatments (P<0.0001).
Dietary intake of methimazole and T3-altered peripheral levels of total T4 (A) and total T3 (B). Methimazole depressed total T4 in males and females, while exogenous T3 significantly elevated total T3 in plasma in both sexes. *P<0.05; **P<0.005; ***P<0.0001, compared with control of same sex.
Citation: Journal of Endocrinology 202, 1; 10.1677/JOE-08-0472
TH regulates pituitary genes encoding thyrotropin
Gene transcripts for tshβ in the pituitary gland were elevated in males and females treated with methimazole (Fig. 2A; P=0.0003). Males also had greater levels of pituitary transcript for tshβ than females (P=0.042). Transcript levels of gphα varied among treatments (Fig. 2B; P=0.049), with a slight elevation in methimazole-treated fish. Levels of gphα mRNA were higher in males than females (P=0.045).
Oral exposure to methimazole elevated relative mRNA levels for thyrotropin β-subunit (tshβ) (A) and glycoprotein hormone α-subunit (gphα) (B) in the pituitary gland. This methimazole-induced increase in gphα mRNA, however, was too minor to be significant in pairwise statistical comparison with the control treatment with that sex. * P<0.05, compared with control of same sex.
Citation: Journal of Endocrinology 202, 1; 10.1677/JOE-08-0472
T3 upregulates trα and trβ mRNAs in brain
In the brain, transcripts for trα (P<0.0001) and trβ (P=0.0002) were elevated by exogenous T3 (Fig. 3A and B); however, the effect on levels of trα mRNA was more pronounced than that of trβ. Transcripts for trα increased by 104%, and for trβ by 26%, in the brain of T3-treated males. In females, T3 induced a 95% increase in trα and 23% elevation in trβ mRNAs. Neither trα nor trβ were affected by treatment with methimazole. Transcript levels for trα did, however, differ between sexes with higher levels in the brain of females than in males (P=0.05). Levels of trβ transcripts were similar between the sexes.
Oral exposure to exogenous T3 significantly altered gene transcripts for thyroid hormone receptor α (trα) (A) and trβ (B) in the brain. The 10-day T3 exposure also resulted in a decline of brain mRNA abundance for basic transcription element-binding protein (bteb) (C). This effect of T3 was pronounced in males, but was not statistically significant in a pairwise comparison with control females (P=0.08). *P<0.05; **P<0.005; ***P<0.0001, compared with control of same sex.
Citation: Journal of Endocrinology 202, 1; 10.1677/JOE-08-0472
Transcript abundance for bteb was reduced 64% in the brain of male minnows by dietary T3 (P<0.0001), but was unaffected in females (Fig. 3C). This sex difference in the response of brain bteb gene expression was reflected as a marginally significant difference in bteb transcript between the sexes (P=0.069).
T3 autoinduces mRNAs for TRs in the liver
Minnows given exogenous T3 had elevated transcripts for trα in the liver relative to control fish (Fig. 4A; P<0.0001). Transcript abundance for trα was similar in the liver of males and females. By contrast, male minnows had higher levels of trβ transcript in the liver than females (P<0.0001), and although exogenous T3 induced elevated mRNA levels for trβ in the liver (Fig. 4B; P<0.0001), the magnitude of the increase varied between sexes (P=0.005). Methimazole did not affect liver trα or trβ transcripts in either sex.
Exogenous T3 increased relative gene transcripts for thyroid hormone receptor α (trα) (A) and for trβ (B) in the liver. *P<0.05; **P<0.005; ***P<0.0001, compared with control of same sex.
Citation: Journal of Endocrinology 202, 1; 10.1677/JOE-08-0472
Gonad transcript abundance, staging, and reproductive behavior
GSI was greater in males than females (P<0.0001), but was not affected by either methimazole or T3. There was no difference among treatments in the frequency of spawning or in the mean number of eggs produced per spawning event. Males exposed to either methimazole or T3 had higher number of cysts containing spermatozoa in their testis compared to control males (Table 2; methimazole versus control: χ2=19.57, P=0.0006; T3 versus control: χ2=21.04, P=0.0003). Males from the methimazole and T3 treatments, however, had similar profiles of spermatogenesis stages in their testes. Females in the methimazole or exogenous T3 treatments had a reduced frequency of cortical alveolus stage oocytes relative to control females (methimazole versus control: χ2=12.02, P=0.007; T3 versus control: χ2=9.68, P=0.022). There was no difference in the distribution of oocytes in various stages of oogenesis between methimazole and T3-treated females.
