Abstract
Pregnancy-associated plasma protein-A and -A2 (PAPPA and PAPPA2) are proteases that cleave IGF binding proteins (IGFBPs) and thereby increase the bioavailability of growth factors. PAPPA has long been recognized as a marker of fetal genetic disorders and adverse pregnancy outcomes. In contrast, although PAPPA2 is also highly expressed in human placenta, its physiological importance is not clear. To establish whether mice will be a useful model for the study of PAPPA2, we compared the patterns of expression of PAPPA2 in the placentae of mouse and human. We show, for the first time, that Pappa2 is highly expressed in mouse placenta, as is the case in humans. Specifically, it is expressed at the interface of the maternal and fetal layers of the mouse placenta at all gestational stages studied (10.5–16.5 days post coitum). Similarly, PAPPA2 is expressed in the syncytiotrophoblast layer of human placental villi and is also detected in some invasive extravillous trophoblasts in the first trimester. These results are consistent with a model whereby PAPPA2 cleaves IGFBPs produced in the maternal decidua to promote feto-placental growth, and indicate that this protein may play analogous roles in human and mouse placenta. PAPPA2 protein is detectable in the circulation of pregnant mice and humans during the first trimester and at term, raising the possibility that PAPPA2 may be a useful biomarker of placental dysfunction. Pappa2 expression also shows specific localization within the mouse embryo and therefore may play roles in fetal development, independent of its action in the placenta.
Introduction
The placenta acts as the interface between fetus and mother during gestation (Cross et al. 1994). Abnormal placental development leads to serious consequences for both fetal and maternal health, such as intrauterine growth restriction (IUGR; Jackson et al. 1995, Salafia et al. 1995), and preeclampsia (Redman & Sargent 2005). During the formation of the placenta in primates and rodents, the epithelium of the uterus is eroded by embryonic trophoblasts, which eventually leads to direct contact between maternal blood and fetal trophoblastic villi, facilitating efficient diffusion between maternal and fetal blood (Rossant & Cross 2001). The invasive action of trophoblasts is promoted by growth factors, the bioavailability of which is aided by proteases (Lala & Hamilton 1996, Salamonsen 1999). One of the critical proteases involved in normal placental development is pregnancy-associated plasma protein-A (PAPPA; Sun et al. 2002), which is produced by human trophoblasts (Tornehave et al. 1984) where it is the major proteolytic enzyme cleaving insulin-like growth factor binding protein-4 (IGFBP4; Boldt & Conover 2007). Degradation of IGFBP4 by PAPPA leads to the release of insulin-like growth factor II (IGF-II; Giudice et al. 1998, 2002), which promotes the development of the placenta through its positive influence on trophoblast invasion as well as growth and permeability of this highly specialized organ (Constancia et al. 2002). Moreover, PAPPA is secreted into the maternal circulation (Folkersen et al. 1981), and can be a useful marker for certain diseases and pregnancy complications. For example, unusually low levels of PAPPA in the first trimester may be indicative of increased risk of fetal genetic disorders such as Down's syndrome (Brambati et al. 1993) and Cornelia de Lange syndrome (Aitken et al. 1999). Furthermore, low circulating PAPPA levels are also associated with higher risk of low birth weight, IUGR, and preeclampsia (Smith et al. 2002, Kwik & Morris 2003, Dugoff et al. 2004, Spencer et al. 2008), which are characterized by impaired trophoblast invasion. Although PAPPA is highly expressed in human placenta (Tornehave et al. 1984), this is not the case in the mouse (Qin et al. 2002, Soe et al. 2002). Nevertheless, Pappa plays an important role in fetal development as Pappa-deficient mice show delayed and impaired growth (Conover et al. 2004).
Recently, another protease similar to PAPPA has been identified (Farr et al. 2000, Overgaard et al. 2001, Page et al. 2001) and designated as PAPPA2 (earlier names included PAPP-E and Plac3). Like PAPPA, PAPPA2 is abundantly expressed in the human placenta (Farr et al. 2000, Page et al. 2001), and also cleaves an IGFBP (Overgaard et al. 2001). Unlike PAPPA, which proteolyses both IGFBP4 and IGFBP5 (Boldt et al. 2004), PAPPA2 cleaves IGFBP5 and may also show lower proteolytic activity against IGFBP3 (Overgaard et al. 2001). Although the physiological functions of PAPPA2 have not been studied, at least four recent studies have found PAPPA2 to be upregulated in hypertensive disorders of pregnancy including preeclampsia and hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome (Buimer et al. 2008, Nishizawa et al. 2008, Sitras et al. 2009, Winn et al. 2009).
Understanding the role of PAPPA2 in placental growth and development may further enhance our knowledge of disorders such as preeclampsia and IUGR and lead to improvements in diagnosis and therapeutic interventions. Animal models are needed to elucidate the physiological roles of PAPPA2 in the placenta in health and disease (Rossant & Cross 2001, Sapin et al. 2001, Cross 2003). Therefore, the primary goal of the current study was to examine and compare the expression and localization of PAPPA2 in mouse and human placentae. A secondary goal was to determine its location of expression in mouse embryo.
