Abstract
The TALLYHO/Jng (TH) mouse strain is a polygenic model for type 2 diabetes (T2D) characterized by moderate obesity, impaired glucose tolerance and uptake, insulin resistance, and hyperinsulinemia. The goal of this study was to elucidate the molecular mechanisms responsible for the reduced glucose uptake and insulin resistance in the adipose tissue of this model. The translocation and localization of glucose transporter 4 (GLUT4) to the adipocyte plasma membrane were impaired in TH mice compared to control C57BL6/J (B6) mice. These defects were associated with decreased GLUT4 protein, reduced phosphatidylinositol 3-kinase activity, and alterations in the phosphorylation status of insulin receptor substrate 1 (IRS1). Activation of c-Jun N-terminal kinase 1/2, which can phosphorylate IRS1 on Ser307, was significantly higher in TH mice compared with B6 controls. IRS1 protein but not mRNA levels was found to be lower in TH mice than controls. Immunoprecipitation with anti-ubiquitin and western blot analysis of IRS1 protein revealed increased total IRS1 ubiquitination in adipose tissue of TH mice. Suppressor of cytokine signaling 1, known to promote IRS1 ubiquitination and subsequent degradation, was found at significantly higher levels in TH mice compared with B6. Immunohistochemistry showed that IRS1 colocalized with the 20S proteasome in proteasomal structures in TH adipocytes, supporting the notion that IRS1 is actively degraded. Our findings suggest that increased IRS1 degradation and subsequent impaired GLUT4 mobilization play a role in the reduced glucose uptake in insulin resistant TH mice. Since low-IRS1 levels are often observed in human T2D, the TH mouse is an attractive model to investigate mechanisms of insulin resistance and explore new treatments.
Introduction
Understanding the pathogenesis of type 2 diabetes (T2D) is necessary to identify therapeutic targets as well as to generate prognostic information, which ultimately should lead to improved outcomes in affected individuals (O'Rahilly et al. 2005). The etiology of T2D likely involves genetic predisposition and nongenetic risk factors such as high calorie diets and reduced physical activity (Leahy 2005, O'Rahilly et al. 2005). It is commonly held that most forms of T2D in humans follow polygenic inheritances; i.e. predisposing alleles from multiple genes contribute to the development of the disease. Furthermore, T2D is genetically heterogeneous and various pathologic pathways underlie the disease in different affected individuals (Leahy 2005, O'Rahilly et al. 2005). Possibly owing to the etiological complexity, only recently common molecular factors have been identified that affect pathogenesis of human T2D (McCarthy & Zeggini 2007).
A hallmark of T2D is insulin resistance. During normal glucose homeostasis, insulin suppresses hepatic glucose production and increases glucose uptake in muscle and adipose tissues. The latter results from insulin-induced translocation to the cell surface of glucose transporter 4 (GLUT4), the major insulin-responsive GLUT. Insulin binding to its receptor initiates a cascade of events resulting in translocation of GLUT4 from an intracellular compartment and insertion into the plasma membrane (PM). The insulin resistance of T2D mellitus includes a blunting of the insulin-stimulated increase in glucose uptake into adipocytes and muscle. Decreased GLUT4 expression in adipocytes can affect glucose homeostasis (Minokoshi et al. 2003), and adipose-selective targeting of the Glut4 gene leads to impaired insulin action in muscle and liver (Abel et al. 2001).
Low-insulin receptor substrate 1 (IRS1) expression and protein levels have been linked to the development of insulin resistance and T2D in humans (Carvalho et al. 1999) and mice heterozygous for IR and IRS1 null alleles (Bruning et al. 1997). Hirosumi et al. (2002) proposed that activation of c-Jun N-terminal kinase (JNK) leads to a reduction in IRS1 levels and thus to insulin resistance in the Lepob mouse and a diet induced obesity model. What factors activate this pathway and whether it is a general principle in T2D has not yet been fully established.
Genetic animal models have been valuable resources for T2D research, and several polygenic rodent models have been developed (Rees & Alcolado 2005). The TALLYHO/Jng (TH) mouse strain is a newly established polygenic model for T2D characterized by moderate obesity, impaired glucose tolerance and uptake, insulin resistance, hyperinsulinemia, and male limited hyperglycemia. The TH strain originated from phenodeviant mice with polyuria discovered in a colony of outbred Theiler original mice (Kim et al. 2001). Several phenodeviants were imported into The Jackson Laboratory and underwent inbreeding by an intercross/backcross scheme with selection for hyperglycemia in male mice. Although hyperglycemia initially segregated as a single recessive trait, subsequent mapping studies in backcrosses with B6 and CAST/Ei mice found several genetic loci contributing to hyperglycemia in the crosses with a major locus mapping to mouse chromosome 19 (Kim et al. 2001). To better validate the TH mouse as a model for human T2D, we examined GLUT4 protein levels, translocation and localization in adipose tissue, as well as components of the insulin signaling pathway. We show not only dysregulated GLUT4 translocation as in other T2D models (Farese et al. 2007), but also a defect in phosphatidylinositol 3-kinase (PI3K) activation, and low-IRS1 levels. We found that IRS1 localizes aberrantly to proteasomal structures in TH adipocytes. Our study identifies IRS1 degradation as a contributor to insulin resistance in TH mice.
Materials and Methods
Materials
Anti-IRS1 and anti-phospho-S307 IRS1 antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA) and Santa Cruz Biotechnology (Santa Cruz, CA, USA). IRS1 ELISA kits, the antibodies for phospho-tyrosine (anti-PY), and PI3K (p85) were purchased from Upstate (Lake Placid, NY, USA). Anti-GLUT4 and anti-suppressor of cytokine signaling 1 (SOCS1) antibodies were purchased from Abcam (Cambridge, MA, USA). Anti-ubiquitin antibodies were purchased from Sigma. Anti-20S proteasome α/β antibodies were obtained from Novus (Littleton, CO, USA). Catch and Release kit for PI3 kinase assays were obtained from Upstate. Porcine insulin was purchased from Eli Lilly (Indianapolis, IN, USA).