Mean percentage observed for cyst stages of spermatogenesis and oogenesis in the testis and ovary
| Spermatogonia | 1° Spermatocytes | 2° Spermatocytes | Spermatids | Mature spermatozoa | |
|---|---|---|---|---|---|
| Male | |||||
| Control | 13.6±1.9 | 24.3±4.1 | 31.5±5.2 | 18.7±2.9 | 12.5±1.3 |
| Methimazole | 12.5±2.4 | 19.0±2.3 | 26.7±3.3 | 15.7±1.9 | 27.2±5.5* |
| T3 | 13.7±1.7 | 20.0±2.2 | 20.4±2.9 | 19.1±1.8 | 26.8±5.3* |
| Oogonia | Cortical alveola | Early vitellogenic | Late vitellogenic | ||
|---|---|---|---|---|---|
| Female | |||||
| Control | 29.2±5.9 | 38.3±6.4 | 17.7±3.0 | 14.7±4.7 | |
| Methimazole | 42.8±4.0 | 23.7±3.9* | 19.1±2.5 | 14.3±2.5 | |
| T3 | 37.4±4.2 | 25.2±2.9* | 16.3±1.8 | 21.1±4.4 |
*P<0.05 compared with control group.
In the testis, the proportion of cysts containing germ cells at various stages of spermatogenesis was related to the time since last spawning. The number of spermatogonia decreased (r2=0.38, P=0.041), and cysts containing spermatozoa increased (r2=0.52, P=0.019) with increased days since last spawning. This increase in spermatozoa since last spawning, however, was observed only in control and T3-treated males; males treated with methimazole did not show this same temporal relationship, suggesting that hypothyroidism may inhibit spermatogenesis in adult fish.
There were higher levels of tshβ transcript in testes than ovaries (Fig. 5A; P<0.0001). In response to exogenous T3, transcripts for tshβ were elevated 23% in the testis (P=0.002), but were unaffected in the ovary. Similarly, gphα mRNA levels varied between sexes and were elevated 120% in the testis and 112% in the ovary by T3 (Fig. 5B; treatment, P<0.0001; sex, P<0.0001). Neither methimazole nor T3 had any effect on mRNA levels for trα in either the testis or ovary; trα did, however, show a strong sex difference with transcript levels approximately five times greater in testis than in ovary (Fig. 5C; P<0.0001). By contrast, trβ transcript was induced by T3 in the gonadal tissues of both sexes (Fig. 5D; P<0.0001). In the testis, trβ transcripts were elevated 204% in T3-exposed fish, while in the ovary trβ transcripts were increased 80%. Overall, the levels of trβ transcript were higher in the ovary compared with the testis (P<0.0001).
Exogenous T3 elevated transcript abundance for tshβ in the testis (A), gphα in the testis and ovary (B), and trβ in the testis and ovary (D). Transcript levels for trα were unaffected by either methimazole or T3 treatment (C). #P=0.05, *P<0.05; **P<0.005; ***P<0.0001, compared with control of same sex.
Citation: Journal of Endocrinology 202, 1; 10.1677/JOE-08-0472
Examination of the relationship between relative transcript levels in gonadal tissue and gonadal staging revealed that trβ mRNAs declined as the proportion of 1° and 2° spermatocytes decreased (Fig. 6A), and increased as the proportion of mature spermatozoa in the testis increased (Fig. 6B). The relationships between trβ transcript and gonadal staging were similar in control and methimazole-treated males. In the testis of T3-treated males, however, trβ transcript abundance showed a stronger decline relative to the proportion of 1° and 2° spermatocytes (P=0.036) and an augmented increase relative to the proportion of mature spermatozoa (P=0.029). This result suggests that T3 not only promotes a shift towards more spermatozoa in the testis (Table 2), but also influences trβ transcript abundance independent of T3-induced changes in spermatogenesis staging.
Relative gene transcript levels for thyroid hormone receptor β (trβ) in the testis declined relative to the proportion of 1° and 2° spermatocytes (combined) in the testis (A), and increased with a greater proportion of mature spermatozoa (B).
Citation: Journal of Endocrinology 202, 1; 10.1677/JOE-08-0472
Discussion
THs regulate a variety of cell functions by facilitating or inhibiting gene transcription, yet little is known about gene regulation by THs in adult teleosts. Here, we examined TH regulation of gene transcripts encoding thyrotropin subunits in the pituitary and gonads, trα and trβ in several target tissues, and the transcription factor bteb in the brain using the fathead minnow teleost model. Adult male and female minnows exposed to dietary T3 for a period of 10 days had elevated plasma total T3 levels, whereas dietary methimazole depressed total T4. The fathead minnow has been shown to have sexual dimorphism in peripheral levels of THs (Crane et al. 2004). Accordingly, we observed higher T4 and T3 levels in males than females, although this difference may have been influenced by sex differences in consumption rates of the methimazole and T3-treated food – which was not controlled within a breeding pair. In both sexes, methimazole and T3 treatments did, however, alter peripheral T3 and T4, which then led to changes in mRNA levels for several TH-regulated genes. In the pituitary gland, transcripts for tshβ were elevated in methimazole-treated fish. Male and female minnows also showed changes in mRNAs for trα and trβ in the brain and peripheral tissues. Exogenous T3 enhanced transcript abundance for trα and trβ in the brain of both sexes, while reducing transcript for bteb in males only. T3 also elevated transcripts for trα and trβ in liver of both sexes, and trβ and gphα in testis and ovary.
