Abstract
IGF1 knockout (IGF1KO) mice show a reduced number of prolactin (PRL) producing cells (PRL cells); however, the role of IGF1 in PRL cell proliferation and differentiation in immature mice is unclear. In this study, ontogenic changes in the percentages of PRL cells, GH producing cells (GH cells), and 5-bromo-2′-deoxyuridine (BrdU)-labeled cells in the anterior pituitary of male IGF1KO mice during the postnatal period were investigated. The percentage of PRL cells in IGF1KO mice was significantly lower at day 20 compared with that in wild-type (WT) mice, while GH cells in IGF1KO mice were significantly increased from day 10. From days 5 to 20, the percentage of BrdU-labeled cells in WT and IGF1KO mice was similar. PRL cells and GH cells are thought to originate from the same progenitor cells, therefore, PRL cells in IGF1KO mice are not able to differentiate because progenitor cells have already committed to be GH cells. However, IGF1, 17β-estradiol (E2), epidermal growth factor (EGF), or IGF1 plus E2 treatments increased the PRL cell number in the pituitaries in vitro of 10-day-old WT and IGF1KO mice. This fact suggests that these factors are involved in PRL cell proliferation and differentiation. In addition, the increase of PRL cells in IGF1KO mice stimulated by E2 or EGF was less than that of WT mice. Thus, IGF1 plays a crucial role in PRL cell proliferation and differentiation in mouse pituitaries by regulating the differentiation of progenitor cells and mediating the actions of E2 and EGF.
Introduction
Differentiation of anterior pituitary cells is thought to be controlled by various factors from the hypothalamus, peripheral hormones and/or growth factors (Schwardz 2000, Denef 2003). In fetal mice, hormone-producing cells except prolactin (PRL) producing cells (PRL cells) in the anterior pituitary can be detected by immunohistochemistry at embryonic day 18.5 (Watanabe & Haraguchi 1994, Stefaneanu et al. 1999). PRL cells are rarely observed in the fetal anterior pituitary (Ogasawara et al. 2009), and these cells begin to increase at postnatal day 3 (Taniguchi et al. 2001). Several factors involved in PRL cell proliferation and differentiation have been investigated using knockout (KO) techniques. In adult insulin-like growth factor 1 (IGF1) KO (IGF1KO) and estrogen receptor 1 (Esr1) KO mice, PRL cells are decreased in number (Stefaneanu et al. 1999, Pelletier et al. 2003). Therefore, IGF1 and estrogen are suggested to influence PRL cell proliferation and differentiation in postnatal life.
IGF1, a small peptide, plays an important role in the regulation, differentiation, and proliferation of various normal and neoplastic cells as autocrine and/or paracrine signals (Yokoyama et al. 1997). The mitogenic effect of IGF1 is mediated via the IGF1 receptor which acts as a tyrosine kinase receptor (LeRoith et al. 1995). Circulating IGF1 produced in the liver acts as a mediator of GH action and regulates systemic growth (D'Ercole et al. 1984). In the regulation of GH synthesis and release, IGF1 specifically inhibits GH gene transcription and secretion by negative feedback mechanisms (Wallenius et al. 2001). Therefore, high blood GH levels are induced by severe IGF1 deficiency (Lembo et al. 1996). In fact, the Gh mRNA expression is increased in IGF1KO mice of both sexes (Stefaneanu et al. 1999).
Since PRL cells and GH-producing cells (GH cells) are thought to originate from the same progenitor cells which express the transcription factors Pit-1 (listed as Pou1f1 in the MGI Database) and Prop1 that play important roles in the differentiation of PRL cells and GH cells (Slabaugh et al. 1981, Simmons et al. 1990). Insulin and IGF1-induce PRL synthesis in the MtT/S pituitary cells which produce large amount of GH with PIT-1 expression (Inoue & Sakai 1991). PRL cells are suggested to be transdifferentiated from somatotrophs in association with insulin or IGF1. IGF1 also stimulates the proliferation of PRL cells in mouse pituitaries in vitro (Oomizu et al. 1998). Igf1 mRNA is detected only in GH cells of the mouse anterior pituitary, and immunoreactive IGF1 is detected in corticotrophs and some of the GH cells in rats. However, IGF1 receptor is localized in GH cells and some corticotrophs in mice, and corticotrophs, gonadotrophs, GH cells, and some of PRL cells in rats (Honda et al. 1998, Eppler et al. 2007). Thus, IGF1 may act in a paracrine manner in PRL cells of anterior pituitary in rodents.
Several factors besides IGF1 which stimulate PRL production and release both in vivo and in vitro have been reported. Estrogen is a potent stimulator of PRL cell proliferation, PRL production and secretion (Lloyd et al. 1975, Raymond et al. 1978, Amara et al. 1987). Epidermal growth factor (EGF) also stimulates PRL production, and this effect may be mediated through ESR1 in mouse pituitaries (Ben-Jonathan et al. 2009). In addition, dopamine produced in the hypothalamus inhibits PRL production via dopaminergic D2 receptor (Drd2) in lactotrophs (Cristina et al. 2006). These factors may be necessary for PRL production; however, the involvement of IGF1 with these factors on PRL cells has not been investigated.