Animals
The TH inbred mouse strain has been described in previous studies (Kim et al. 2001, 2006). Ten- to 12-week-old male TH mice were used in this study. Mice were bred and maintained in the Research Animal Facility at The Jackson Laboratory with free access to food (NIH31 diet with 6% fat) and water on a 12 h light:12 h darkness cycle. All animal studies were performed with the approval of The Jackson Laboratory Animal Care and Use Committee. Male C57BL6/J (B6) mice (10–12 weeks old) were used as normoglycemic controls as described (Kim et al. 2001, 2006, Sung et al. 2005).
Real-time quantitative PCR
Real-time PCR assays were performed as previously described (Wang et al. 2006) on an ABI PRISM 7500 SDS instrument. Samples were analyzed in triplicate in three independent runs. To quantify the gene expression profiles, we used the comparative threshold cycle method. PCR primers that amplified 150–180 bp fragments of mouse Irs1 cDNA (NM010570) were used (F: CGCTACATCCCAGGTGCTAAC, R: GCGGAGTGAGTTCTCTTTCGA).
Immunohistochemistry and confocal microscopy
Immunohistochemical analyses were performed as described previously with modifications (Liu et al. 1993). Briefly, mice were either fasted overnight and left untreated or allowed to eat ad libitum and then given an i.p. injection of glucose (1 g/kg) and insulin (8 U/kg). Thirty minutes after the injections, the mice were anesthetized with tribromoethanol and perfused with PBS followed by 4% paraformaldehyde in PBS as fixative. Abdominal adipose tissue was removed and postfixed in the same fixative overnight at room temperature. A microwave procedure was used for antigen retrieval in paraffin-embedded tissue sections (8 min in citrate buffer, pH 6–6.5). Slides were then incubated in 0.3% hydrogen peroxide for 30 min to inhibit endogenous peroxidase activity. After incubation with blocking solution (3% normal goat serum), slides were incubated overnight with rabbit polyclonal antiserum against GLUT4 protein, mouse monoclonal anti-IRS1 antibodies, and rabbit polyclonal anti-proteasome 20S α+β antibodies. Confocal microscopy (Leica CTR6000, Bannockburn, IL, USA) was used to detect GLUT4 distribution, and fluorescence microscopy (Leica DMLB) was employed for IRS1 and 20S proteasome protein localization. For single or double immunofluorescence staining, FITC- and rhodamine-conjugated secondary antibodies were employed. Analysis and photo-documentation were described in our previous studies (He et al. 2000, Wang et al. 2006). The specificity of staining was confirmed using negative controls in which the primary antibody was omitted.
Immunoprecipitations and western blot analysis
Immunoprecipitations and western blot analyses of insulin signaling proteins were performed on abdominal adipose tissue homogenates as previously described (Araki et al. 1994, Hu et al. 2004). Briefly, mice were fasted overnight and intraperitoneally injected with insulin (0.5 U/kg body weight) or saline. Thirty minutes after injection, epididymal fat pads were dissected and saved for immunoprecipitation and immunoblot (IB) analysis of insulin signaling molecules. Adipose tissue samples were homogenized in buffer (50 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.5% NP40, 0.1 mM Na3VO4, and protease inhibitors) and particulates removed by centrifugation. The supernatants were incubated overnight at 4 °C with antibodies against IRS1, p85, or ubiquitin, followed by the addition of protein A- or G-sepharose and antibodies against IRS1 and phospho-tyrosine. Immunoprecipitated proteins were resolved by PAGE and detected by chemiluminescence after western blotting. Quantitative densitometric analyses of the chemoluminescence photographs were carried out on a LAS-1000 plus densitometer and Image Gauge V3.45 software (Fuji Photo Film Co., Stamford, CT, USA). Results were expressed as percentage of signal intensity seen in samples from insulin-stimulated B6 animals.
Phosphatidylinositol kinase activity assay
Mice were fasted overnight (18 h) and then given insulin (0.5 U/kg) or saline intraperitoneally. Thirty minutes after injection, adipose tissue was homogenized on ice with a 5 mm Omni ultrasound probe. PI3K assays were performed as previously described (Krook et al. 1997, Storgaard et al. 2001, Farese et al. 2007). Briefly, to 500 μl aliquots of diluted cell lysate (500 μg) in fresh tubes were added 4 μg PY20 antibody and 10 μl (1 μg) antibody capture affinity ligand (Fisher Scientific, Pittsburgh, PA, USA). The samples were briefly mixed and incubated for 5–15 min at room temperature. Proteins were captured in an Eppendorf spin column at 1500 g for 2 min. The spin columns were washed twice with 500 μl 1×Catch and Release lysis/wash buffer and centrifuged for 3 min at 2000 g. The bound protein was eluted with 500 μl of assay dilution buffer followed by 30–60 μl water to obtain the final combined eluates. Phosphatidylinositol (PI), 1 mg/ml, was dispersed by sonication for 15 min in 5 mM HEPES. PI was preincubated with the immunoprecipitates at 4 °C for 20 min at a final concentration of 0.2 mg/ml. The phosphorylation reaction was started by adding 20 μCi (γ32P)ATP and MgCl2 to final concentration of 50 μM ATP (cold) and 5 mM MgCl2 in a volume of 50 μl. After incubation for 20 min at 25 °C, the reaction was terminated by adding 100 μl 1 M HCl. Phospholipids were extracted immediately with 200 μl CHCl3/MeOH (1:1). The organic phase was washed with 80 μl MeOH/HCl (1:1) and 15 μl of the organic phase were spotted onto a silica gel thin layer chromatography (TLC) plate. Phosphorylated products were separated by TLC in a CHCl3/MeOH/4 M NH4OH (9:7:2) developing solvent for 1 h and visualized by autoradiography.
Measurement of JNK activation
The phosphorylation status at threonine 183 and tyrosine 185 of JNK1/2 was assayed using a commercial antibody bead kit for phospho-JNK1/2 (pTpY 183/185) (Cat. LHO0081, Biosource, Camarillo, CA, USA).
