A novel spontaneous mutation of Irs1 in mice results in hyperinsulinemia, reduced growth, low bone mass and impaired adipogenesis

in Journal of Endocrinology
Authors:
Victoria E DeMambro
Search for other papers by Victoria E DeMambro in
Current site
Google Scholar
PubMed
Close
,
Masanobu Kawai The Jackson Laboratory, Medical Center Research Institute, John Hopkins University, Massachusetts General Hospital, Department of Research, 600 Main Street, Bar Harbor, Maine 04609, USA

Search for other papers by Masanobu Kawai in
Current site
Google Scholar
PubMed
Close
,
Thomas L Clemens The Jackson Laboratory, Medical Center Research Institute, John Hopkins University, Massachusetts General Hospital, Department of Research, 600 Main Street, Bar Harbor, Maine 04609, USA

Search for other papers by Thomas L Clemens in
Current site
Google Scholar
PubMed
Close
,
Keertik Fulzele The Jackson Laboratory, Medical Center Research Institute, John Hopkins University, Massachusetts General Hospital, Department of Research, 600 Main Street, Bar Harbor, Maine 04609, USA

Search for other papers by Keertik Fulzele in
Current site
Google Scholar
PubMed
Close
,
Jane A Maynard
Search for other papers by Jane A Maynard in
Current site
Google Scholar
PubMed
Close
,
Caralina Marín de Evsikova
Search for other papers by Caralina Marín de Evsikova in
Current site
Google Scholar
PubMed
Close
,
Kenneth R Johnson
Search for other papers by Kenneth R Johnson in
Current site
Google Scholar
PubMed
Close
,
Ernesto Canalis The Jackson Laboratory, Medical Center Research Institute, John Hopkins University, Massachusetts General Hospital, Department of Research, 600 Main Street, Bar Harbor, Maine 04609, USA

Search for other papers by Ernesto Canalis in
Current site
Google Scholar
PubMed
Close
,
Wesley G Beamer
Search for other papers by Wesley G Beamer in
Current site
Google Scholar
PubMed
Close
,
Clifford J Rosen The Jackson Laboratory, Medical Center Research Institute, John Hopkins University, Massachusetts General Hospital, Department of Research, 600 Main Street, Bar Harbor, Maine 04609, USA

Search for other papers by Clifford J Rosen in
Current site
Google Scholar
PubMed
Close
, and
Leah Rae Donahue
Search for other papers by Leah Rae Donahue in
Current site
Google Scholar
PubMed
Close

(Correspondence should be addressed to V E DeMambro; Email: victoria.demambro@yahoo.com)
Free access

Sign up for journal news

A spontaneous mouse mutant, designated ‘small’ (sml), was recognized by reduced body size suggesting a defect in the IGF1/GH axis. The mutation was mapped to the chromosome 1 region containing Irs1, a viable candidate gene whose sequence revealed a single nucleotide deletion resulting in a premature stop codon. Despite normal mRNA levels in mutant and control littermate livers, western blot analysis revealed no detectable protein in mutant liver lysates. When compared with the control littermates, Irs1sml/Irs1sml (Irs1sml/sml) mice were small, lean, hearing impaired; had 20% less serum IGF1; were hyperinsulinemic; and were mildly insulin resistant. Irs1sml/sml mice had low bone mineral density, reduced trabecular and cortical thicknesses, and low bone formation rates, while osteoblast and osteoclast numbers were increased in the females but not different in the males compared with the Irs1+/+ controls. In vitro, Irs1sml/sml bone marrow stromal cell cultures showed decreased alkaline phosphatase-positive colony forming units (pre-osteoblasts; CFU-AP+) and normal numbers of tartrate-resistant acid phosphatase-positive osteoclasts. Irs1sml/sml stromal cells treated with IGF1 exhibited a 50% decrease in AKT phosphorylation, indicative of defective downstream signaling. Similarities between engineered knockouts and the spontaneous mutation of Irs1sml were identified as well as significant differences with respect to heterozygosity and gender. In sum, we have identified a spontaneous mutation in the Irs1 gene associated with a major skeletal phenotype. Changes in the heterozygous Irs1+/sml mice raise the possibility that similar mutations in humans are associated with short stature or osteoporosis.