In this study, our aim was to clarify the role of IGF1 in PRL cell proliferation and differentiation in mouse pituitaries from neonate to adult, and analyze the ontogenic changes of PRL cells and GH cells in adult and immature homozygous male wild-type (WT) and IGF1KO mice. Expression of Prl, Pit-1, Esr1, Egf, and Drd2 mRNAs in anterior pituitaries of WT and IGF1KO mice at days 10 and 20 was also examined by real-time RT-PCR. Finally, the effects of 17β-estradiol (E2), IGF1, and EGF on PRL production were examined in pituitaries from WT and IGF1KO mice at postnatal day 10 using an organ-culture system.
Materials and Methods
Animals
IGF1KO mice were obtained by mating of a mixed MF1×129/Sv background that was heterozygous for the Igf1 gene disruption, as previously described (Baker et al. 1996). The pups' genotypes were determined by multiplex PCR of DNA extracted from tails, homozygous WT, and homozygous IGF1KO males were used. They were housed under 12 h light:12 h darkess cycles with lights on at 0800 and controlled temperature (24 °C). Animals were given free access to mouse chow (MF, Oriental Yeast Co., Ltd, Tokyo, Japan) and tap water ad libitum, and were maintained in accordance with the NIH Guide for the Care and Use of Laboratory Animals. All experiments were approved by the Institutional Animal Care Committee of the Yokohama City University.
Treatments
Pituitaries of 3- to 5-month-old WT and IGF1KO mice were collected. To examine the ontogenic changes of PRL in WT and IGF1KO mice, pituitaries were collected from 5-, 10-, 15- and 20-day-old WT and IGF1KO mice. Two hours before killing, WT and IGF1KO mice were given a single injection of 1 mg/10 g body weight (BW) of 5-bromo-2′-deoxyuridine (BrdU, Sigma Chemical Co.) in saline.
PRL and GH immunohistochemistry
For PRL and GH immunohistochemistry, pituitaries were fixed in Bouin's solution overnight, then dehydrated and embedded in paraffin. Each 4-μm thick section was mounted on silane (3-aminopropyl triethoxy-silane, Sigma Chemical Co.) coated glass slides. Sections were deparaffinized and hydrated through xylene and graded alcohol series. After washing in 0.1 M PBS (pH 7.4), sections were microwaved for 8 min in 1 M sodium citrate buffer (pH 6.0) for antigen retrieval. Endogenous peroxydase was blocked by 1% (v/v) H2O2 in H2O, and then the slides were washed in PBS. Sections were incubated with normal goat serum (VECTASTAIN Elite ABC kit, Vector Laboratories, Inc., Burlingame, CA, USA) for 20 min at room temperature to reduce nonspecific binding, then reacted with the rabbit polyclonal antibody to mouse PRL diluted with PBS (1:10 000, Biogenesis Ltd, Poole, UK) or to rat GH diluted with PBS (1:5000, Biogenesis Ltd) overnight at 4 °C. After washing in PBS, sections were incubated with biotinylated anti-rabbit IgG (1:500, Vector Laboratories Inc.) for 30 min. After washing in PBS, sections were incubated with ABC reagent (Vector Laboratories Inc.) for 30 min. Reaction products were visualized by using 3,3′-diaminobenzidine (DAB, Sigma Chemical Co). Negative control was prepared by incubation of sections with rabbit immunoglobulin fraction (DAKO Cytomation, Glostrup, Denmark) instead of the primary antibody. Finally, sections were counterstained with hematoxylin.
BrdU and PRL immunohistchemistry
For BrdU and PRL double-immunostaining, pituitaries were fixed in 10% (v/v) formalin neutral buffer solution (Wako Pure Chemical Industries, Ltd, Osaka, Japan) overnight as this fixative was better than Bouin's solution for the double staining of BrdU and PRL, dehydrated and embedded in paraffin. Sections of 4-μm were mounted on silane coated glass slides. After deparafinization, endogenous peroxydase was blocked by 0.3% (v/v) H2O2 in methanol for 30 min. For denaturation of DNA, sections were incubated in 2 M HCl for 20 min at room temperature, and immersed in 0.1 M borate buffer (pH 8.5) to neutralize pH. After washing in PBS, sections were digested with 0.1% (w/v) trypsin (Sigma Chemical Co.) in PBS for 30 min at 37 °C. After preincubation with 1% (w/v) BSA/PBS at room temperature to block nonspecific binding, sections were incubated with anti-BrdU antibody (1:15, Roche Molecular Biochemical) at room temperature for 60 min. Then, DAB with NiCl2 reaction was carried out. After washing in PBS, sections were immunostained using anti-PRL antibody (Biogenesis Ltd) as described above and counterstained with methylgreen (Chroma-Gesellschaft Schmid, Kongen, Germany).
In situ hybridization
For Gh mRNA in situ hybridization, pituitaries were fixed in 4% (w/v) paraformaldehyde overnight at 4 °C, embedded in paraffin and sectioned at 4-μm thickness. Sections were digested with 10 μg/ml proteinase K (Wako Pure Chemical Industries, Ltd) for 15 min at 37 °C, and then post-fixed with 4% (w/v) paraformaldehyde in PBS, followed by an acetylation treatment.