Materials and Methods
Sample collection
Mice (Charles River Laboratories, Saint-Constant, Quebec, Canada) were housed in the Animal Care Facility at SFU, and all procedures were in accordance with the guidelines of the Canadian Council on Animal Care. Six CD1 female mice were time-mated with CD1 studs, and the day the seminal fluid plug was found was designated as day 0.5 post-coitus (dpc). On 12.5 dpc, females were killed by CO2 inhalation. Embryos, placentae, stomach, kidneys, and liver were quickly dissected in diethylpyrocarbonate (DEPC)-treated 10×PBS (Nagy et al. 2003), and these samples were immediately either frozen at −20 °C for protein work, fixed in 4% paraformaldehyde (PFA) overnight for in situ hybridization (placentae and embryos only), or placed in RNAlater (Ambion, Foster City, CA, USA) overnight at 4 °C and then stored at −20 °C prior to quantitative PCR. Nonpregnancy serum samples were collected from live mice from the saphenous vein, and pregnancy serum samples were collected from killed mice by cardiac puncture. Blood samples were centrifuged, and serum was collected and stored at −80 °C until further use.
Serum samples were also obtained from three healthy nonpregnant women, three healthy pregnant women during the first trimester, and three at term. This study was approved by The Ottawa Hospital Research Ethics Board, and informed consent was obtained. Upon collection, samples were centrifuged and the serum frozen at −20 °C for later batch analysis. Early placental tissues were obtained from voluntary terminations at 8–12 weeks.
RNA isolation and quantitative PCR
Quantitative PCR was performed to compare expression levels of Pappa2 and Pappa transcripts. Total RNA was extracted from mouse tissues using QIAshredder homogenizers (Qiagen) and RNeasy spin columns (Qiagen) following the manufacturer's instructions. Each sample was standardized to contain 50 ng/μl total RNA, and a reference sample was prepared by combining aliquots of placental samples; this reference sample was included in every assay to account for variation between assays. The relative expression levels of Pappa2 and Pappa in the tissue samples and reference sample were assessed by quantitative PCR with the MJ Mini Thermal Cycler (Bio-Rad) using primers and probes (Integrated DNA Technologies, Coralville, IA, USA) as described in Table 1. The expression of a ‘housekeeping gene’, β-actin (Actb, as given in MGI Database), was also measured. All primers were designed to span introns to avoid detection of genomic DNA. iScript One-Step RT-PCR Kit for Probes (Bio-Rad) was used to reverse-transcribe and amplify the RNA template for 40 cycles, and the cycle at which the signal rose above a fixed threshold (Ct) was determined. The quantitative PCR amplification was performed using 25 μl reaction volumes containing reaction mix (Bio-Rad), Protector RNase Inhibitor (Roche Applied Sciences), 0.5 U iScript RTase, 8.5 μl RNA template (i.e. 425 ng), 0.25 mM each primer, and 175 nM probe. The quantitative PCR program consisted of an initial reverse transcription of 30 min at 50 °C, an initial PCR activation step of 15 min at 95 °C followed by 40 cycles of 1 min at 94 °C, 1 min at 55 °C, and 1 min at 72 °C.
Quantitative PCR primer and probe sequences
| Forward primer | Reverse primer | Probe (contains fluorophore, 6-FAM, on the 5′ end and quencher, BHQ-1, at the 3′ end) | |
|---|---|---|---|
| Gene | |||
| Pappa | CACAATGGACTCTGTGATGCT | TCTCCCTTCTAGGCAAAGGT | TGGTTCCCACCCATCGATGG |
| Pappa2 | GGGACAAGGAAGCTCTCAGT | CAGGGATCATCACAGGATTC | CATGCTTGGCCACACCAACATCATGATCCA |
| β-Actin | CCTGAAAAGATGACCCAGAT | GGTACGACCAGAGGCATACA | ACCTTCAACACCCCAGCCATGT |
Samples were measured in triplicate and the Ct values for Pappa2 and Pappa were normalized to those of β-actin using the Pfaffl method (2001), which involves calculating the efficiency of the PCR for each gene using serial dilutions of samples. Using this method, expression in a sample is calculated relative to the reference sample measured in the same assay to account for variation between assays.
In order to compare transcript levels between Pappa2 and Pappa, we estimated transcript copy number using a standard curve constructed for each gene. cDNA samples corresponding to the regions amplified during quantitative PCR were generated with a One-Step RT-PCR Kit (Qiagen). The DNA concentration of each cDNA sample was measured using a NanoDrop spectrometer, and cDNA copy number was calculated using cDNA concentration and amplicon length (http://www.uri.edu/research/gsc/resources/cndna.html). cDNA samples were then serially diluted and used as template for quantitative PCR to construct the standard curves.
Western blotting
Mouse tissue samples were homogenized in T-PER Tissue Protein Extraction Reagent (Pierce, Rockford, IL, USA) and incubated on ice for 15 min to allow cell lysis. The homogenates were then centrifuged at 16 000 g and supernatant collected and stored at −80 °C until further use. Complete Protease Inhibitor Cocktail (Roche Applied Sciences) was added to all samples (including serum samples) to prevent protein degradation.
Samples containing 30 μg total protein were mixed with 5×SDS loading buffer and boiled for 10 min. Samples and pre-stained molecular weight markers (Precision Plus Protein Prestained Standards, Bio-Rad) were loaded onto a 4% stacking gel and run through an 8% polyacrylamide gel under reducing conditions. The gels were then equilibrated in transfer buffer, and proteins were transferred onto nitrocellulose membranes (Bio-Rad) using a semi-dry transfer machine (Bio-Rad). After transfer, the membranes were rinsed, blocked, and then incubated overnight at 4 °C with 1:1000 polyclonal anti-human PAPPA2 antibody (R&D Systems, Minneapolis, MN, USA). According to the manufacturer, this antibody shows <1% cross-reactivity with PAPPA. Membranes were washed, incubated with 1:10 000 fluorescent-labeled secondary antibody (Li-Cor Biosciences, Lincoln, NE, USA) for 45 min at room temperature, rinsed and scanned with an Odyssey infrared imaging system (Li-Cor Biosciences).