Adipocyte isolation and glucose uptake
Adipocytes were isolated from overnight fasted mice by a protocol modified from Rodbell (1964). The epididymal fat pads were removed and minced into rice-sized pieces and then placed in pregassed (95% O2, 5% CO2) Krebs–Ringer buffer with HEPES (KRBH, 117 mM NaCl, 4.72 mM KCl, 2.5 mM CaCl2, 1.2 mM KH2PO4, 1.2 mM MgSO4, 10 mM NaHCO3, 20 mM HEPES, 200 nM adenosine, filtered and adjusted to pH 7.4) with 3% BSA and 2.5 mg/ml collagenase. The cells were incubated in a 37 °C water bath for 1 h with shaking at 100 r.p.m. After digestion, the cell suspension was passed through a premoistened 250 μm filter and cells were washed three times with cold KRBH with 3% BSA. The diluted cell suspension was then dispersed equally by volume into 5 ml cell culture tubes. Cells were treated with saline (basal) or 70 nM insulin for 30 min before the addition of 0.2 μCi of 2-[3H]-deoxyglucose. After 10 min, glucose uptake was stopped by centrifugation of the cells over dinonyl phthalate oil at 350 g for 2 min. Cells were lysed with a 3% SDS (v/v) buffer and the lysates were solubilized in Ultima-Gold scintillation cocktail. Cytochalasin B was used as a control for non-insulin dependant glucose uptake. An aliquot of each cell lysate was taken prior to the addition of scintillation fluid and all counts were normalized for protein concentration. Final glucose uptake values are presented as pmol/mg per min (Zisman et al. 2000).
Subcellular fractionation of isolated adipocytes
Mice were fasted for 4 h after the darkness period and then given insulin (0.5 U/kg) or saline by i.p. injection. Thirty minutes later, the epididymal adipose tissue was collected. Subcellular fractions were prepared as previously described (Tsuji et al. 2001), with some modifications. In brief, the isolated adipocytes were suspended in 10 ml homogenization buffer A (20 mM Tris–HCl, 1 mM EDTA, 255 mM sucrose, pH 7.4) with protease inhibitors. They were homogenized on ice and were centrifuged at 5000 g for 5 min at 4 °C to remove fat droplets. The homogenates were centrifuged for 20 min at 19 000 g. The initial supernatant contained the microsomal membrane fraction. The PM-rich fractions were prepared as follows: the initial pellet was resuspended in 3 ml buffer B (20 mM Tris–HCl, 1 mM EDTA, pH 7.4 with protease inhibitors), then layered onto a 6 ml sucrose cushion (38% sucrose in buffer B) and centrifuged at 100 000 g for 70 min. The PMs collected at the interface on top of the sucrose cushion were resuspended in buffer B and centrifuged at 40 000 g for 20 min and yielded a pellet of the PM fraction. The 100 000 g pellet was resuspended by homogenization in buffer A, yielding the mitochondrial and nuclear fractions. The 19 000 g initial supernatant was centrifuged for 20 min at 41 000 g, yielding a pellet of the high-density microsome (HDM) fraction. The 41 000 g supernatants were centrifuged at 180 000 g for 70 min, yielding a pellet of the low-density microsome (LDM) fractions. For western blotting, 10 μg of each membrane fraction was solubilized in sample buffer (2.3 M urea, 1.5% (w/v) SDS, 15 mM Tris/HCl and 100 mM dithiothreitol, pH 6.8) at room temperature for 30 min, subjected to SDS/PAGE, and transferred to nitrocellulose membranes. The nitrocellulose membranes were immunoblotted with anti-GLUT4 antibody, and detected with enhanced chemiluminescence as described previously (Wang et al. 2006).
Ex vivo insulin signaling studies in isolated adipocytes
Isolated adipocytes were incubated for 30 min with 0 (basal), 10, 50, and 100 nM insulin respectively in Krebs–Ringer buffer containing 3% BSA. Adipocytes were then harvested for immunoprecipitation and IB analysis of insulin signaling proteins. Because of the low abundance of IRS1 protein in mouse adipose tissue, ELISA assays were performed to compare total IRS1 protein levels in TH and B6 mice.
Statistical analysis
All data are presented as means±s.e.m. The statistical analyses were conducted in StatView (v.4.5; Abacus Concepts, Berkeley, CA, USA). The differences between two groups was assessed by Student's t-test, P<0.05 was considered statistically significant.
Results
Reduced glucose transport in TH mice
In comparison with B6 mice, adipocytes from TH mice displayed comparable basal but significantly reduced insulin-stimulated 2-deoxyglucose uptake (Fig. 1, 12% reduction under basal conditions and 60% reduction after insulin stimulation). The decrease in glucose uptake by adipocytes from TH versus B6 correlated with a significant 20% reduction in both basal and insulin-stimulated cellular GLUT4 content (Fig. 2A) as determined by western blot analysis of whole adipocyte lysates, and a diminished localization of the GLUT4 protein at the adipocyte cell surface as assessed by immunofluorescence in adipose tissue (Fig. 2C).
Reduced glucose uptake in TH mice. Epididymal adipocytes were isolated from 10-week-old TH mice (n=8–10 mice per group) as well as B6 controls (n=8 mice per group), and incubated in the absence or presence of insulin (70 nM) for 30 min. Glucose uptake was assessed by adding trace amounts of 2-[3H]-deoxyglucose.
Citation: Journal of Endocrinology 203, 1; 10.1677/JOE-09-0026
Reduced GLUT4 translocation in TH mice. (A) Western blot analysis of GLUT4 protein from adipose tissue in B6 and TH mice. (B) Subcellular distribution of GLUT4 protein from adipocytes of B6 and TH mice. Plasma membrane (PM), low-density microsome (LDM), and high-density microsome (HDM) fractions were prepared from adipocytes treated with insulin or saline, and GLUT4 was detected by western blot as described in Materials and Methods (n=6 per group). Data from three experiments were quantitated by densitometry, and graphed relative to the value for insulin-stimulated LDM B6 control, which was assigned a value of 100%. (C) Confocal fluorescent localization of adipocyte GLUT4 protein in B6 control mice (left panel) and TH mice (right panel). Mice were either fasted overnight and left untreated, Ins (−), or allowed to feed ad libitum and given an i.p. injection of insulin and glucose, Ins (+). Adipose tissue was cryopreserved. Arrows mark several locations of punctate cytoplasmic staining in adipocytes. Arrows mark locations of extensive membrane-associated GLUT4 in adipocytes of insulin-stimulated B6 mice. Images are representative of three independent experiments (n=3 per group). *P<0.05 in fractions of PM and LDM different from basal versus respective insulin-stimulated states.