These results demonstrate that transcripts for tshβ and gphα in the pituitary are upregulated in response to reductions in peripheral T4. The transcriptional dynamics of thyrotropin in the pituitary have been examined in several other teleosts (Larsen et al. 1997, Pradet-Balade et al. 1999, Chatterjee et al. 2001), and our results correspond with the findings of those previous studies. For instance, in adult goldfish (Carassius auratus) pituitary tshβ transcripts were reduced 30% by exogenous T4 treatment, and elevated to twice control levels in fish exposed to the goitrogen thiourea (Yoshiura et al. 1999). Similarly, thiourea depressed circulating T4 and T3 and elevated mRNA abundance for tshβ and gphα in the pituitary of adult European eel, Anguilla anguilla (Pradet-Balade et al. 1997). Taken together, these responses of pituitary thyrotropin transcripts in teleosts indicate the presence of a negative feedback loop, whereby peripheral TH levels regulate thyrotropin production and, ultimately, TH biosynthesis by the thyroid gland. Additional support for this negative feedback comes from studies by Leiner & MacKenzie (2003), who found that red drum (Sciaenops ocellatus) fingerlings, given aqueous T3 exposure (100 ng/ml), had reduced peak levels of plasma total T4 over the diel cycle.
The experimentally induced changes in peripheral THs also altered levels of transcripts for trα and trβ in the brain and liver – and trβ in the gonads – of adult minnows. TRs act as ligand-activated transcription factors by inducing or repressing the transcription of genes containing thyroid response element (TRE)-binding domains in their promoter region (Ribeiro et al. 1998). In amphibians, TR genes themselves contain TREs so that transcription of these genes is autoinduced by T3 (Machuca et al. 1995). In fish, TRs are encoded by at least two genes (Marchand et al. 2001), and two receptor cDNAs (trα and trβ) have been identified in the fathead minnow (Filby & Tyler 2007). The receptor isoforms are expressed in sex, tissue, and developmental-stage-specific patterns in these minnows and in other teleosts (Yamano & Miwa 1998, Nelson & Habibi 2006, Filby & Tyler 2007). In zebrafish (Danio rerio), for instance, trα mRNAs are expressed more highly than trβ transcripts during early embryonic development (Liu et al. 2000). Yet in adults of this species, trβ mRNA levels are greater in the brain, while trα mRNA is more abundant in liver and ovary.
Here, transcripts for trα and trβ were elevated by T3 in the brain and liver of both sexes of fathead minnow. To our knowledge, this is the first demonstration that transcripts for TRs are regulated in vivo by T3 in the brain and liver of adult teleosts. In the context of previous studies in teleosts, the autoinduction of trα and trβ mRNAs by T3 appears consistent across developmental stages after embryogenesis. In zebrafish embryos, trα mRNAs appear to be T3 regulated while trβ is not (Walpita et al. 2007), but in larvae of this species transcripts for trα1 and trβ1 have both been shown to be upregulated in vivo in a dose-dependent manner by T3 (Liu et al. 2000). In Senegalese sole (Solea senegalensis), mRNAs for trβ are elevated during larval metamorphosis, and experimental manipulations revealed that trβ transcript levels increase in response to exogenous T4 – and decrease in response to thiouracil – during the metamorphic transition in this flatfish (Manchado et al. 2009). Transcripts for conger eel (Conger myriaster) trαA and trαB expressed in vitro in eel (A. anguilla) hepatocytes were induced equally by T3 and T4, while transcripts for trβA and trβB were both upregulated more strongly by T3 than T4 (Kawakami et al. 2006). In other vertebrates, TR mRNAs are clearly regulated by THs, but whether these genes are induced or repressed depends on the tissue, receptor isoform, and taxon (Hodin et al. 1990, Kanamori & Brown 1992, Machuca et al. 1995, Sadow et al. 2003). In Xenopus, trβ is autoinduced by T3 in the brain (Krain & Denver 2004), while in mice, T3 inhibits gene transcription for trβ1 and trα2 in the liver, but induces transcription of these genes in the heart (Sadow et al. 2003). To complement these findings from other vertebrate models, our results suggest transcripts for trα and trβ are similarly T3 induced in the brain and liver of adult teleosts.