For western blotting of human serum, 0.5 μl aliquots of serum samples were resolved using 7.5% SDS-PAGE under reducing conditions and transferred to nitrocellulose membranes in duplicate. The two membranes were immunoblotted with anti-human PAPPA and PAPPA2 antibodies (R&D Systems), and the bands were visualized using ECL reagents (Thermo Fisher Scientific, Rockford, IL, USA). To confirm the specificity of the PAPPA2 antibody, a recombinant PAPPA2 peptide (amino acids 243–1396; R&D Systems) was included in the gel as a positive control. Furthermore, an additional membrane was blotted with nonpregnant and pregnant serum samples, which were probed with a secondary antibody (HRP conjugated rabbit anti-goat IgG, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) without incubation with PAPPA2 antibody.
Immunohistochemistry
Cross sections of mouse placenta at different stages of pregnancy were obtained from Zyagen (San Diego, CA, USA). Slides were deparaffinized in xylene washes and rehydrated with graded series of ethanol. Antigen retrieval was performed by heating the slides in a microwave for 15 min in citrate buffer (pH 6.0). Sections were then incubated in PBS with 3% H2O2 for 10 min to inactivate endogenous peroxidase. Blocking steps were performed using serum blocking reagent G, avidin blocking reagent, and biotin blocking reagent (R&D Systems), followed by incubation with polyclonal anti-human PAPPA2 or polyclonal anti-mouse IGFBP5 antibody (1:50, R&D Systems) in PBS overnight at 4 °C. After three washes in PBS, samples were incubated with biotinylated secondary antibody (R&D Systems) for 30 min at 37 °C, followed by streptavidin conjugated with HRP, and visualized with 3,3-diamino-benzidine (DAB) substrate (R&D Systems). The slides were then counterstained with hematoxylin. To evaluate the extent of nonspecific immunostaining, primary antibodies were substituted with goat anti-rabbit IgG (1:50; Sigma) as negative controls.
Human placental samples were fixed overnight in 4% PFA–PBS, dehydrated through a graded series of ethanol, and then embedded in paraffin. Adjacent sections (4–5 μm) were deparaffinized in xylene, followed by rehydration in graded series of ethanol concentrations. Sections were washed with PBS and exposed to 15 min of antigen retrieval (400 ml 10 mM citrate buffer, pH 6.0) in the microwave. The inactivation of endogenous peroxidase was performed by the incubation of sections in 3% H2O2 with methanol, followed by blocking solution (50 μl) at room temperature. Adjacent sections were then incubated at 4 °C with primary antibody, polyclonal anti-human PAPPA2 antibody (R&D Systems) in 1×PBS. Biotinylated secondary antibodies were applied to samples for 30 min followed by streptavidin–HRP incubation (40 min) at room temperature. Sections were visualized with DAB or 3-amino-9-ethylcarbazole (AEC) under the light microscope. Counterstaining was performed with hematoxylin stain and sectioned slides were mounted with cytoseal 60. To determine the extent of nonspecific immunostaining, primary antibodies were substituted with goat IgG (at the same concentrations) for negative controls.
To further examine whether extravillous trophoblasts express PAPPA2 at the maternal–fetal interface of human placenta, sections were first stained for cytokeratin 18 (mouse monoclonal antibody, Santa Cruz Biotechnology Inc.), a trophoblast marker, and AEC substrate was used to visualize the immunosignal. After images of typical immunosignals were captured, the sections were destained with 0.1 M HCl in 70% ethanol to remove rose–red insoluble precipitates. To remove previously applied antibodies, sections were treated with double stain blocker (DAKO Corporation, Mississauga, Ontario, Canada). Sections were further immunostained for vimentin (goat polyclonal antibody, Santa Cruz Biotechnology Inc.), a marker of maternal decidual cells, or PAPPA2 (R&D Systems). The vimentin and PAPPA2 immunosignals in these sections were examined in the same field as the previously captured image that showed cytokeratin immunoreactivity, which allowed the examination of different immunosignals in the same cells of the same sections.
Probe synthesis for in situ hybridization
Mouse placental mRNA was reverse transcribed into cDNA using the RevertAid H Minus First Strand cDNA Synthesis kit (Fermentas, Burlington, Ontario, Canada), and 600 bp of the Pappa2 gene was amplified using the following primers: 5′-CAGAGGGAGGACAGAGCAA-3′ and 5′-GTAAAGGTGACAGAATCTCAGG-3′. The 600 bp cDNA was inserted into TA TOPO cloning vector (Invitrogen) and used as template for in vitro transcription. A 660 bp fragment of the Igfbp5 gene was also amplified (forward primer: 5′-ACGAGAAAGCTCTGTCCATGTGTC-3′, reverse primer: 5′-GCTTCATTCCGTACTTGTCCACAC-3′) and cloned into TA TOPO cloning vector. Similarly, a 434 bp fragment of the Igf-II (Igf2 as listed in MGI Database) gene was produced using the following primers: 5′-TTCTCATCTCTTTGGCCTTCGCCT-3′ and 5′-ACGATGACGTTTGGCCTCTCTGAA-3′. Antisense and sense probes were synthesized by either SP6 or T7 RNA polymerase depending on insert orientation. Digoxigenin (DIG)-labeled RNA was subsequently purified by Quick Spin Columns (Roche).