The cDNA fragment encoding a part of the mouse Gh was generated from total RNA prepared from the WT mouse pituitary by RT-PCR with a pair of primers (forward 5′ CTGGCTGCTGACACCTACAA 3′ and reverse 5′ GCTAGAAGGCACAGCTGCTT 3′). These primers generate PCR products of 508 bp for the mouse Gh. The cDNA fragment was subcloned into pGEM-T Easy (Promega), sequenced and confirmed to be cDNA encoding a part of the mouse Gh. The probes were synthesized from subcloned plasmids using a PCR digoxygenin (DIG) synthesis kit (Roche) with a pair of primers described above.
Sections were prehybridized with 4× SSC/40% (v/v) formamide at 37 °C, then hybridized in a solution containing 50% (v/v) formamide, 200 ng/ml tRNA, 10% (w/v) dextran sulfate, 1× Dehardt's solution, 10 mM Tris–HCl, 600 mM NaCl, 0.25% (w/v) SDS, 1 mM EDTA (pH 8.0), and DIG-labeled probe (1:50) at 37 °C overnight in a moist chamber. Slides were washed in 5× SSC for 5 min, and 2× SSC/50% (v/v) formamide for 1 h at 37 °C five times, then washed in 2× SSC twice. After preincubation with 1.5% (w/v) blocking reagent (DIG Luminescent Detection Kit, Roche) for 60 min, sections were incubated with the primary antibody diluted at 1:1000 for anti-DIG-AP, Fab fragments (Roche) for 2 h at room temperature. After washing in DIG buffer 1 (100 mM Tris–HCl, pH 7.5 and 150 mM NaCl) and DIG buffer 3 (100 mM Tris–HCl, pH 9.5, 100 mM NaCl and 50 mM MgCl2), hybridization signal was visualized with nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate in DIG buffer 3 for 15 h, then the reaction was stopped by Tris–EDTA buffer (10 mM Tris–HCl pH 7.6 and 1 mM EDTA). Finally, slides were post-fixed in 4% paraformaldehyde in PBS for 60 min at 4 °C and counterstained with methylgreen (Chroma-Gesellshaft, Schmid GmbH).
Real-time RT-PCR
For real-time RT-PCR, anterior pituitaries were separated from posterior and intermediate lobes, and homogenized in TRIzol (Invitrogen Corp). Total RNA from anterior pituitaries was purified using DNase I (Roche) to remove genomic DNA and cleaned up with an RNeasy total RNA kit (Qiagen). The amount and integrity of RNA were assessed by measurement of optical density (OD) at 260 and 280 nm. RNA (1 μg) was reverse transcribed into first strand cDNA using SuperScript II reverse transcriptase (Invitrogen Corp.) using oligo dT primer (Invitrogen Corp). Real-time PCR was carried out with a Smart Cycler II System with a total reaction volume of 25 μl consisting of 12.5 μl SYBR Green Master Mix (Takara Bio Inc., Otsu, Japan) by the standard curve method. Primer sequences are indicated in Table 1. Cyclophilin was chosen as an internal standard to control variability in amplification due to differences in starting mRNA concentration. Pituitaries from 3 to 5 mice were pooled for each point and three independent experiments were carried out for each study.
Primer sequences used for real-time RT-PCR
| Forward sequence (5′→3′) | Reverse sequence (5′→3′) | |
|---|---|---|
| Gene | ||
| Prl | TCAAGAAGCCCCCGAATACA | TCCCATTTCCTTTGGCTTCA |
| Pit-1 | TGAGCAGGTCGGAGCTTTGTA | TCCGTTTCCTCTTCCTTTCGT |
| Esr1 | CCTAGCTCAGCTGCTCCTTCTCATTCTT | GGCACAACGTTCTTGCATTTC |
| Drd2 | CCCAGAGAGGACCCGGTATAG | CTGGTTTGGCAGGACTGTCA |
| Egf | ATGTCCTGGACAAACGGCTCT | ACAAACTGTGCCGTGCTTGA |
| Cyclophilin | CCATCCAGCCATTCAGTCTTG | AGGTCCTGGCATCTTGTCCAT |
Organ culture
Three-to-five pituitaries of 10-day-old WT and IGF1KO mice were placed on a 24-well culture plate with 200 μl serum-free DMEM/Nutrient Mixture F12 (1:1, phenol red free, Invitrogen Corp.) with or without 10−9 M E2 (Sigma Chemical Co.), 20 ng/ml IGF1 (Sigma Chemical Co.) or 50 ng/ml EGF (Sigma Chemical Co.) and 1 ng/ml BSA (Sigma Chemical Co.) and incubated at 37 °C in a humidified 5% CO2 atmosphere in air for 5 days. Serum-free DMEM/Nutrient Mixture F12 (phenol red free, 50 μl) was added in a well on day 3 of culture. After 5 days in culture, pituitaries were fixed in Bouin's solution and immunostained for PRL cells and GH cells as described above.
To investigate cell proliferation, pituitaries of WT mice were incubated with or without IGF1, E2, or EGF for 24 h, and then culture medium containing 100 mg/ml BrdU was added to each treatment and incubated for 24 h. After a total of 48 h culture, each pituitary was fixed with 10% (v/v) formalin neutral buffer solution and PRL/BrdU double immunohistochemistry was performed as described above.
Cell count and data analysis
For PRL/BrdU and GH immunohistochemistory and in situ hybridization, five individual pituitaries were used. GH, PRL, and BrdU immunoreactive cells were counted under a light microscope with an ×40 objective lens. Positive cells in 200 anterior pituitary cells were counted in six randomly chosen areas from transversal horizontal sections. Three different sections from each pituitary were chosen to avoid counting the same cells.