In the brain, we also found that the 10-day T3 exposure downregulated mRNA abundance for bteb. Female minnows showed a similar trend towards reduced bteb transcript abundance in response to T3, although this effect was not statistically significant (P=0.08). The bteb immediate-early gene encodes a zinc-fingered transcription factor that binds GC-box domains to facilitate or inhibit TH-mediated gene transcription. In mammals, the T3-induced Bteb protein binds the promoter of the trβ gene to regulate trβ autoexpression by THs (Bagamasbad et al. 2008). Bteb has been shown to mediate T3-induced neural differentiation and neurite branching, and these effects on neurogenesis occur via TH activation of trβ (Denver et al. 1999, Cayrou et al. 2002). In Xenopus, bteb mRNA has been shown to be upregulated by T3 in brain and other tissues during metamorphosis (Furlow & Kanamori 2002, Hoopfer et al. 2002), while in mammals, T3 upregulation of bteb appears specific to neurons and is only seen during early developmental stages (Denver et al. 1999). In both amphibian and mammalian tissues, bteb appears to act as an immediate-early gene with T3 upregulation of bteb transcripts occurring rapidly (within 24–72 h; Hoopfer et al. 2002). By contrast, we observed a decline in bteb transcript abundance in the brain of male and female minnows after 10 days of T3 treatment. Given the length of T3 exposure used here, this reduced bteb abundance suggests there could be a refractory response of bteb to the protracted supraphysiological elevation of peripheral T3. Nevertheless, this observation suggests that bteb may be TH regulated in the brain of teleosts, although additional experiments are needed to test whether T3 upregulates bteb transcription over a shorter duration of T3 exposure. Moreover, the question of whether bteb is TH regulated in neural tissues during early teleost development as it is in mammals and amphibians remains to be addressed.
In the gonads, our results provide the first evidence for T3 regulation of TR transcripts in an adult teleost. These data also suggest, however, that TRs may have roles in the gonad, which are distinct from their functions in brain and liver. In both the testis and ovary, we found that trβ mRNA was elevated by T3 treatment, although trβ abundance was greater in ovaries than testes across all exposure groups. This is consistent with previous studies of sexually mature, adult teleosts where ovaries had higher levels of trβ mRNA than testes (Nelson & Habibi 2006, Filby & Tyler 2007). By contrast, trα mRNA was expressed at greater levels in testis than ovary, but was unaffected by T3 in either tissue. The differential regulation of trα and trβ in the gonads likely indicates distinct roles for these two receptors in the regulation of gametogenesis and gonadal function. Little is known about the functions of TRs in the gonads, however, and why trα mRNA was not regulated by THs in these tissues is not clear.
Associations between thyroid status and reproductive function have been known for some time in teleosts (Cyr & Eales 1996), and there is now accruing evidence that THs influence testicular development and spermatogenesis in fish and other vertebrates (Maran 2003, Krassas & Pontikides 2004). In mammals, THs have been shown to regulate Sertoli cell proliferation leading to changes in testis development and, subsequently, sperm production after sexual maturity (Cooke et al. 1991, Francavilla et al. 1991, Maran & Arudhas 2002). The effects of THs on the mammalian testis appear mediated in part via TR-regulated pathways, since knockout of trα1 leads to elevated Sertoli cell number, increased testis mass, and heightened daily sperm production (Holsberger et al. 2005). These influences of THs on testicular function may not be limited to direct effects on the gonad, as neonatal hypothyroidism also alters the development of GnRH neural pathways leading to changes in pituitary gonadotropin secretion (Jansen et al. 2007). Although less well understood, comparable effects of hypothyroidism on testicular function appear to occur in teleosts (Swapna & Senthilkumaran 2007). In the catfish Clarias gariepinus, exogenous T4 reduced plasma and testis testosterone levels and led to fewer spermatids and spermatozoa (Jacob et al. 2005), while 21-day thiourea exposures to pre-spawning males led to narrowed seminiferous tubules and fewer spermatozoa (Swapna et al. 2006). Hypothyroidism during early life has also been shown in teleosts to result in larger mass testis, more Sertoli cells, and increased spermatozoa after maturation (Matta et al. 2002).
There is limited evidence that these effects of THs on testicular function may not occur solely through TR-mediated pathways. Here, we found that T3 induced an elevation in tshβ transcript in the testis, indicating this gene is TH regulated in this tissue. We also observed that variation in testis tshβ transcript abundance was associated with progression of spermatogenesis, with higher tshβ mRNA levels in testes with a greater proportion of mature spermatozoa. Receptors for Tsh have recently been identified in the testicular tissues of several species of teleost fishes, and transcripts for the receptor appear to be localized to the gametes in at least one of these species (Kumar et al. 2000, Goto-Kazeto et al. 2003, Rahman et al. 2003, Vischer & Bogerd 2003, Rocha et al. 2007). Transcripts for tshβ have also been shown by RT-PCR and in situ hybridization to be present in the testis of another adult teleost: the red-spotted grouper, Epinephelus akaara (Wang et al. 2004). This species experiences environmentally induced sex change, and Wang et al. (2004) observed increases in tshβ transcript abundance when the gonadal tissue shifted from ovarian to testicular cell types as individuals changed sex from female to male. Transcripts for tshβ in these male grouper were localized to spermatogonia and spermatocytes. While the role of Tsh in the gonads clearly requires further study, our observation that testicular – but not ovarian – tshβ mRNA is upregulated by T3 suggests Tshβ protein may be important to the TH-mediated effects on testicular function and spermatogenesis.