Whole-mount in situ hybridization
The brain cavity and heart of mouse embryos were punctured to facilitate exchange of solutions and avoid probe trapping. Embryos were rehydrated by passage through 75, 50, 25% methanol and twice through PBS containing 0.1% Tween-20 (PBST). To permeabilize tissues, embryos were treated with 10 μg/ml proteinase K in PBST for 35 min at room temperature, and rinsed briefly in PBST containing 2 mg/ml glycine. Post-fixation was in 4% PFA with 0.1% glutaraldehyde for 20 min. After one rinse and one wash in PBST, embryos were equilibrated in 1:1 PBST/hybridization mix at room temperature. Hybridization mix was composed of 50% formamide, pH 5 1.3×SSC (Invitrogen), 5 mM EDTA, 50 μg/ml yeast RNA core particle (Sigma), 0.2% Tween-20, 0.5% CHAPS (Sigma), 100 μg/ml heparin (Sigma) and RNAse-free water, adjusted to pH 8 (Correia & Conlon 2001). Embryos were pre-hybridized at 65 °C for at least 1 h and hybridized for 36 h at 65 °C with 1 μg/ml of either antisense or sense (for negative controls) DIG-labeled RNA probes. After hybridization, embryos were rinsed twice, followed by two 30-min washes with pre-warmed hybridization buffer at 65 °C. The solution was then replaced by 0.1 M maleic acid containing 0.1% Tween-20 (MABT) at room temperature. The embryos were incubated in MABT containing 2% Boehringer Blocking Reagent (BBR; Roche) for 1 h at room temperature with gentle shaking, and the solution was replaced with MABT containing 2% BBR and 20% heat-treated goat serum (Sigma) for at least 1 h. The embryos were subsequently incubated with MABT+2% BBR+20% sheep serum+1/5000 dilution of sheep anti-DIG Fab fragment covalently coupled to alkaline phosphatase (Roche) on rotation overnight at 4 °C. The next day, embryos were rinsed three times with MABT, and washed at least five times for 2–4 h each, and incubated overnight with fresh MABT. To visualize probes bound to the embryo, nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) was added to the detection buffer consisting of 100 mM NaCl, 100 mM Tris (pH 9.5), and 0.1% Tween-20. The embryos were incubated in the solution until color developed. Subsequently, the embryos were rinsed once and washed at least twice with PBST. Embryos were fixed again in 4% PFA/0.1% glutaraldehyde for 2 h at room temperature. Embryos were then stored in PBST+0.1% azide at 4 °C (Nagy et al. 2003).
Results
Expression of Pappa2 measured by quantitative PCR
Pappa transcript levels were not particularly high in mouse placenta compared to other tissues (Fig. 1A), but Pappa2 expression in the placenta was much higher than in other tissues (Fig. 1B). For placental samples, the Ct values for Pappa ranged from 24 to 28, whereas the Ct values for Pappa2 ranged from 16 to 19. To estimate the copy number of each gene transcript in placenta samples, Ct values were converted into copy number using standard curves constructed by plotting the log-transformed value of initial cDNA copy number (calculated from cDNA concentration) against its Ct value. The r2 values were 0.9951 for Pappa and 0.9933 for Pappa2, showing a strong correlation between Ct values and copy number. The copy number of Pappa2 in the placenta was estimated to be nearly 1000-fold higher than that of Pappa (Pappa: 141±149 copies; Pappa2: 1.3×105±0.7×105 copies). Because this analysis compares cDNA copy number, rather than mRNA copy number, this comparison assumes that the reverse transcription reaction was equally efficient for both Pappa and Pappa2.
Relative mRNA expression levels of (A) Pappa and (B) Pappa2 in mouse placenta (n=6), liver (n=3), kidney (n=3), and stomach (n=3). Values are expressed as estimates of cDNA copy number (calculated using standard curves described in text), and therefore comparison between genes assumes that reverse transcription reactions were equally efficient for Pappa and Pappa2. Each column represents the mean±s.d.
Citation: Journal of Endocrinology 202, 3; 10.1677/JOE-09-0136
Western blotting
Western blot analysis (Fig. 2) showed that PAPPA2 protein was strongly expressed in the murine placenta and to a lesser extent in the embryo, and that it was also detectable in murine pregnancy serum. It was not possible to use pseudopregnant females to test whether the placenta was the source of serum PAPPA2 in pregnant females because pseudopregnancy does not usually last until 12.5 dpc in mice (Jasper et al. 2000, Miller et al. 2004). PAPPA2 protein was not detectable in nonpregnant mouse serum, liver, kidney, and stomach (Fig. 2). The pattern of expression was similar in all tested mice.
(A) Western blot of PAPPA2 in various murine tissues. The blot shown is representative of blots obtained from six different mice (neg:, negative control (water); NPS, nonpregnancy serum; PS, pregnancy serum; dpc, day post coitum). (B) EZblue-stained SDS-PAGE gel loaded with the same protein samples as used for immunodetection.