For multiple comparisons, treatment groups were compared using ANOVA followed by appropriate post hoc tests. Two-tailed Student's t-test after application of F test was used for comparison of two mean values. A statistically significant difference was defined as P<0.05.
Results
PRL and GH immunoreactive cells in the anterior pituitary of WT and IGF1KO adult mice
PRL and GH immunoreactivities were observed in the cytoplasm of anterior pituitary cells of 3- to 5-month-old WT and IGF1KO mice, respectively (Fig. 1A–D). Negative control incubating with rabbit immunoglobulin fraction showed no staining (Fig. 1E). These cells formed clusters and were distributed randomly in the anterior pituitaries in both WT and IGF1KO mice. The percentage of GH cells in pituitaries of IGF1KO mice was significantly higher as compared with that in WT mice (Fig. 2A). In contrast, the percentage of PRL cells in IGF1KO mice was significantly lower than that in WT mice (Fig. 2B). Some PRL cells in the anterior pituitaries both in WT and IGF1KO mice also showed positive staining for GH (somatolactotrophs, data not shown).
Immunohistochemical staining of GH in the pituitaries of 3- to 5-month-old WT (A) and IGF1KO (B) mice and prolactin (PRL) in the pituitaries of 3- to 5-month-old WT (C) and IGF1KO (D) mice. Negative staining for PRL and GH immunostaining (E).
Citation: Journal of Endocrinology 203, 2; 10.1677/JOE-09-0232
The percentages of GH positive cells (A) and PRL positive cells (B) in the anterior pituitaries of adult (3–5 months old) WT and IGF1KO mice. aSignificantly different from that in WT mice, P<0.05 (Student's t-test).
Citation: Journal of Endocrinology 203, 2; 10.1677/JOE-09-0232
Gh mRNA expressing cells in the anterior pituitary of adult WT and IGF1KO adult mice
Stefaneanu et al. (1999) already demonstrated that Prl mRNA expressing cells were reduced in IGF1KO mice and the IGF1 administration to adult IGF1KO mice had no effect on the intensity or Prl RNA signal. Therefore, in this study, only Gh mRNA expressing cells were analyzed. Gh mRNA expressing cells were detected in the anterior lobe but not in the intermediate and posterior lobes of pituitaries of adult WT and IGF1KO mice, and no signal was detected in the negative controls in the anterior lobe by in situ hybridization (Fig. 3A and B). Gh mRNA expressing cells in IGF1KO mice were distinguishable, and the percentage of Gh mRNA expressing cells was significantly higher compared with that in WT mice (Fig. 3C).
In situ hybridization of Gh mRNA in the pituitaries of WT (A) and IGF1KO (B) mice and the percentage of Gh mRNA expressing cells of adult (3–5 months old) WT and IGF1KO mice (C). aSignificantly different from that in WT mice, P<0.05 (Student's t-test).
Citation: Journal of Endocrinology 203, 2; 10.1677/JOE-09-0232
BrdU and PRL double immunostaining in 5- to 20-day-old WT and IGF1KO mice
In the anterior pituitary of WT and IGF1KO mice, BrdU-labeled cells were observed between days 5 and 20 (Fig. 4A–D). The percentage of BrdU-labeled cells in WT mice was high at day 5 and it decreased from days 10 to 20 (Fig. 4E). PRL cells in WT mice conversely increased with age (Fig. 4E). In the anterior pituitaries of IGF1KO mice, the percentage of BrdU-labeled cells was similar to that in WT mice at days 5–20 (Fig. 4E). In IGF1KO mice, the percentage of PRL cells increased with age as seen in WT mice; however, the percentage of PRL cells in IGF1KO mice at day 20 was significantly lower than that in the age-matched WT mice (Fig. 4E). Furthermore, a few PRL and BrdU double positive cells were found in WT and IGF1KO mice at days 5–20, although, there was no difference in the percentages of double positive cells between WT and IGF1KO mice (data not shown).
Immunohistochemical double staining of PRL and BrdU in WT (A and B) and IGF1KO (C and D) mice at day 10 (A and C) and day 20 (B and D). The percentages of PRL-stained cells (filled squares (WT) and open squares (IGF1KO)) and BrdU-labeled cells (filled circles (WT) and open circles (IGF1KO)) in the anterior pituitaries of mice at days 5–20 (E). aSignificantly different from that in age-matched WT mice. P<0.05 (Student's t-test).
Citation: Journal of Endocrinology 203, 2; 10.1677/JOE-09-0232
GH immunostaining in 10- to 20-day-old WT and IGF1KO mice
In postnatal mice, GH immuoreactive cells were clearly distinguishable (Fig. 5A and B). The percentage of GH cells in IGF1KO mice had significantly increased as compared with that in WT mice through days 10–20 (Fig. 5C).
Immunohistochemical staining of GH in WT (A) and IGF1KO (B) mice at day 10. The percentage of GH cells (squares (WT) and circles (IGF1KO)) in the anterior pituitaries of WT and IGF1KO mice (C) at days 10, 15, and 20. aSignificantly different from that in the age-matched WT mice. P<0.05 (Student's t-test).