In summary, these results provide the first systematic assessment of TH gene regulation in an adult teleost – the fathead minnow – a species that is commonly used as a model for assessing the endocrine-disrupting effects of chemicals. We observed that gene transcripts (tshβ and gphα) encoding thyrotropin in the pituitary gland were TH regulated as part of a negative feedback loop. Our findings also show that transcripts for trα and trβ are T3 induced in the brain, and provide preliminary evidence that bteb transcription may be T3 regulated in neural tissues of teleosts as it is in amphibians and mammals. Transcripts for trα and trβ were similarly upregulated by T3 in the liver of both male and female minnows, while only trβ was T3 regulated in the gonads. Taken together, these results provide new insights into TH regulation of TR gene transcripts in target tissues of adult teleost fishes, while also identifying transcripts that may have application as endpoints for evaluating pollutant-induced disruption of the HPT axis in teleost models.
Declaration of interest
The authors declare that they have no conflict of interest that would prejudice the impartiality of results presented in this manuscript.
Funding
This publication was supported by the West Coast Center for Oceans and Human Health (WCCOHH) as part of the NOAA Oceans and Human Health Initiative. The WCCOHH is part of the National Marine Fisheries Service's Northwest Fisheries Science Center, Seattle, WA, USA.
Acknowledgements
The authors thank Ann Skillman, Adam Luckenbach, Larissa Felli, Kathy Cooper, and Walt Dickhoff for their technical assistance, and Robert Denver for helpful discussion of data presented in this manuscript.
References
Ankley GT & Johnson RD 2004 Small fish models for indentifying and assessing the effects of endocrine-disrupting chemicals. ILAR Journal 45 469–483.
Ankley GT & Villeneuve DL 2006 The fathead minnow in aquatic toxicology: past, present and future. Aquatic Toxicology 78 91–102.
Bagamasbad P, Howdeshell KL, Sachs LM, Demeneix BA & Denver RJ 2008 A role for basic transcription element-binding protein 1 (BTEB 1) in the autoinduction of thyroid hormone receptor β. Journal of Biological Chemistry 283 2275–2285.
Blanton ML & Specker JL 2007 The hypothalamic–pituitary–thyroid (HPT) axis in fish and its role in fish development and reproduction. Critical Reviews in Toxicology 37 97–115.
Brown DD 1997 The role of thyroid hormone in zebrafish and axolotl development. PNAS 94 13011–13016.
Brown SB, Adams BA, Cry DG & Eales JG 2004 Contaminant effects on the teleost fish thyroid. Environmental Toxicology and Chemistry 23 1680–1701.
Cayrou C, Denver RJ & Puymirat J 2002 Suppression of the basic transcription element-binding protein in brain neuronal cultures inhibits thyroid hormone-induced neurite branching. Endocrinology 143 2242–2249.
Chatterjee A, Hsieh Y-L & Yu JYL 2001 Molecular cloning of cDNA encoding thyroid stimulating hormone β subunit of bighead carp Aristichthys nobilis and regulation of its gene expression. Molecular and Cellular Endocrinology 174 1–9.
Cooke PS, Hess RA, Porcelli J & Meisami E 1991 Increased sperm production in adult rats after transient neonatal hypothyroidism. Endocrinology 129 244–248.
Crane HM, Pickford DB, Hutchinson TH & Brown JA 2004 Developmental changes of thyroid hormones in the fathead minnow, Pimephales promelas. General and Comparative Endocrinology 139 55–60.
Crofton KM 2008 Thyroid disrupting chemicals: mechanisms and mixtures. International Journal of Andrology 31 209–223.
Cyr DG & Eales JG 1996 Interrelationships between thyroidal and reproductive endocrine systems in fish. Reviews in Fish Biology and Fisheries 6 165–200.
Denver RJ, Ouellet L, Furling D, Kobayashi A, Fujii-Kuriyama Y & Puymirat J 1999 Basic transcription element-binding protein (BTEB) is a thyroid hormone-regulated gene in the developing central nervous system. Journal of Biological Chemistry 274 23128–23134.
Dickhoff WW, Folmar LC, Mighell JL & Mahnken CVW 1982 Plasma thyroid hormones during smoltification of yearling and underyearling coho salmon and yearling Chinook salmon and steelhead trout. Aquaculture 28 39–48.