Citation: Journal of Endocrinology 203, 1; 10.1677/JOE-09-0026
To further explore the mechanism of impaired glucose uptake in TH mice, we carried out a fractionation of the cellular membranes of adipocytes from B6 and TH mice. In unstimulated adipose tissue of control B6 mice, 10% of GLUT4 was located at the cell surface in the PM and >90% in intracellular compartments, LDM and HDM fractions. As expected, insulin treatment (0.5 U/kg) of B6 adipocytes resulted in 2.5-fold increase in GLUT4 protein in the PM fraction along with a 30% decrease in GLUT4 protein in the LDM fraction, reflecting the translocation from the intracellular pools of GLUT4 transporter protein to the PM. In TH mice, in concordance with the reduction of total GLUT4 protein content, the combined membrane fraction (PM, LDM and HDM) GLUT4 showed approximately a 20% decrease compared with B6 controls (quantitation not shown). GLUT4 levels in the PM fraction slightly increased from basal levels after insulin stimulation. GLUT4 content in the LDM fraction from TH mice after insulin stimulation remained unchanged (Fig. 2B), reflecting an impairment of GLUT4 transport in the adipose tissue of TH mice.
Histologically, adipose tissue from fasted B6 mice exhibited a punctate, nonlinear cytoplasmic GLUT4 immunofluorescence as well as a weak immunofluorescence associated with the PM in the basal state (Fig. 2C top left panel). GLUT4 immunofluorescence was redistributed from the condensed cytoplasmic staining to the PM after treatment with insulin and glucose in B6 mice (Fig. 2C bottom left panel). GLUT4 staining in TH mice showed a similar distribution as B6 in the basal state but with less staining of the PM (Fig. 2C top right panel). However, in TH mice treated with insulin and glucose the localization of GLUT4 remained unchanged, with the immunofluorescence signal in punctate staining in the cytoplasm with little signal present on the cell membrane (Fig. 2C bottom right panel).
Impaired insulin signaling in TH mice
Binding of insulin to its receptor results in autophosphorylation of the intracellular domain of the receptor. The phosphorylated receptor associates with IRS1, phosphorylated IRS1 binds and activates the lipid kinase PI3K and triggers GLUT4 translocation and insulin-stimulated glucose uptake (Buren et al. 2002). We found that basal PI3K activity in adipose tissue of TH was lower than in B6, although not significantly so. Stimulation of PI3K activity by insulin was significantly reduced in TH mice (Fig. 3A). The association of the PI3K regulatory subunit p85 with IRS1 was markedly less in the adipose tissue of TH mice. IRS1 binding to PI3K in TH was reduced both before (B6: 50.0±0.3% versus TH: 10.0±3.2%, P<0.01) and after insulin stimulation (B6: 100.0±8.6% versus TH: 8±3.6%, P<0.01; Fig. 3B).
Impaired insulin signaling in TH mice. (A) Impaired PI3K activity in adipose tissue of TH mice. Ten-week-old male mice (n=10–12 per group) were fasted overnight and given insulin (0.5 U/kg) or saline. Adipocyte lysates were immunoprecipitated with anti-phosphotyrosine antibodies and immune complexes were assayed for their ability to phosphorylate phosphatidylinositol. Reaction products were resolved by thin layer chromatography, and results were quantified using a phospho-imager as described in Materials and Methods. (B) Decreased association of p85 with IRS1 in TH mice. Adipose tissue was isolated from TH and control mice (n=10–12 per group) that were treated with insulin (0.5 U/kg) or saline. Equal amounts of protein lysates (500 μg) were immunoprecipitated with anti-p85 antibody followed by western blot analyses with anti-IRS1. Membranes were stripped and reprobed with anti-p85 to confirm p85 levels. Data from three experiments were quantified by densitometry, and graphed relative to the value for insulin-stimulated B6 control, which was assigned a value of 100%. **P<0.01 for TH samples versus the B6 samples in basal or insulin stimulation state respectively.
Citation: Journal of Endocrinology 203, 1; 10.1677/JOE-09-0026
Decreased levels of IRS protein have been reported in insulin-resistant subjects as well as diabetic patients (Carvalho et al. 1999). We measured the protein and phosphorylation levels of IRS1 in TH mice by western blotting. IRS1 protein levels in adipose tissue of TH mice were significantly reduced compared with B6 in both basal and insulin-stimulated states (Fig. 4A). The reduction of IRS1 protein was paralleled by a similar reduction in IRS1 tyrosine phosphorylation (Fig. 4B).
Reduced levels of IRS1 protein and aberrant phosphorylation of IRS1 in TH mice. (A) Western blot analysis of IRS1 protein from adipose tissue in B6 and TH mice. Animals (n=12 per group) were fasted overnight and then given insulin (0.5 U/kg) or saline. Lysates (20 μg/well) were resolved on a 3–8% polyacrylamide gradient Tris–Acetate gel, transferred to nitrocellulose and probed with anti-IRS1 antibody. Figures are representative of three independent experiments. (B) Mice were fasted overnight and given insulin (0.5 U/kg) or saline and adipocyte lysates were prepared for immunoprecipitation. Immunoprecipitates of IRS1 were probed for phosphotyrosine (P–Y) by immunoblotting (IB). Membranes were stripped and reprobed with anti-IRS1 to confirm IRS1 levels. (C) Western blot analysis of IRS1 S307 from adipose tissue lysates. IRS1 pSer307 was measured as fraction of total protein lysates (left panel) and total IRS1 contents (right panel) respectively. Data from three experiments were quantified by densitometry, and graphed relative to the value for insulin-stimulated B6 control. *P<0.05, **P<0.01 for TH samples versus the B6 samples in basal or insulin stimulation state respectively.