Citation: Journal of Endocrinology 203, 2; 10.1677/JOE-09-0232
Real-time RT-PCR
To clarify the changes in expression of factors involved in PRL cell proliferation and differentiation in anterior pituitaries, mRNA expression of Prl, Pit-1, Esr1, Egf, and Drd2 was analyzed in WT and IGF1KO mice at days 10 and 20. mRNA expression of these genes showed no difference between WT and IGF1KO mice at days 10 and 20 (Fig. 6).
Changes in the mRNA expression of genes related to PRL production in WT and IGF1KO mice at days 10 and 20.
Citation: Journal of Endocrinology 203, 2; 10.1677/JOE-09-0232
PRL and GH cells in organ-cultured WT and IGF1KO mouse pituitaries
Stefaneanu et al. (1999) report that PRL cell number and serum PRL levels in adult IGF1KO mice are not changed by IGF1 injections; therefore, we investigated the effects of IGF1, E2, and EGF on PRL production in pituitaries of WT and IGF1KO mice at day 10 using an organ culture system. After 5 days in culture with control medium, the percentage of PRL cells was not different between WT and IGF1KO mouse pituitaries (Fig. 7A and B). When pituitaries of WT and IGF1KO mice were cultured with IGF1, E2, or EGF, the percentages of PRL cells were significantly increased as compared with those in controls (Figs 7A, B, E, F, I, J, M, N and 8). A combination of IGF1 and E2 treatment also caused a significant increase as compared with that in controls, but it was not an additive effect on pituitaries from both WT and IGF1KO mice (Figs 7A, B, Q, R and 8). Interestingly, when pituitaries of IGF1KO mice were cultured with E2 or EGF, the percentage of PRL cells was significantly lower than that in WT mice (Fig. 8).
Immunohistochemical staining of PRL in the organ-cultured anterior pituitaries from WT (A, E, I, M, and Q) and IGF1KO (B, F, J, N, and R) mice, and GH in the organ-cultured anterior pituitaries from WT (C, G, K, O, and S) and IGF1KO (D, H, L, P, and T) mice. Control (A–D), IGF1 (E–H), E2 (I–L), EGF (M–P), and IGF1+E2 (Q–T) treatments. Control, BSA; IGF1, 20 ng/ml insulin-like growth factor 1; E2, 10−9 M 17β-estradiol; EGF, 50 ng/ml epidermal growth factor.
Citation: Journal of Endocrinology 203, 2; 10.1677/JOE-09-0232
The percentages of PRL and GH cells in organ-cultured anterior pituitaries treated with BSA control, IGF1, E2, EGF or IGF1+E2. *Significantly different from control treatment, P<0.05. aSignificantly different from the same treatment of WT pituitaries, P<0.05 (post hoc test).
Citation: Journal of Endocrinology 203, 2; 10.1677/JOE-09-0232
The percentage of GH cells in pituitaries of WT mice was not different from those in IGF1KO mice after 5 days in culture (Figs 7C, D, G, H, K, L, O, P, S, T and 8).
To elucidate whether an increase of PRL cell number was due to cell proliferation of PRL cells, BrdU-labeled cells were counted in pituitaries of WT mice after 2 days in culture. The number of BrdU-labeled cells was similar among treatments (data not shown).
Discussion
IGF1 has a crucial role in the increase in PRL cell number because these cells are reduced in female IGF1KO mice from day 10 to adult (Saitoh et al. 2005). In this study, the percentage of PRL cells was significantly lower in male IGF1KO mice at day 20 as compared with age-matched WT mice, but the percentage of BrdU-labeled cells was not different between WT and IGF1KO mice. Thus, some of the anterior pituitary cells in immature IGF1KO mice may not be able to differentiate into PRL cells in both sexes. PRL cells in the anterior pituitary proliferate and differentiate from late fetal ages to postnatal periods (Taniguchi et al. 2001). In this study, the percentage of BrdU-labeled cells was high at day 5 and decreased; however, PRL cells increased in number with age, suggesting that PRL is not synthesized during mitosis of progenitor cells, and differentiated cells begin to produce PRL from days 15 to 20. A similar phenomenon is also reported in rat anterior pituitaries (Taniguchi et al. 2001). However, BrdU- and PRL-labeled cells were also found during neonatal period, indicating that some differentiated PRL cells have the potential to proliferate.
GH cells and PRL cells are thought to originate from common progenitor cells. The progenitor cells express Pit-1 and Prop-1, which are essential for differentiation of PRL cells (Slabaugh et al. 1981, Simmons et al. 1990). PRL cells are also believed to be differentiated from GH-producing cells or somatolactotrophs that express GH and PRL. Borrelli et al. (1989) show that transgenic mice expressing HSV1-TK gene under the rat Gh promoter treated with FIAU results in the complete loss of somatotrophs and lactotrophs. Behringer et al. (1988) also show a severe decrease in lactotrophs in the anterior pituitary of rGh-DT-A transgenic mice which targeted diphtheria toxin-mediated destruction of GH producing cells. These results indicate that PRL cells arise from GH cells. However, in the adult rGhp-Cre transgenic mice, only 10% of lactotrophs are derived from somatotrophs (Luque et al. 2007). In this study, GH cells in IGF1KO mice were already increased at day 10 because of the absence of the IGF1 negative feedback loop that suppressed GH production (Wallenius et al. 2001). An increase of GH cells may be due to the mass differentiation of progenitor cells to GH cells, therefore, it may result in suppression of PRL cell differentiation in IGF1KO mice because PRL cells and GH cells are derived from the same origin. IGF1 may regulate the balance of GH cells and PRL cells during the immature period.