Edeline E, Bardonnet A, Bolliet V, Dufour S & Pierre E 2005 Endocrine control of Anguilla anguilla glass eel dispersal: effect of thyroid hormones on locomotor activity and rheotactic behavior. Hormones and Behavior 48 53–63.
Filby AL & Tyler CR 2007 Cloning and characterization of cDNAs for hormones and/or receptors of growth hormone, insulin-like growth factor-I, thyroid hormone, and corticosteroid and the gender-, tissue-, and developmental-specific expression of their mRNA transcripts in fathead minnow (Pimephales promelas). General and Comparative Endocrinology 150 151–163.
Francavilla S, Cordeschi G, Properzi G, Di Cicco L, Jannini EA, Palmero S, Fugassa E, Loras B & D'Armiento M 1991 Effect of thyroid hormone on the pre- and postnatal development of the rat testis. Journal of Endocrinology 129 35–42.
Furlow JD & Kanamori A 2002 The transcription factor basic transcription element-binding protein 1 is a direct thyroid hormone response gene in the frog Xenopus laevis. Endocrinology 143 3295–3305.
Goto-Kazeto R, Kazeto Y & Trant JM 2003 Cloning and seasonal changes in ovarian expression of a TSH receptor in the channel catfish, Ictalurus punctatus. Fish Physiology and Biochemistry 28 339–340.
Hodin RA, Lazar MA & Chin WW 1990 Differential and tissue-specific regulation of the multiple rat c-erbA messenger RNA species by thyroid hormone. Journal of Clinical Investigation 85 101–105.
Holsberger DR, Kiesewetter SE & Cooke PS 2005 Regulation of neonatal sertoli cell development by thyroid hormone receptor α1. Biology of Reproduction 73 396–403.
Hoopfer ED, Huang L & Denver RJ 2002 Basic transcription element binding protein is a thyroid hormone-regulated transcription factor expressed during metamorphosis in Xenopus laevis. Development, Growth and Differentiation 44 365–381.
Huang L, Specker JL & Bengtson DA 1996 Effect of triiodothyronine on growth and survival of larval striped bass (Morone saxatilis). Fish Physiology and Biochemistry 15 57–64.
Jacob TN, Pandey JP, Raghuveer K, Sreenivasulu G, Gupta AD, Yoshikuni M, Jagota A & Senthilkumaran B 2005 Thyroxine-induced alterations in the testis and seminal vesicles of air-breathing catfish, Clarias gariepinus. Fish Physiology and Biochemistry 31 271–274.
Jansen HT, Kirby JD, Cooke PS, Arambepola N & Iwamoto GA 2007 Impact of neonatal hypothyroidism on reproduction in the male hamster, Mesocricetus auratus. Physiology and Behavior 90 771–781.
de Jesus EGT, Toledo JD & Simpas MS 1998 Thyroid hormones promote early metamorphosis in grouper (Epinephelus coioides) larvae. General and Comparative Endocrinology 112 10–16.
Kanamori A & Brown DD 1992 The regulation of thyroid hormone receptor β genes by thyroid hormone in Xenopus laevis. Journal of Biological Chemistry 267 739–745.
Kang D-Y & Chang YJ 2004 Effects of maternal injection of 3,5,3′-triiodo-l-thyronine (T3) on growth of newborn offspring of rockfish, Sebastes schlegeli. Aquaculture 234 641–655.
Kawakami Y, Shin D-H, Kitano T, Adachi S, Yamauchi K & Ohta H 2006 Transactivation activity of thyroid hormone receptors in fish (Conger myriaster) in response to thyroid hormones. Comparative Biochemistry and Physiology, Part B 144 503–509.
Krain LP & Denver RJ 2004 Developmental expression and hormonal regulation of glucocorticoid and thyroid hormone receptors during metamorphosis in Xenopus laevis. Journal of Endocrinology 181 91–104.
Krassas GE & Pontikides N 2004 Male reproductive function in relation with thyroid alterations. Best Practice and Research. Clinical Endocrinology and Metabolism 18 183–195.
Kumar RS, Ijiri S, Kight K, Swanson P, Dittman A, Alok D, Zohar Y & Trant JM 2000 Cloning and functional expression of a thyrotropin receptor from the gonads of a vertebrate (bony fish): potential thyroid-independent role for thyrotropin in reproduction. Molecular and Cellular Endocrinology 167 1–9.
Larsen DA, Dickey JT & Dickhoff WW 1997 Quantification of salmon α- and thyrotropin (TSH) β-subunit messenger RNA by an RNase protection assay: regulation by thyroid hormones. General and Comparative Endocrinology 107 98–108.
Leiner KA & MacKenzie DS 2003 Central regulation of thyroidal status in a teleost fish: nutrient stimulation of T4 secretion and negative feedback of T3. Journal of Experimental Zoology 298A 32–43.