Citation: Journal of Endocrinology 203, 1; 10.1677/JOE-09-0026
Since Irs1 mRNA levels were not different between B6 and TH adipose tissue as measured by real-time PCR (data not shown), we considered protein degradation as a mechanism for the reduced IRS1 levels in TH mice. IRS1 degradation is mediated by the proteasome degradative pathway and is primed by phosphorylation of serine residues on IRS1, particularly Ser307 (Gual et al. 2005). In total protein lysates, the level of IRS1 phosphorylated at Ser307 was significantly lower in TH mice in the basal state and significantly higher after insulin stimulation compared with B6 (Fig. 4C left panel). However, importantly, the fraction of total IRS1 protein that was phosphorylated at Ser307 was higher in TH mice compared with B6 both in the basal state (1.5-fold) as well as after insulin stimulation (17-fold, Fig. 4C right panel).
To determine whether the defects of IRS1 in adipocytes of TH mice are intrinsic to adipose tissue or caused by the systemic metabolic milieu, we examined IRS1 protein levels and tyrosine phosphorylation in primary-culture adipocytes derived from TH and B6 mice. Similar results compared to the in vivo data were obtained. Insulin increased total IRS1 protein in both B6 and TH mice in a concentration-dependent manner, however, to a lesser degree in TH (25% reduction in basal level and 40% reduction after 10 nM insulin stimulation, Supplementary Fig. 1A, ELISA and Fig. 1B, western blot available in the online version of the Journal of Endocrinology at http://joe.endocrinology-journals.org/cgi/content/full/JOE-09-0026/DC1). High-insulin concentrations (100 nM) markedly suppressed IRS1 protein in both TH mice and B6 controls (Supplementary Fig. 1A). Similar results were observed in T2D patients (Rondinone et al. 1997). Although tyrosine phosphorylation of IRS1 was similar in TH and B6 without insulin, in contrast to B6 derived adipocytes, insulin at 10 and 50 nM failed to stimulate IRS1 tyrosine phosphorylation in TH adipocytes (Supplementary Fig. 1C).
Activation of JNK has been implicated in phosphorylating the IRS1 Ser307 residue in insulin resistant mice (Ozcan et al. 2006). JKN1/2 activation (pTpY183/185) was measured and shown to be 1.5-fold higher in the basal state, and 2-fold higher after insulin stimulation in adipose tissue from TH mice compared with B6 controls (Fig. 5A).
Degradation of IRS1 protein from adipose tissue of TH mice. (A) Activation of JNK1/2 (pTpY183/185) in adipose tissue of B6 and TH mice at 10 weeks of age (n=6–8). (B) Immunoprecipitation with antibodies against ubiquitin and subsequent western blot analysis of the precipitate with anti-IRS1 antibodies showed increased amounts of polyubiquinated IRS1 in TH adipose tissue. (C) Western blot analysis of SOCS1 from adipose tissue lysates. Data from three experiments were quantified by densitometry, and graphed relative to the value for insulin-stimulated B6 control, which was assigned a value of 100%.*P<0.05; **P<0.01 for TH samples versus the B6 samples in basal or insulin stimulation state respectively.
Citation: Journal of Endocrinology 203, 1; 10.1677/JOE-09-0026
Colocalization of IRS1 and the 20S proteasome subunit, and degradation of IRS1
Targeting of many proteins for proteasomal degradation is mediated by their modification with polyubiquitin. To assess whether the reduction of IRS1 was associated with enhanced degradation, immunoprecipitation with antibodies against ubiquitin and subsequent western blot analysis of the precipitate with anti-IRS1 antibodies was performed. The decrease in IRS1 content due to degradation is associated with retarded migration of the protein band during SDS/PAGE (Potashnik et al. 2003). In agreement with this, a higher molecular weight IRS1-immunreactive band was observed in adipose tissue from TH mice but not in B6 (Fig. 5B).
SOCS1 has previously been shown to bind IRS1 protein and promote its ubiquitination and subsequent degradation (Rui et al. 2002), and expression of SOCS proteins has been reported to be elevated in rodent genetic models of obesity and diabetes. SOCS1 protein levels were significantly higher in TH mice compared with B6 (∼1.7-fold, Fig. 5C). SOCS1 localizes to the complex-associated 20S proteasome (Vuong et al. 2004). To obtain cellular evidence for proteasomal targeting of IRS1, we stained adipose tissue samples from B6 and TH mice for the 20S core α and β subunits of the proteasome. The 20S α and β subunits of the proteasomes were localized throughout the cytoplasm of B6 adipocytes as shown in Fig. 6A. In TH adipose tissue, considerably more punctate staining for proteasomal structures was observed (Fig. 6A). In contrast to B6 where IRS1 staining was observed in the nucleus and cytoplasm (Fig. 6B top panel), in TH mice IRS1 staining colocalized with staining for the 20S subunit in cytoplasmic proteasomal structures (Fig. 6B bottom panel).
Colocalization of IRS1 and the 20S proteasome subunit. (A) Adipose tissue was probed with antibodies against the 20S proteasome (red), and DAPI for DNA (blue). Arrows mark locations of 20S cytoplasmic staining in B6 and TH mice. (B) Adipose tissue from TH and B6 mice was stained with antibodies against IRS1 (green) or against the 20S proteasome (red), or with DAPI for DNA (blue) and the pictures were merged in the last panel. Arrows mark different locations of IRS1 and 20S in B6 mice (top panel), arrows mark colocalization of IRS1 and 20S in TH mice (bottom panel).
Citation: Journal of Endocrinology 203, 1; 10.1677/JOE-09-0026
Discussion
Previously we have described a new mouse model for T2D, the inbred TH strain. TH mice are moderately obese, hyperinsulinemic, glucose intolerant, and insulin resistant (Kim et al. 2001, 2006). Although occasionally diabetic females are observed in our colony, hyperglycemia is largely male limited as is typical for mouse models of T2D (Leiter et al. 1991).