Several factors may be related to PRL cell proliferation and/or differentiation, including E2, IGF1, and EGF. E2 stimulates PRL cell proliferation (Wiklund et al. 1981, Amara et al. 1987) and E2 also induces transdifferentiation of PRL cells from GH cells via somatolactotrophs (Behringer et al. 1988, Borrelli et al. 1989, Goda et al. 1998). Furthermore, EGF plays a role in cell proliferation and differentiation in the mouse anterior pituitary (Schwardz 2000). EGF induces the expression of dopamine receptor and transdifferentiation into lactotroph-like cells in the GH3 cell line (Missale et al. 1991) and PRL cell differentiation in the MtT/S cell line (Goda et al. 1998). Ben-Jonathan et al. (2009) show that the ability of EGF to stimulate Prl gene expression and release is mediated by Erk1/2-induced phosphorylation of Esr1 in GH3 cells, which express both Esr1 and Esr2 (Mitchner et al. 1999). Thus, E2 and EGF can share a common pathway in the control of Prl gene expression. IGF1 also converts GH cells into PRL cells in the MtT/S cells (Inoue & Sakai 1991). Hypothalamic dopamine inhibits PRL production and cell proliferation (Freeman et al. 2000, Ben-Jonathan & Hnasko 2001). In this study, the differentiation of PRL cells was stimulated by IGF1, E2 or EGF in the anterior pituitary of IGF1KO mice in vitro. In addition, the percentage of PRL cells in IGF1KO mice stimulated by E2 or EGF was significantly lower than that in the WT mice, suggesting that IGF1 mediates E2 or EGF action partially. In addition, Esr1, Egf, and Drd2 mRNA were not different between WT and IGF1KO mice at days 10 and 20, in spite of a decrease in PRL cell number at day 20. This fact suggests that deletion of IGF1 does not affect the expression of these genes.
Pit-1 mRNA level was not changed in pituitaries from both WT and IGF1KO mice, suggesting that IGF1KO mice may have the same population of progenitor cells. Interestingly, the Prl mRNA level in IGF1KO mice was similar to that in WT mice at days 10 or 20. However, Prl mRNA expressing cells in adult IGF1KO mice are decreased (Stefaneanu et al. 1999), suggesting that IGF1 is responsible for PRL protein synthesis rather than PRL transcription in immature male IGF1KO mice.
IGF1 injection to IGF1KO mice shows no effect on the percentage of Prl mRNA expressing cells (Stefaneanu et al. 1999), which is in conflict with the result in this study. The discrepancy between these studies may be due to differences in the age of the mice used. In the anterior pituitary of day 10 mice, PRL cells are undergoing differentiation and progenitor cells may still exist, while percentages of PRL cells in adult mice are maximally increased. Therefore, IGF1 can stimulate the differentiation of these progenitor cells in WT and IGF1KO mice at day 10 but not in the adult.
A combination of IGF1 and E2 increased the percentage of PRL cells, but it was not an additive effect. Several reports show that E2 inhibits IGF1 action which induces proliferation of PRL cells in primary culture of rat pituitary (Kawashima et al. 2002, Gutiérrez et al. 2005). However, an antagonistic effect of estrogen was not observed in this study, it may be due to the use of pituitaries from the developmental period of mice. Arroba et al. (2005) show that E2 utilizes IGF1 receptor to stimulate PRL cells and activates MAPK cascade. This may be one of the reasons that an additive increase was not observed in E2 and IGF1 treatments because of the sharing the same signaling pathway. Another possibility is the limit of progenitor cells in number, the percentage of PRL cells can reach a plateau even after a combination of IGF1 and E2 treatment. In addition, the percentage of PRL cells in our data was higher than that in the previous report (Stefaneanu et al. 1999), therefore, it is necessary to confirm the percentage of cells producing both GH and PRL in the next study.
GH cells in the pituitaries of WT and IGF1KO mice were increased after 5 days in culture with the control medium. Since Gh gene expression is suppressed by IGF1 at the pituitary level (Goodyer et al. 1984, Yamashita & Melmed 1986), the hypothalamic level (Abe et al. 1983, Tannenbaum et al. 1983) and somatostatin from the hypothalamus (Sugihara et al. 1999, Morishita et al. 2003), GH cells can be increased when the pituitary is released from suppression. However, addition of IGF1 did not decrease GH cell number in vitro, suggesting that IGF1 suppresses GH synthesis through the hypothalamus or somatostatin at day 10. Similarly, PRL cells did not increase in control medium, indicating that PRL cell differentiation is not inhibited by the factors from the hypothalamus and stimulative factors induce differentiation from progenitor cells to PRL cells at this age.
In conclusion, IGF1 is essential for PRL cell differentiation, but not proliferation. In IGF1KO mice, the number of PRL cells is low due to the increase of GH cells from the same progenitor cells. IGF1 is a mediator of E2 and EGF signaling in pituitary cells. Thus, IGF1 plays a crucial role for PRL cell development by regulating differentiation of progenitor cells and mediating actions of E2 and EGF.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was partially supported by a Grant-in-Aid for Scientific Research on Priority Areas (A) (T S), Grants-in-Aid for Encouragement of Young Scientists (T S) and Scientific Research (B) (T I) from the Ministry of Education, Culture, Sports, Science and Technology of Japan, a Grant for Support of the Promotion of Research at Yokohama City University (S H and T S), a Grant for Support of the Collaborative Study at NIBB (T S), and a Health Sciences Research Grant from the Ministry of Health, Labor and Welfare, Japan (T I).