Citation: Journal of Endocrinology 202, 3; 10.1677/JOE-09-0136
In humans, PAPPA2 was detected in human serum during pregnancy at term (Fig. 3) and at lower levels during the first trimester (Fig. 4), but not in serum from nonpregnant women (Figs 3 and 4). The estimated size of PAPPA2 was ∼250 kDa in both mouse and human (Figs 2 and 3), as found by Nishizawa et al. (2008). In humans there was also a band of ∼130 kDa, which is close to the expected size of a splice variant of PAPPA2 (Page et al. 2001).
Western blot of PAPPA2 in serum from pregnant women at term and nonpregnant women. Left panel: two protein bands of ∼250 and 130 kDa (indicated with solid arrows) are detected in pregnant serum samples but not in nonpregnant samples, representing full-length PAPPA2 and its processed fragment respectively. Right panel: the other bands (indicated with open arrows) are also present in the western blot without anti-PAPPA2 antibody incubation, suggesting nonspecific binding. The positive control (last lane of left panel) consists of a recombinant fragment of PAPPA2 (amino acids 243–1396; R&D Systems) and therefore is smaller than the full-length PAPPA2 in serum samples.
Citation: Journal of Endocrinology 202, 3; 10.1677/JOE-09-0136
Western blot of PAPPA and PAPPA2 in maternal circulation during the first and third trimester (T).
Citation: Journal of Endocrinology 202, 3; 10.1677/JOE-09-0136
Localization of PAPPA2 in the placenta
The spatial and temporal expression pattern of PAPPA2 protein in the mouse placenta from gestational stages 10.5–16.5 dpc was determined by immunohistochemistry. The mouse placenta is composed of three main layers: a layer of decidual cells of maternal origin, the labyrinth of fetal origin, and the intermediate junctional zone. Throughout the stages examined, PAPPA2-positive signals were detected primarily in the junctional zone (Fig. 5). Because we observed PAPPA2 expression in the junctional zone but not the decidua, we did not examine pseudopregnant controls, in which the junctional zone would not be present. At 11.5 dpc, IGFBP5 was expressed in the decidual part of the placenta, adjacent to PAPPA2 expression (Fig. 5). In human placenta, PAPPA2 was clearly detectable in the syncytiotrophoblast layer of placental villi in the first trimester (see Supplementary Figure 1 in the online version of the Journal of Endocrinology at http://joe.endocrinology-journals.org/cgi/content/full/JOE-09-0136/DC1) and in invasive extravillous trophoblasts at the maternal–fetal interface (Fig. 6).
Expression of PAPPA2 is strongest in the junctional zone in the mouse placenta. IGFBP5 protein is expressed in the decidual part in the mouse placenta at 11.5 dpc. No staining was observed when nonimmune goat IgG was used for immunohistochemical detection in mouse placenta (neg). D, decidua; J, junctional zone; L, labyrinth; and dpc, day post coitum. Note that the sections showing IGFBP5 expression were not counterstained with hematoxylin due to low signal level. The scale bar represents 1 mm.
Citation: Journal of Endocrinology 202, 3; 10.1677/JOE-09-0136
PAPPA2 expression in invasive extravillous trophoblasts at 12 weeks. Sections were initially immunostained for cytokeratin 18, a marker of trophoblasts, followed by destaining and restaining for vimentin, a marker of maternal decidual cells, or PAPPA2. As shown in section 1, cytokeratin-positive cells are vimentin-negative (indicated by line arrowheads), whereas cells displaying vimentin immunoreactivity did not show cytokeratin immunoactivity (indicated by solid arrowheads), confirming the specificity of cytokeratin as a trophoblast marker and no interference of initial cytokeratin staining on subsequent immunostaining. Most cytokeratin-positive cells displayed PAPPA2 immunosignals (indicated by line arrowheads), although some trophoblasts (indicated by solid arrowheads) lacked PAPPA2 immunoreactivity.
Citation: Journal of Endocrinology 202, 3; 10.1677/JOE-09-0136
Whole-mount in situ hybridization of mouse embryo
At embryonic day 12.5, Pappa2 transcripts were found to be present in the nasal region, forebrain, dorsal side, and the sides of the tail (Fig. 7A and B). To compare the expression of Pappa2 with that of its substrate, in situ hybridization was also carried out with Igfbp5 RNA probes. Igfbp5 transcripts were expressed throughout the body except in the brain region, developing whisker barrels and feet (data not shown), as found by Allan et al. (2000). Igfbp5 expression in the tail occurred laterally and along the midline (Fig. 7C). There was some co-expression of Pappa2 and Igfbp5 in the tail and nasal region. Igf-II was also found to be expressed in the tail, as well as the limbs (Fig. 7D).
Pappa2, Igfbp5, and Igf-II expression in mouse embryos at e12.5. Low levels of Pappa2 transcripts are present in the nasal region (n), forebrain (fb), dorsal side (d), and tail (t) (A and B). The same embryos are shown in A and B. The expression of Pappa2 in the tail laterally co-localizes with that of Igfbp5 (C), which in turn also colocalizes with Igf-II expression (D) (indicated by arrowheads). AS, antisense probes; S, sense probes. The scale bar represents 1 mm.