The insulin resistance of T2D mellitus leads to a blunting of the insulin-stimulated increase in glucose uptake into fat and muscle. In muscle, this is due to defective stimulation of the translocation of the insulin sensitive GLUT, GLUT4 from intracellular storage pools to the cell surface (Shepherd & Kahn 1999, Watson et al. 2004). In adipocytes, the decreased insulin sensitivity is due to both this defect in insulin-stimulated translocation, as well as to decreased expression of GLUT4 (Shepherd & Kahn 1999, Minokoshi et al. 2003, Watson et al. 2004). Reduced adipocyte GLUT4 protein levels have also been found in human obesity and T2D, as well as in numerous rodent models of insulin resistance (Shepherd & Kahn 1999). We previously had shown that there was a slight, but not significant reduction of GLUT4 content in soleus muscle from TH male mice (Kim et al. 2006). In the current studies, we found that there was 20% reduction in the total GLUT4 content in adipose tissue from TH compared with B6 mice. Importantly, GLUT4 content in the PM fraction and the LDM fraction in TH mice after insulin stimulation remained unchanged (Fig. 2B), reflecting an impairment of GLUT4 transport in the adipose tissue of TH mice.
IRS1 is required for normal induction of the signaling pathway that is key to many of the metabolic actions of insulin. Induction of IRS1 (3-fold) in rodents occurs within 20–40 min following feeding or insulin injection (Bruning et al. 1997, Ruiz-Alcaraz et al. 2005). The induction is not due to changes in posttranslational phosphorylation, but related to increased protein synthesis (Ruiz-Alcaraz et al. 2005). This short term insulin stimulation of IRS1 is also observed in human muscle (Ruiz-Alcaraz et al. 2005). After prolonged insulin exposure (4–48 h) or in insulin resistant states, a reduction in IRS1 levels is observed (Renstrom et al. 2005). In the present study, IRS1 content in TH adipose tissue is significantly lower than in B6 controls (P<0.001, Fig. 4A). In both strains of mice insulin leads to a significant induction of IRS1 protein, however to a lesser degree in TH compared with B6 (∼ 2 vs 4-fold respectively).
The GLUT4 translocation defect in adipose tissue could be ascribed to reduced levels of IRS1 in adipocytes, which consequently cause alterations in the phosphorylation status, and the activity of intermediates in the insulin signaling pathway through PI3 kinase in TH mice. The lower levels of IRS1 and reduced insulin signaling explain at least in part the insulin resistance observed in the TH model. It makes TH an attractive model for diabetes research since similar defects have been observed in human patients with T2D (Rondinone et al. 1997).
Our data showed an increase in serine phosphorylation and a decrease in tyrosine phosphorylation of IRS1 in the insulin resistant TH mice compared with the more insulin sensitive B6 controls. While the phosphorylation of IRS1 on tyrosine residues is required for insulin-stimulated responses, the role of serine phosphorylation of IRS1 is primarily to terminate the insulin effects (Kim et al. 1999). Increased serine phosphorylation (Ser307) of IRS1 was also reported in other models of insulin resistance in mice (Hirosumi et al. 2002, Rui et al. 2002, Ueki et al. 2004). Gual et al. (2003) and others have shown that stimulation with insulin increases the phosphorylation of Ser307 (mouse) in IRS1. Furthermore, Morino et al. (2005) found that in insulin resistant offspring of T2D parents reduced muscle glucose uptake was associated with increased IRS1 Ser312 (human) phosphorylation. Bikman et al. (2008) found that in morbidly obese gastric bypass surgery patients increased IRS1 Ser312 phosphorylation was associated with insulin resistance, which improved after surgery accompanied by a lowering of IRS1 Ser312 phosphorylation. The argument has been raised that phosphorylation of IRS1 at Ser312 (human)/Ser307 (mouse) following insulin stimulation may be a physiologically normal response, possibly implicated in the determination of the correct amplitude and length of insulin action (Frojdo et al. 2009).
One key signaling mechanism through which IRS1 can become phosphorylated at Ser307(mouse)/Ser312(human) is the stress and inflammatory response pathway mediated by JNK1/2. As observed in dietary obesity and the Lepob model (Hirosumi et al. 2002), we find significant activation of JNK1/2 in the TH model compared with B6 controls. Since JNK can be activated by free fatty acids (FFA; Nguyen et al. 2005), the elevated FFA levels in TH mice may play a role (Kim et al. 2001, 2006).
Hyperphosphorylation of IRS1 on serine/threonine residues after chronic stimulation with insulin results in its targeted degradation by the proteasome (Rice et al. 1993, Sun et al. 1999). Important mediators in this process are the SOCS proteins (Howard & Flier 2006), which target IRS1 and IRS2 for proteasomal degradation via an interaction with their SOCS box (Emanuelli et al. 2001, Rui et al. 2002, Ueki et al. 2004). Higher levels of SOCS1 in TH mice suggest that the low IRS1 levels and concomitant insulin resistance in TH mice are, at least in part, due to SOCS mediated degradation of IRS1.
Degradation of IRS1 as a cause for insulin resistance in TH mice is also supported by our finding of IRS1 colocalization with proteasomal structures in TH mice, but not in B6. It had been described that polyubiquitin chains are essential for proteolytic targeting, whereas mono-ubiquitination might only affect subcellular localization (Beal et al. 1996). Polyubiquitination, as found for IRS1 in TH mice (Fig. 5B), cellular localization (Fig. 6B), and reduced protein levels of IRS1 (Fig. 4A) are, therefore, consistent with IRS1 being targeted for proteasomal degradation, leading to the insulin resistance observed in TH mice.
The impaired glucose tolerance and reduced glucose uptake in muscle and fat of TH mice are a plausible consequence of lower insulin signaling due to low-IRS1 levels. This correlates well with findings in humans that low-IRS1 expression and protein levels are predictive of insulin resistance and T2D (Carvalho et al. 1999). However, the cause for the IRS1 abnormalities including the potentially initiating event of JKN1/2 activation in TH mice as well as other models and humans remain to be determined. Nevertheless, the similarity of events leading to impaired glucose uptake and insulin resistance in the polygenic TH mouse with mechanisms proposed to mediate human T2D makes TH an excellent model for investigating T2D in general.
Declaration of interest
The authors have no conflicting interests to disclose.
Funding
The Jackson Laboratory core services were supported by an institutional grant (CA-24190). This work was supported by National Institute of Diabetes, Digestive and Kidney Diseases Grant DK-46977 (J K N).