Leino RL, Jensen KM & Ankley GT 2005 Gonadal histology and characteristic histopathology associated with endocrine disruption in the adult fathead minnow (Pimephales promelas). Environmental Toxicology and Pharmacology 19 85–98.
Lema SC & Nevitt GA 2004 Evidence that thyroid hormone induces olfactory cellular proliferation in salmon during a sensitive period for imprinting. Journal of Experimental Biology 207 3317–3327.
Lema SC & Nevitt GA 2006 Testing an ecophysiological mechanism of morphological plasticity in pupfish and its relevance to conservation efforts for endangered Devils Hole pupfish. Journal of Experimental Biology 209 3499–3509.
Lema SC, Dickey JT, Schultz IR & Swanson P 2008a Dietary exposure to 2,2′,4,4′-tetrabromodiphenyl ether (PBDE 47) alters thyroid status and thyroid hormone-regulated gene expression in the pituitary and brain. Environmental Health Perspectives 116 1694–1699.
Lema SC, Dickey JT & Swanson P 2008b Molecular cloning and sequence analysis of multiple cDNA variants for thyroid-stimulating hormone β subunit (TSHβ) in the fathead minnow (Pimephales promelas). General and Comparative Endocrinology 155 472–480.
Liu Y-W, Lo L-J & Chan W-K 2000 Temporal expression and T3 induction of thyroid hormone receptors α1 and β1 during early embryonic and larval development in zebrafish, Danio rerio. Molecular and Cellular Endocrinology 159 187–195.
Machuca I, Esslemont G, Fairclough L & Tata JR 1995 Analysis of structure and expression of the Xenopus thyroid hormone receptor, β (xTRβ) gene to explain its autoregulation. Molecular Endocrinology 9 96–107.
Manchado M, Infante C, Rebordinos L & Cañavate JP 2009 Molecular characterization, gene expression and transcriptional regulation of thyroid hormone receptors in Senegalese sole. General and Comparative Endocrinology 160 139–147.
Maran RRM 2003 Thyroid hormones: their role in testicular steroidogenesis. Archives of Andrology 49 375–388.
Maran RRM & Arudhas MM 2002 Adverse effects of neonatal hypothyroidism on Wistar rat spermatogenesis. Endocrine Research 28 141–154.
Marchand O, Safi R, Escriva H, Van Rompaey E, Prunet P & Laudet V 2001 Molecular cloning and characterization of thyroid hormone receptors in teleost fish. Journal of Molecular Endocrinology 26 51–65.
Marchand O, Duffraisse M, Triqueneaux G, Safi R & Laudet V 2004 Molecular cloning and developmental expression patterns of thyroid hormone receptors and T3 target genes in the turbot (Scophtalmus maximus) during post-embryonic development. General and Comparative Endocrinology 135 345–357.
Matta SLP, Vilela DAR, Godinho HP & França LR 2002 The goitrogen 6-n-propyl-2-thiouracil (PTU) given during testis development increases sertoli and germ cell numbers per cyst in fish: the tilapia (Oreochromis niloticus) model. Endocrinology 143 970–978.
McCormick SD, Hansen LP, Quinn TP & Saunders RL 1998 Movement, migration, and smolting of Atlantic salmon (Salmo salar). Canadian Journal of Fisheries and Aquaculture Sciences 55 77–92.
Nelson ER & Habibi HR 2006 Molecular characterization and sex-related seasonal expression of thyroid receptor subtypes in goldfish. Molecular and Cellular Endocrinology 253 83–95.
Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 2002–2007.
Picard-Aitken M, Fournier H, Pariseau R, Marcogliese DJ & Cyr DG 2007 Thyroid disruption in walleye (Sander vitreus) exposed to environmental contaminants: cloning and use of iodothyronine deiodinases as molecular biomarkers. Aquatic Toxicology 83 200–211.
Power DM, Llewellyn L, Faustino M, Nowell MA, Björnsson BTH, Einarsdottir IE, Canario AVM & Sweeney GE 2001 Thyroid hormones in growth and development of fish. Comparative Biochemistry and Physiology, Part C 130 447–459.
Pradet-Balade B, Schmitz M, Salmon C, Dufour S & Quérat B 1997 Down-regulation of TSH subunit mRNA levels by thyroid hormones in the European eel. General and Comparative Endocrinology 108 191–198.
Pradet-Balade B, Burel C, Dufour S, Boujard T, Kaushik SJ, Quérat B & Boeuf G 1999 Thyroid hormones down-regulate thyrotropin β mRNA level in vivo in the turbot (Psetta maxima). Fish Physiology and Biochemistry 20 193–199.
Rahman MA, Ohta K, Yamaguchi A, Chuda H, Hirai T & Matsuyama M 2003 Gonadotropins, gonadotropin receptors and their expressions during sexual maturation in yellowtail, a carangid fish. Fish Physiology and Biochemistry 28 81–83.