Citation: Journal of Endocrinology 202, 3; 10.1677/JOE-09-0136
Discussion
In the present work, we show for the first time that Pappa2, but not Pappa, is highly expressed in the mouse placenta. Pappa2 is expressed at much higher levels in the murine placenta than in other tissues analyzed, such as the kidney, stomach, and liver. Previously, Pappa2 expression was found to be higher in stomach than in a variety of other adult tissues, including brain, kidney, heart, lung, testis, pancreas, and prostate gland (Christians et al. 2006). In humans, PAPPA2 has also been expressed much more strongly in placenta than in other adult tissues (Farr et al. 2000, Page et al. 2001). In contrast, while PAPPA is highly expressed in human placenta (Sun et al. 2002), Pappa expression in the murine placenta is not particularly high compared to other tissues (Qin et al. 2002, Soe et al. 2002, this study). We quantitatively compared the transcript abundance of Pappa and Pappa2 in mouse placenta and found that Pappa2 levels were nearly 1000-fold higher than those of Pappa, as estimated by cDNA levels.
To identify specific sites of PAPPA2 expression, immunohistochemistry was performed in both mouse and human placentae. In the mouse, PAPPA2 is primarily expressed in the junctional zone, located between the maternal decidua and the fetal labyrinth zone. The junctional zone is mainly composed of two cell types: the spongiotrophoblasts and glycogen trophoblast cells (Coan et al. 2005). Glycogen trophoblast cells have been proposed to be a specialized subtype of spongiotrophoblast, involved in the invasion of the decidua by fetal tissue (Adamson et al. 2002). The substrate of PAPPA2, IGFBP5, is expressed in some maternal components of the mouse placenta, including endothelium of maternal blood vessels (Carter et al. 2006, this study). Given that PAPPA2 contributes to the proteolysis of IGFBP5 (Overgaard et al. 2001), its expression in the junctional zone likely leads to the breakdown of IGFBP5 in the neighboring decidua, freeing IGF-II. Similarly, in the human placenta, PAPPA2 is expressed in the syncytiotrophoblast layer of placental villi in the first trimester and may contribute to the release of IGF-II to promote feto-placental growth. In general, our results with human placenta confirm previous findings (Nishizawa et al. 2008, Winn et al. 2009). However, using cell-specific markers to distinguish between trophoblasts and maternal decidual cells, we also observed some PAPPA2 immunoreactivity in invasive extravillous trophoblasts in the first trimester (at 12 weeks).
PAPPA2 is detectable in the circulation of pregnant women during the first trimester (Nishizawa et al. 2008; this study) raising the possibility that PAPPA2 may be a useful biomarker of placental dysfunction, as is the case with PAPPA. At least four recent studies have found PAPPA2 to be upregulated in hypertensive disorders of pregnancy including preeclampsia and HELLP syndrome (Buimer et al. 2008, Nishizawa et al. 2008, Sitras et al. 2009, Winn et al. 2009). It is curious that, although PAPPA2 and PAPPA are proteases that cleave IGFBPs, upregulation of PAPPA2 is associated with disease, whereas abnormally low maternal serum levels of PAPPA are associated with a variety of pregnancy complications (Smith et al. 2002, Kwik & Morris 2003, Dugoff et al. 2004, Spencer et al. 2008). The evaluation of PAPPA2 as a biomarker will require a better understanding of its physiological roles in the placenta, which will benefit from animal models (Sapin et al. 2001, Cross 2003). The parallels in the location of PAPPA2 expression between mouse and human found in this study indicate that the mouse will provide a suitable model.
Pappa2 is also expressed in mouse embryo. Using whole-mount in situ hybridization, we found that Pappa2 is expressed in the tail and dorsal side of the embryo, forebrain, and the nasal region. While Pappa is present throughout the embryonic tail (Conover et al. 2004), Pappa2 transcripts are laterally located in the tail and the dorsal side of the embryo. The substrate of PAPPA2, IGFBP5, has been found to be expressed in various embryonic tissue types, including the developing tail (Allan et al. 2000), as confirmed in this study. The co-localization of PAPPA2 and IGFBP5 in certain embryonic tissues suggests that PAPPA2 may play a role in modulating IGFBP5 bioavailability in the mouse fetus, potentially affecting prenatal growth. Previous work with mice has suggested that Pappa2 may play a role in postnatal growth; Pappa2 was identified as a candidate gene for a quantitative trait locus (QTL) affecting tail length, skeletal growth, and levels of circulating IGFBP5 in mice (Christians et al. 2006, Christians & Senger 2007). The localization of Pappa2 expression in the embryonic tail (this study) is consistent with the hypothesis that Pappa2 is the gene responsible for a QTL affecting tail length.
This study demonstrates that Pappa2 is highly expressed at the feto-maternal interface of mouse placenta, confirming that the mouse will likely be a useful model for understanding the role of PAPPA2 in placental physiology. Previous observations show that PAPPA2 is found at higher levels in pregnancies complicated by preeclampsia or HELLP syndrome, whereas PAPPA is found at lower levels in various pregnancy complications which indicate that these two proteins may play quite different physiological roles despite having similar biochemical actions. The development of PAPPA2 as an additional marker may therefore offer increased diagnostic power for identifying placental dysfunction and complications such as preeclampsia and IUGR, which have lasting health consequences for the mother and child.
Declaration of interest
There is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
Funding was provided by a Simon Fraser University President's Research Grant and The Natural Sciences and Engineering Research Council of Canada (NSERC) operating grant (326791-06) to J K C, and by a CIHR operating grant (MOP-84542) to A G and Q Q.
Acknowledgements
We thank Mary Dearden, Alex Fraser, Dong Han, and Jim Mattsson for their technical instruction and assistance and the Women's Health Research Institute of British Columbia for team building support.