Acknowledgements
We thank Lawrence J Bechtel and Elizabeth Hinman for technical assistance, and Dr Edward H Leiter for reviewing the manuscript. We thank Jesse Hammer for assistance in preparing illustrations.
References
Abel ED, Peroni O, Kim JK, Kim YB, Boss O, Hadro E, Minnemann T, Shulman GI & Kahn BB 2001 Adipose-selective targeting of the GLUT4 gene impairs insulin action in muscle and liver. Nature 409 729–733.
Araki E, Lipes MA, Patti ME, Bruning JC, Haag B III, Johnson RS & Kahn CR 1994 Alternative pathway of insulin signalling in mice with targeted disruption of the IRS-gene. Nature 372 186–190.
Beal R, Deveraux Q, Xia G, Rechsteiner M & Pickart C 1996 Suface hydrophobic residues of multiubiquitin chains essential for proteolytic targeting. PNAS 93 861–866.
Bikman BT, Zheng D, Pories WJ, Chapman W, Pender JR, Bowden RC, Reed MA, Cortright RN, Tapscott EB & Houmard JA et al. 2008 Mechanism for improved insulin sensitivity after gastric bypass surgery. Journal of Clinical Endocrinology and Metabolism 93 4656–4663.
Bruning JC, Winnay J, Bonner-Weir S, Taylor SI, Accili D & Kahn CR 1997 Development of a novel polygenic model of NIDDM in mice heterozygous for IR and IRS-1 null alleles. Cell 88 561–572.
Buren J, Liu HX, Jensen J & Eriksson JW 2002 Dexamethasone impairs insulin signalling and glucose transport by depletion of insulin receptor substrate-1, phosphatidylinositol 3-kinase and protein kinase B in primary cultured rat adipocytes. European Journal of Endocrinology 146 419–429.
Carvalho E, Jansson PA, Axelsen M, Eriksson JW, Huang X, Groop L, Rondinone C, Sjostrom L & Smith U 1999 Low cellular IRS 1 gene and protein expression predict insulin resistance and NIDDM. FASEB Journal 13 2173–2178.
Emanuelli B, Peraldi P, Filloux C, Chavey C, Freidinger K, Hilton DJ, Hotamisligil GS & Obberghen E 2001 SOCS-3 inhibits insulin signaling and is up-regulated in response to tumor necrosis factor-alpha in the adipose tissue of obese mice. Journal of Biological Chemistry 276 47944–47949.
Farese RV, Sajan MP, Yang H, Li P, Mastorides S, Gower WR Jr, Nimal S, Choi CS, Kim S & Shulman GI et al. 2007 Muscle-specific knockout of PKC-lambda impairs glucose transport and induces metabolic and diabetic syndromes. Journal of Clinical Investigation 117 2289–2301.
Frojdo S, Vidal H & Pirola L 2009 Alterations of insulin signaling in type 2 diabetes: a review of the current evidence from humans. Biochimica et Biophysica Acta 1792 83–92.
Gual P, Gremeaux T, Gonzalez T, Le Marchand-Brustel Y & Tanti JF 2003 MAP kinase and mTOR mediate insulin-induced phosphorylation of insulin receptor substrate-1 on serine residues 307, 612 and 632. Diabetologia 46 1532–1542.
Gual P, Le Marchand-Brustel Y & Tanti JF 2005 Positive and negative regulation of insulin signaling through IRS-1 phosphorylation. Biochimie 87 99–109.
He W, Ikeda S, Bronson RT, Yan G, Nishina PM, North MA & Naggert JK 2000 GFP-tagged expression and immunohistochemical studies to determine the subcellular localization of the tubby gene family members. Brain Research. Molecular Brain Research 81 109–117.
Hirosumi J, Tuncman G, Chang L, Gorgun CZ, Uysal KT, Maeda K, Karin M & Hotamisligil GS 2002 A central role for JNK in obesity and insulin resistance. Nature 420 333–336.
Howard JK & Flier JS 2006 Attenuation of leptin and insulin signaling by SOCS proteins. Trends in Endocrinology and Metabolism 17 365–371.
Hu Y, Liu Y, Pelletier S, Buchdunger E, Warmuth M, Fabbro D, Hallek M, Van Etten RA & Li S 2004 Requirement of Src kinases Lyn, Hck and Fgr for BCR-ABL1-induced B-lymphoblastic leukemia but not chronic myeloid leukemia. Nature Genetics 36 453–461.
Kim YB, Nikoulina SE, Ciaraldi TP, Henry RR & Kahn BB 1999 Normal insulin-dependent activation of Akt/protein kinase B, with diminished activation of phosphoinositide 3-kinase, in muscle in type 2 diabetes. Journal of Clinical Investigation 104 733–741.
Kim JH, Sen S, Avery CS, Simpson E, Chandler P, Nishina PM, Churchill GA & Naggert JK 2001 Genetic analysis of a new mouse model for non-insulin-dependent diabetes. Genomics 74 273–286.
Kim JH, Stewart TP, Soltani-Bejnood M, Wang L, Fortuna JM, Mostafa OA, Moustaid-Moussa N, Shoieb AM, McEntee MF & Wang Y et al. 2006 Phenotypic characterization of polygenic type 2 diabetes in TALLYHO/JngJ mice. Journal of Endocrinology 191 437–446.
Krook A, Kawano Y, Song XM, Efendic S, Roth RA, Wallberg-Henriksson H & Zierath JR 1997 Improved glucose tolerance restores insulin-stimulated Akt kinase activity and glucose transport in skeletal muscle from diabetic Goto–Kakizaki rats. Diabetes 46 2110–2114.
Leahy JL 2005 Pathogenesis of type 2 diabetes mellitus. Archives of Medical Research 36 197–209.
Leiter EH, Chapman HD & Falany CN 1991 Synergism of obesity genes with hepatic steroid sulfotransferases to mediate diabetes in mice. Diabetes 40 1360–1363.
Liu ML, Gibbs EM, McCoid SC, Milici AJ, Stukenbrok HA, McPherson RK, Treadway JL & Pessin JE 1993 Transgenic mice expressing the human GLUT4/muscle-fat facilitative glucose transporter protein exhibit efficient glycemic control. PNAS 90 11346–11350.