Rasmussen R 2000 Quantification on the LightCycler. In Rapid Cycle Real-time PCR, Methods and Applications, pp 21–34. Eds Meuer S, Wittwer C, Nakagaqara K. Heidelberg: Springer Press.
Reddy PK & Lam TJ 1992 Effect of thyroid hormones on morphogenesis and growth of larvae and fry of telescopic-eye black goldfish, Carassius auratus. Aquaculture 107 383–394.
Ribeiro RCJ, Apriletti JW, Wagner RL, West BL, Feng WJ, Huber R, Kushner PJ, Nilsson S, Scanlan T & Fletterick RJ et al. 1998 Mechanisms of thyroid hormone action: insights from X-ray crystallographic and functional studies. Recent Progress in Hormone Research 53 351–394.
Rocha A, Gómez A, Galay-Burgos M, Zanuy S, Sweeney GE & Carrillo M 2007 Molecular characterization and seasonal changes in gonadal expression of a thyrotropin receptor in the European sea bass. General and Comparative Endocrinology 152 89–101.
Sadow PM, Chassande O, Koo EK, Gauthier K, Samarut J, Xu J, O'Malley BW & Weiss RE 2003 Regulation of expression of thyroid hormone receptor isoforms and coactivators in liver and heart by thyroid hormone. Molecular and Cellular Endocrinology 203 65–75.
Shiao JC & Hwang PP 2006 Thyroid hormones are necessary for the metamorphosis of tarpon Megalops cyprinoides leptocephali. Journal of Experimental Marine Biology and Ecology 331 121–132.
Swapna I & Senthilkumaran B 2007 Thyroid hormones modulate the hypothalamo–hypophyseal–gonadal axis in teleosts: molecular insights. Fish Physiology and Biochemistry 33 335–345.
Swapna I, Rajasekhar M, Supriya A, Raghuveer K, Sreenivasulu G, Rasheeda MK, Majumdar KC, Kagawa H, Tanaka H & Dutta-Gupa A et al. 2006 Thiourea-induced thyroid hormone depletion impairs testicular recrudescence in the air-breathing catfish, Clarias gariepinus. Comparative Biochemistry and Physiology, Part A 144 1–10.
Tagawa M & Aritaki M 2005 Production of symmetrical flatfish by controlling the timing of thyroid hormone treatment in spotted halibut Verasper variegatus. General and Comparative Endocrinology 141 184–189.
Trijuno DD, Yoseda K, Hirokawa J, Tagawa M & Tanaka M 2002 Effects if thyroxine and thiourea on the metamorphosis of coral trout grouper Plectropomus leopardus. Fisheries Science 68 282–289.
USEPA 2002 A Short-Term Method for Assessing the Reproductive and Developmental Toxicity of Endocrine-Disrupting Chemicals Using the Fathead Minnow (Pimephales promelas). EPA-600/R-01/067. Cincinnati, OH: USEPA..
Villeneuve DL, Miracle AL, Jensen KM, Degitz SJ, Khal MD, Korte JJ, Greene KJ, Blake LS, Linnum A & Ankley GT 2007 Development of quantitative real-time PCR assays for fathead minnow (Pimephales promelas) gonadotropin β subunit mRNAs to support endocrine disruptor research. Comparative Biochemistry and Physiology, Part C 145 171–183.
Vischer HF & Bogerd J 2003 Cloning and function characterization of a testicular TSH receptor cDNA from the African catfish (Clarias gariepinus). Journal of Molecular Endocrinology 30 227–238.
Walpita CN, Van der Geyten S, Rurangwa E & Darras VM 2007 The effect of 3,5,3′-triiodothyronine supplementation on zebrafish (Danio rerio) embryonic development and expression of iodothyronine deiodinases and thyroid hormone receptors. General and Comparative Endocrinology 152 206–214.
Wang Y, Zhou L, Yao B, Li C-J & Gui J-F 2004 Differential expression of thyroid-stimulating hormone β subunit in gonads during sex reversal of orange-spotted and red-spotted groupers. Molecular and Cellular Endocrinology 220 77–88.
Yamano K 2005 The role of thyroid hormone in fish development with reference to aquaculture. Japanese Agricultural Research Quarterly 39 161–168.
Yamano K & Miwa S 1998 Differential gene expression of thyroid hormone receptor α and β in fish development. General and Comparative Endocrinology 109 75–85.
Yoshiura Y, Sohn YC, Munakata A, Kobayashi M & Aida K 1999 Molecular cloning of the cDNA encoding the β subunit of thyrotropin and regulation of its gene expression by thyroid hormones in the goldfish, Carassius auratus. Fish Physiology and Biochemistry 21 201–210.