Acknowledgements
We thank Dr Argiris Efstratiadis (Columbia University) and the late Dr Matthew Hardy (Population Council) for supplying the IGF1 knockout mice. Authors are grateful to Dr Raphael Guzman, Department of Molecular Cell Biology and Cancer Research Laboratory of University of California, Berkeley, for his critical reading of this manuscript.
References
Abe H, Molitch ME, Van Wyk JJ & Underwood LE 1983 Human growth hormone and somatomedin C suppress the spontaneous release of growth hormone in unanesthetized rats. Endocrinology 113 1319–1324.
Amara JF, Van Itallie C & Dannies PS 1987 Regulation of prolactin production and cell growth by estradiol: difference in sensitivity to estradiol occurs at level of messenger ribonucleic acid accumulation. Endocrinology 120 264–271.
Arroba AI, Frago LM, Argente J & Chowen JA 2005 Oestrogen requires the insulin-like growth factor-I receptor for stimulation of prolactin synthesis via mitogen-activated protein kinase. Journal of Neuroendocrinology 17 97–104.
Baker J, Hardy MP, Zhou J, Bondy C, Lupu F, Bellvé AR & Efstratiadis A 1996 Effects of an Igf1 gene null mutation on mouse reproduction. Molecular Endocrinology 10 903–918.
Behringer RR, Mathews LS, Palmiter RD & Brinster RL 1988 Dwarf mice produced by genetic ablation of growth hormone-expressing cells. Genes and Development 2 453–461.
Ben-Jonathan N & Hnasko R 2001 Dopamine as a prolactin (PRL) inhibitor. Endocrine Reviews 22 724–763.
Ben-Jonathan N, Chen S, Dunckley JA, Lapensee C & Kansra S 2009 Estrogen receptor-alpha mediates the epidermal growth factor-stimulated prolactin expression and release in lactotrophs. Endocrinology 150 795–802.
Borrelli E, Heyman RA, Arias C, Sawchenko PE & Evans RM 1989 Transgenic mice with inducible dwarfism. Nature 339 538–541.
Cristina C, García-Tornadú I, Díaz-Torga G, Rubinstein M, Low MJ & Becú-Villalobos D 2006 Dopaminergic D2 receptor knockout mouse: an animal model of prolactinoma. Frontiers of Hormone Research 35 50–63.
Denef C 2003 Paracrine control of lactotrope proliferation and differentiation. Trends in Endocrinology and Metabolism 14 188–195.
D'Ercole AJ, Stiles AD & Underwood LE 1984 Tissue concentrations of somatomedin C: further evidence for multiple sites of synthesis and paracrine or autocrine mechanisms of action. PNAS 81 935–959.
Eppler E, Jevdjovic T, Maake C & Reinecke M 2007 Insulin-like growth factor 1 (IGF-1) and its receptor (IGF-1R) in the rat anterior pituitary. European Journal of Neuroscience 25 191–200.
Freeman ME, Kanyicska B, Lerant A & Nagy G 2000 Prolactin: structure, function, and regulation of secretion. Physiological Reviews 80 1523–1631.
Goda H, Sakai T, Kurosumi M & Inoue K 1998 Prolactin-producing cells differentiate from G0/G1-arrested somatotrophs in vitro: an analysis of cell cycle phases and mammotroph differentiation. Endocrine Journal 45 725–735.
González-Parra S, Chowen JA, Garciá Segura LM & Argente J 1996 Ontogeny of pituitary transcription factor-1 (Pit-1), growth hormone (GH) and prolactin (PRL) mRNA levels in male and female rats and the differential expression of Pit-1 in lactotrophs and somatotrophs. Journal of Neuroendocrinology 8 211–225.
Goodyer CG, De Stephano L, Guyda HJ & Posner BI 1984 Effects of insulin-like growth factors on adult male rat pituitary function in tissue culture. Endocrinology 115 1568–1576.
Gutiérrez S, Petiti JP, De Paul AL, Mukdsi JH, Aoki A, Torres AI & Orgnero EM 2005 Antagonic effects of oestradiol in interaction with IGF-1 on proliferation of lactotroph cells in vitro. Histochemistry and Cell Biology 124 291–301.
Honda J, Takeuchi S, Fukamachi H & Takahashi S 1998 Insulin-like growth factor-1 and its receptor in mouse pituitary glands. Zoological Science 15 573–579.
Inoue K & Sakai T 1991 Conversion of growth hormone-secreting cells into prolactin-secreting cells and its promotion by insulin and insulin-like growth factor-1 in vitro. Experimental Cell Research 195 53–58.
Kawashima K, Yamakawa K, Takahashi W, Takizawa S, Yin P, Sugiyama N, Kanba S & Arita J 2002 The estrogen-occupied estrogen receptor functions as a negative regulator to inhibit cell proliferation induced by insulin/IGF-1: a cell context-specific antimitogenic action of estradiol on rat lactotrophs in culture. Endocrinology 143 2750–2758.