McCarthy MI & Zeggini E 2007 Genome-wide association scans for type 2 diabetes: new insights into biology and therapy. Trends in Pharmacological Sciences 28 598–601.
Minokoshi Y, Kahn CR & Kahn BB 2003 Tissue-specific ablation of the GLUT4 glucose transporter or the insulin receptor challenges assumptions about insulin action and glucose homeostasis. Journal of Biological Chemistry 278 33609–33612.
Morino K, Petersen KF, Dufour S, Befroy D, Frattini J, Shatzkes N, Neschen S, White MF, Bilz S & Sono S et al. 2005 Reduced mitochondrial density and increased IRS-1 serine phosphorylation in muscle of insulin-resistant offspring of type 2 diabetic parents. Journal of Clinical Investigation 115 3587–3593.
Nguyen MT, Satoh H, Favelyukis S, Babendure JL, Imamura T, Sbodio JI, Zalevsky J, Dahiyat BI, Chi NW & Olefsky JM 2005 JNK and tumor necrosis factor-alpha mediate free fatty acid-induced insulin resistance in 3T3-L1 adipocytes. Journal of Biological Chemistry 280 35361–35371.
O'Rahilly S, Barroso I & Wareham NJ 2005 Genetic factors in type 2 diabetes: the end of the beginning? Science 307 370–373.
Ozcan U, Yilmaz E, Ozcan L, Furuhashi M, Vaillancourt E, Smith RO, Gorgun CZ & Hotamisligil GS 2006 Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes. Science 313 1137–1140.
Potashnik R, Bloch-Damti A, Bashan N & Rudich A 2003 IRS1 degradation and increased serine phosphorylation cannot predict the degree of metabolic insulin resistance induced by oxidative stress. Diabetologia 46 639–648.
Rees DA & Alcolado JC 2005 Animal models of diabetes mellitus. Diabetic Medicine 22 359–370.
Renstrom F, Buren J & Eriksson JW 2005 Insulin receptor substrates-1 and -2 are both depleted but via different mechanisms after down-regulation of glucose transport in rat adipocytes. Endocrinology 146 3044–3051.
Rice KM, Turnbow MA & Garner CW 1993 Insulin stimulates the degradation of IRS-1 in 3T3-L1 adipocytes. Biochemical and Biophysical Research Communications 190 961–967.
Rodbell M 1964 Metabolism of isolated fat cells I. Effects of hormones on glucose metabolism and lipolysis. Journal of Biological Chemistry 239 375–380.
Rondinone CM, Wang LM, Lonnroth P, Wesslau C, Pierce JH & Smith U 1997 Insulin receptor substrate (IRS) 1 is reduced and IRS-2 is the main docking protein for phosphatidylinositol 3-kinase in adipocytes from subjects with non-insulin-dependent diabetes mellitus. PNAS 94 4171–4175.
Rui L, Yuan M, Frantz D, Shoelson S & White MF 2002 SOCS-1 and SOCS-3 block insulin signaling by ubiquitin-mediated degradation of IRS1 and IRS2. Journal of Biological Chemistry 277 42394–42398.
Ruiz-Alcaraz AJ, Liu HK, Cuthbertson DJ, McManus EJ, Akhtar S, Lipina C, Morris AD, Petrie JR, Hundal HS & Sutherland C 2005 A novel regulation of IRS1 (insulin receptor substrate-1) expression following short term insulin administration. Biochemical Journal 392 345–352.
Shepherd PR & Kahn BB 1999 Glucose transporters and insulin action – implications for insulin resistance and diabetes mellitus. New England Journal of Medicine 341 248–257.
Storgaard H, Song XM, Jensen CB, Madsbad S, Bjornholm M, Vaag A & Zierath JR 2001 Insulin signal transduction in skeletal muscle from glucose-intolerant relatives of type 2 diabetic patients (corrected). Diabetes 50 2770–2778.
Sun XJ, Goldberg JL, Qiao LY & Mitchell JJ 1999 Insulin-induced insulin receptor substrate-1 degradation is mediated by the proteasome degradation pathway. Diabetes 48 1359–1364.
Sung YY, Lee YS, Jung WH, Kim HY, Cheon HG, Yang SD & Rhee SD 2005 Glucose intolerance in young TallyHo mice is induced by leptin-mediated inhibition of insulin secretion. Biochemical and Biophysical Research Communications 338 1779–1787.
Tsuji Y, Kaburagi Y, Terauchi Y, Satoh S, Kubota N, Tamemoto H, Kraemer FB, Sekihara H, Aizawa S & Akanuma Y et al. 2001 Subcellular localization of insulin receptor substrate family proteins associated with phosphatidylinositol 3-kinase activity and alterations in lipolysis in primary mouse adipocytes from IRS-1 null mice. Diabetes 50 1455–1463.
Ueki K, Kondo T & Kahn CR 2004 Suppressor of cytokine signaling 1 (SOCS-1) and SOCS-3 cause insulin resistance through inhibition of tyrosine phosphorylation of insulin receptor substrate proteins by discrete mechanisms. Molecular and Cellular Biology 24 5434–5446.
Vuong BQ, Arenzana TL, Showalter BM, Losman J, Chen XP, Mostecki J, Banks AS, Limnander A, Fernandez N & Rothman PB 2004 SOCS-1 localizes to the microtubule organizing complex-associated 20S proteasome. Molecular and Cellular Biology 24 9092–9101.
Wang Y, Seburn K, Bechtel L, Lee BY, Szatkiewicz JP, Nishina PM & Naggert JK 2006 Defective carbohydrate metabolism in mice homozygous for the tubby mutation. Physiological Genomics 27 131–140.
Watson RT, Kanzaki M & Pessin JE 2004 Regulated membrane trafficking of the insulin-responsive glucose transporter 4 in adipocytes. Endocrine Reviews 25 177–204.
Zisman A, Leibovici D, Kleinmann J, Siegel YI & Lindner A 2000 Prediciting CAP in patients with intermediate PSA using modified PSA indices. Canadian Journal of Urology 7 1144–1148.