References
Adamson SL, Lu Y, Whiteley KJ, Holmyard D, Hemberger M, Pfarrer C & Cross JC 2002 Interactions between trophoblast cells and the maternal and fetal circulation in the mouse placenta. Developmental Biology 250 358–373.
Aitken DA, Ireland M, Berry E, Crossley JA, Macri JN, Burn J & Connor JM 1999 Second-trimester pregnancy associated plasma protein-A levels are reduced in Cornelia de Lange syndrome pregnancies. Prenatal Diagnosis 19 706–710.
Allan GJ, Flint DJ, Darling SM, Geh J & Patel K 2000 Altered expression of insulin-like growth factor-1 and insulin like growth factor binding proteins-2 and 5 in the mouse mutant hypodactyly (Hd) correlates with sites of apoptotic activity. Anatomy and Embryology 202 1–11.
Boldt HB & Conover CA 2007 Pregnancy-associated plasma protein-A (PAPP-A): a local regulator of IGF bioavailability through cleavage of IGFBPs. Growth Hormone and IGF Research 17 10–18.
Boldt HB, Kjaer-Sorensen K, Overgaard MT, Weyer K, Poulsen CB, Sottrup-Jensen L, Conover CA, Giudice LC & Oxvig C 2004 The Lin12-Notch repeats of pregnancy-associated plasma protein-A bind calcium and determine its proteolytic specificity. Journal of Biological Chemistry 279 38525–38531.
Brambati B, Macintosh MCM, Teisner B, Maguiness S, Shrimanker K, Lanzani A, Bonacchi I, Tului L, Chard T & Grudzinskas JG 1993 Low maternal serum levels of pregnancy associated plasma protein-A (PAPP-A) in the 1st trimester in association with abnormal fetal karyotype. British Journal of Obstetrics and Gynaecology 100 324–326.
Buimer M, Keijser R, Jebbink JM, Wehkamp D, van Kampen AHC, Boer K, van der Post JAM & Ris-Stalpers C 2008 Seven placental transcripts characterize HELLP-syndrome. Placenta 29 444–453.
Carter AM, Nygard K, Mazzuca DM & Han VKM 2006 The expression of insulin-like growth factor and insulin-like growth factor binding protein mRNAs in mouse placenta. Placenta 27 278–290.
Christians JK & Senger LK 2007 Fine mapping dissects pleiotropic growth quantitative trait locus into linked loci. Mammalian Genome 18 240–245.
Christians JK, Hoeflich A & Keightley PD 2006 PAPPA2, an enzyme that cleaves an insulin-like growth-factor-binding protein, is a candidate gene for a quantitative trait locus affecting body size in mice. Genetics 173 1547–1553.
Coan PM, Ferguson-Smith AC & Burton GJ 2005 Ultrastructural changes in the interhaemal membrane and junctional zone of the murine chorioallantoic placenta across gestation. Journal of Anatomy 207 783–796.
Conover CA, Bale LK, Overgaard MT, Johnstone EW, Laursen UH, Fuchtbauer EM, Oxvig C & van Deursen J 2004 Metalloproteinase pregnancy-associated plasma protein A is a critical growth regulatory factor during fetal development. Development 131 1187–1194.
Constancia M, Hemberger M, Hughes J, Dean W, Ferguson-Smith A, Fundele R, Stewart F, Kelsey G, Fowden A & Sibley C et al. 2002 Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature 417 945–948.
Correia KM & Conlon RA 2001 Whole-mount in situ hybridization to mouse embryos. Methods 23 335–338.
Cross JC 2003 The genetics of pre-eclampsia: a feto-placental or maternal problem? Clinical Genetics 64 96–103.
Cross JC, Werb Z & Fisher SJ 1994 Implantation and the placenta: key pieces of the development puzzle. Science 266 1508–1518.
Dugoff L, Hobbins JC, Malone FD, Porter TF, Luthy D, Comstock CH, Hankins G, Berkowitz RL, Merkatz I & Craigo SD et al. 2004 First-trimester maternal serum PAPP-A and free-beta subunit human chorionic gonadotropin concentrations and nuchal translucency are associated with obstetric complications: a population-based screening study (the FASTER trial). American Journal of Obstetrics and Gynecology 191 1446–1451.
Farr M, Strube J, Geppert HG, Kocourek A, Mahne M & Tschesche H 2000 Pregnancy-associated plasma protein-E (PAPP-E). Biochimica et Biophysica Acta – Gene Structure and Expression 1493 356–362.
Folkersen J, Grudzinskas JG, Hindersson P, Teisner B & Westergaard JG 1981 Pregnancy-associated plasma protein-A: circulating levels during normal pregnancy. American Journal of Obstetrics and Gynecology 139 910–914.
Giudice LC, Mark SP & Irwin JC 1998 Paracrine actions of insulin-like growth factors and IGF binding protein-1 in non-pregnant human endometrium and at the decidual–trophoblast interface. Journal of Reproductive Immunology 39 133–148.
Giudice LC, Conover CA, Bale L, Faessen GH, Ilg K, Sun I, Imani B, Suen LF, Irwin JC & Christiansen M et al. 2002 Identification and regulation of the IGFBP-4 protease and its physiological inhibitor in human trophoblasts and endometrial stroma: evidence for paracrine regulation of IGF-II bioavailability in the placental bed during human implantation. Journal of Clinical Endocrinology and Metabolism 87 2359–2366.