Lembo G, Rockman HA, Hunter JJ, Steinmetz H, Koch WJ, Ma L, Prinz MP, Ross J Jr, Chien KR & Powell-Braxton L 1996 Elevated blood pressure and enhanced myocardial contractility in mice with severe IGF-1 deficiency. Journal of Clinical Investigation 98 2648–2655.
LeRoith D, Werner H, Beitner-Johnson D & Roberts CT Jr 1995 Molecular and cellular aspects of the insulin-like growth factor 1 receptor. Endocrine Reviews 16 143–163.
Lloyd HM, Meares JD & Jacobi J 1975 Effects of oestrogen and bromocryptine on in vivo secretion and mitosis in prolactin cells. Nature 255 497–498.
Luque RM, Amargo G, Ishii S, Lobe C, Franks R, Kiyokawa H & Kineman RD 2007 Reporter expression, induced by a growth hormone promoter-driven Cre recombinase (rGHp-Cre) transgene, questions the developmental relationship between somatotropes and lactotropes in the adult mouse pituitary gland. Endocrinology 148 1946–1953.
Missale C, Castelletti L, Boroni F, Memo M & Spano P 1991 Epidermal growth factor induces the functional expression of dopamine receptors in the GH3 cell line. Endocrinology 128 13–20.
Mitchner NA, Garlick C, Steinmetz RW & Ben-Jonathan N 1999 Differential effects of estrogen receptors α and β in GH3 cells. Endocrinology 140 2651–2658.
Morishita M, Iwasaki Y, Onishi A, Asai M, Mutsuga N, Yoshida M, Oiso Y, Inoue K & Murohara T 2003 The effects of GH-releasing hormone/somatostatin on the 5′-promoter activity of the GH gene in vitro. Journal of Molecular Endocrinology 31 441–448.
Ogasawara K, Nogami H, Tsuda MC, Gustafsson JA, Korach KS, Ogawa S, Harigaya T & Hisano S 2009 Hormonal regulation of prolactin cell development in the fetal pituitary gland of the mouse. Endocrinology 150 1061–1068.
Oomizu S, Takeuchi S & Takahashi S 1998 Stimulatory effect of insulin-like growth factor I on proliferation of mouse pituitary cells in serum-free culture. Journal of Endocrinology 157 53–62.
Pelletier G, Li S, Phaneuf D, Martel C & Labrie F 2003 Morphological studies of prolactin-secreting cells in estrogen receptor alpha and estrogen receptor beta knockout mice. Neuroendocrinology 77 324–333.
Raymond V, Beaulieu M, Labrie F & Boissier J 1978 Potent antidopaminergic activity of estradiol at the pituitary level on prolactin release. Science 200 1173–1175.
Saitoh Y, Sato T & Hayashi S 2005 Estrogen action on PRL cells of anterior pituitary in IGF-1 KO mice. Zoological Science 22 1501.
Schwardz J 2000 Intracellular communication in the anterior pituitary. Endocrine Reviews 21 488–513.
Simmons DM, Voss JW, Ingraham HA, Holloway JM, Broide RS, Rosenfeld MG & Swanson LW 1990 Pituitary cell phenotypes involve cell-specific Pit-1 mRNA translation and synergistic interactions with other classes of transcription factors. Genes and Development 4 695–711.
Slabaugh MB, Lieberman ME, Rutledge JJ & Gorski J 1981 Growth hormone and prolactin synthesis in normal and homozygous snell and ames dwarf mice. Endocrinology 109 1040–1046.
Stefaneanu L, Powell-Braxton L, Won W, Chandrashekar V & Bartke A 1999 Somatotroph and lactotroph changes in the adenohypophyses of mice with disrupted insulin-like growth factor 1 gene. Endocrinology 140 3881–3889.
Sugihara H, Emoto N, Tamura H, Kamegai J, Shibasaki T, Minami S & Wakabayashi I 1999 Effect of insulin-like growth factor-1 on growth hormone-releasing factor receptor expression in primary rat anterior pituitary cell culture. Neuroscience Letters 276 87–90.
Taniguchi Y, Yasutaka S, Kominami R & Shinohara H 2001 Proliferation and differentiation of pituitary somatotrophs and mammotrophs during late fetal and postnatal periods. Anatomy and Embryology 204 469–475.
Tannenbaum GS, Guyda HJ & Posner BI 1983 Insulin-like growth factors: a role in growth hormone negative feedback and body weight regulation via brain. Science 220 77–79.
Wallenius K, Sjogren K, Peng XD, Park S, Wallenius V, Liu JL, Umaerus M, Wennbo H, Isaksson O & Frohman L et al. 2001 Liver-derived IGF-I regulates GH secretion at the pituitary level in mice. Endocrinology 142 4762–4770.
Watanabe YG & Haraguchi H 1994 Immunohistochemical study of the cytogenesis of prolactin and growth hormone calls in the anterior pituitary grand of fetal rat. Archives of Histology and Cytology 57 161–166.
Wiklund J, Wertz N & Gorski J 1981 A comparison of estrogen effects on uterine and pituitary growth and prolactin synthesis in F344 and Holtzman rats. Endocrinology 109 1700–1707.
Yamashita S & Melmed S 1986 Insulin-like growth factor I action on rat anterior pituitary cells: suppression of growth hormone secretion and messenger ribonucleic acid levels. Endocrinology 118 176–182.
Yokoyama S, Stefaneanu L & Kovacs K 1997 Pituitary insulin-like growth factors. Endocrine Pathology 8 167–179.