Jackson MR, Walsh AJ, Morrow RJ, Mullen JBM, Lye SJ & Ritchie JW 1995 Reduced placental villous tree elaboration in small-for-gestational-age pregnancies: relationship with umbilical artery Doppler waveforms. American Journal of Obstetrics and Gynecology 172 518–525.
Jasper MJ, Robertson SA, Van der Hoek KH, Bonello N, Brannstrom M & Norman RJ 2000 Characterization of ovarian function in granulocyte–macrophage colony-stimulating factor-deficient mice. Biology of Reproduction 62 704–713.
Kwik M & Morris J 2003 Association between first trimester maternal serum pregnancy associated plasma protein-A and adverse pregnancy outcome. Australian and New Zealand Journal of Obstetrics and Gynaecology 43 438–442.
Lala PK & Hamilton GS 1996 Growth factors, proteases and protease inhibitors in the maternal–fetal dialogue. Placenta 17 545–555.
Miller BH, Olson SL, Turek FW, Levine JE, Horton TH & Takahashi JS 2004 Circadian clock mutation disrupts estrous cyclicity and maintenance of pregnancy. Current Biology 14 1367–1373.
Nagy A, Gertsenstein M, Vintersten K & Behringer R 2003 Manipulating the Mouse Embryo: A Laboratory Manual, edn 3. New York: Cold Spring Harbor Laboratory Press..
Nishizawa H, Pryor-Koishi K, Suzuki M, Kato T, Kogo H, Sekiya T, Kurahashi H & Udagawa Y 2008 Increased levels of pregnancy-associated plasma protein-A2 in the serum of pre-eclamptic patients. Molecular Human Reproduction 14 595–602.
Overgaard MT, Boldt HB, Laursen LS, Sottrup-Jensen L, Conover CA & Oxvig C 2001 Pregnancy-associated plasma protein-A2 (PAPP-A2), a novel insulin-like growth factor-binding protein-5 proteinase. Journal of Biological Chemistry 276 21849–21853.
Page NM, Butlin DJ, Lomthaisong K & Lowry PJ 2001 The characterization of pregnancy associated plasma protein-E and the identification of an alternative splice variant. Placenta 22 681–687.
Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 e45.
Qin XZ, Sexton C, Byun D, Strong DD, Baylink DJ & Mohan S 2002 Differential regulation of pregnancy associated plasma protein (PAPP)-A during pregnancy in human and mouse. Growth Hormone and IGF Research 12 359–366.
Redman CW & Sargent IL 2005 Latest advances in understanding preeclampsia. Science 308 1592–1594.
Rossant J & Cross JC 2001 Placental development: lessons from mouse mutants. Nature Reviews. Genetics 2 538–548.
Salafia CM, Minior VK, Pezzullo JC, Popek EJ, Rosenkrantz TS & Vintzileos AM 1995 Intrauterine growth restriction in infants of less than 32 weeks gestation: associated placental pathological features. American Journal of Obstetrics and Gynecology 173 1049–1057.
Salamonsen LA 1999 Role of proteases in implantation. Reviews of Reproduction 4 11–22.
Sapin V, Blanchon L, Serre AF, Lemery D, Dastugue B & Ward SJ 2001 Use of transgenic mice model for understanding the placentation: towards clinical applications in human obstetrical pathologies? Transgenic Research 10 377–398.
Sitras V, Paulssen RH, Grønaas H, Leirvikc J, Hanssend TA, Vårtun Å & Acharya G 2009 Differential placental gene expression in severe preeclampsia. Placenta 30 424–433.
Smith GCS, Stenhouse EJ, Crossley JA, Aitken DA, Cameron AD & Connor JM 2002 Early pregnancy levels of pregnancy-associated plasma protein A and the risk of intrauterine growth restriction, premature birth, preeclampsia, and stillbirth. Journal of Clinical Endocrinology and Metabolism 87 1762–1767.
Soe R, Overgaard MT, Thomsen AR, Laursen LS, Olsen IM, Sottrup-Jensen L, Haaning J, Giudice LC, Conover CA & Oxvig C 2002 Expression of recombinant murine pregnancy-associated plasma protein-A (PAPP-A) and a novel variant (PAPP-Ai) with differential proteolytic activity. European Journal of Biochemistry 269 2247–2256.
Spencer K, Cowans NJ & Nicolaides KH 2008 Low levels of maternal serum PAPP-A in the first trimester and the risk of pre-eclampsia. Prenatal Diagnosis 28 7–10.
Sun IYC, Overgaard MT, Oxvig C & Giudice LC 2002 Pregnancy-associated plasma protein a proteolytic activity is associated with the human placental trophoblast cell membrane. Journal of Clinical Endocrinology and Metabolism 87 5235–5240.
Tornehave D, Chemnitz J, Teisner B, Folkersen J & Westergaard JG 1984 Immunohistochemical demonstration of pregnancy-associated plasma protein-a (PAPP-A) in the syncytiotrophoblast of the normal placenta at different gestational ages. Placenta 5 427–431.
Winn VD, Gormley M, Paquet AC, Kjaer-Sorensen K, Kramer A, Rumer KK, Haimov-Kochman R, Yeh RF, Overgaard MT & Varki A et al. 2009 Severe preeclampsia-related changes in gene expression at the maternal-fetal interface include sialic acid-binding immunoglobulin-like lectin-6 and pappalysin-2. Endocrinology 150 452–462.