Abstract

A spontaneous mouse mutant, designated ‘small’ (sml), was recognized by reduced body size suggesting a defect in the IGF1/GH axis. The mutation was mapped to the chromosome 1 region containing Irs1, a viable candidate gene whose sequence revealed a single nucleotide deletion resulting in a premature stop codon. Despite normal mRNA levels in mutant and control littermate livers, western blot analysis revealed no detectable protein in mutant liver lysates. When compared with the control littermates, Irs1sml/Irs1sml (Irs1sml/sml) mice were small, lean, hearing impaired; had 20% less serum IGF1; were hyperinsulinemic; and were mildly insulin resistant. Irs1sml/sml mice had low bone mineral density, reduced trabecular and cortical thicknesses, and low bone formation rates, while osteoblast and osteoclast numbers were increased in the females but not different in the males compared with the Irs1+/+ controls. In vitro, Irs1sml/sml bone marrow stromal cell cultures showed decreased alkaline phosphatase-positive colony forming units (pre-osteoblasts; CFU-AP+) and normal numbers of tartrate-resistant acid phosphatase-positive osteoclasts. Irs1sml/sml stromal cells treated with IGF1 exhibited a 50% decrease in AKT phosphorylation, indicative of defective downstream signaling. Similarities between engineered knockouts and the spontaneous mutation of Irs1sml were identified as well as significant differences with respect to heterozygosity and gender. In sum, we have identified a spontaneous mutation in the Irs1 gene associated with a major skeletal phenotype. Changes in the heterozygous Irs1+/sml mice raise the possibility that similar mutations in humans are associated with short stature or osteoporosis.

Introduction

Insulin and insulin-like growth factor 1 (IGF1) are critical regulators of growth and metabolism in virtually all mammals. Insulin deficiency syndromes, such as diabetes mellitus type 1 (type I DM) and low IGF1 levels from GH deficiency or resistance, are associated with reduced bone mineral density (BMD) and heightened fracture risk (Garnero et al. 2000, Janghorbani et al. 2006, 2007, Räkel et al. 2008). GH deficiency and hence IGF1 deficiency in children and adults impair peak bone acquisition and are associated with an increased prevalence of fractures in adulthood (Vestergaard et al. 2002, Mukherjee et al. 2004, Giustina et al. 2008). Similarly, a spontaneous recessive mutation in GHRH also results in low areal BMD (aBMD) in mice and humans (Donahue & Beamer 1993, Godfrey et al. 1993, Maheshwari et al. 1998, Baumann 1999). Studies using genetically engineered mice have reinforced the importance of the IGF1 regulatory system in skeletal development. For example, global Igf1 gene deletion causes a dramatic skeletal phenotype characterized by impaired bone formation and bone resorption (Liu et al. 1993, Bikle et al. 2001, He et al. 2006, Wang et al. 2006). Conditional targeted deletion of the type I IGF receptor (Igf1r) in osteoblasts causes a profound reduction in trabecular bone volume and osteoblast function, and changes in mineralization lag time (Zhang et al. 2002). Furthermore, engineered knockout and transgenic overexpression of several IGF-binding proteins induce marked changes in bone turnover and bone mass (Silha et al. 2003, Zhang et al. 2003, Atti et al. 2005, Ben Lagha et al. 2006, DeMambro et al. 2008). Likewise, hepatic-specific deletion of Igf1 (Yakar et al. 1999) or global deletion of the acid-labile subunit (Igfals) in mice promotes marked thinning of the cortical bone compartment, despite minimal changes in linear growth (Yakar et al. 2009). Hence, skeletal and circulating IGF1 are essential for optimal peak bone acquisition.

Insulin and IGF1 initiate a chain of intracellular responses and signaling cascades upon binding to tyrosine kinase receptors (IR and Igf1r). The first substrates phosphorylated after ligand binding are the insulin receptor substrate (IRS) proteins. Once phosphorylated by their cognate receptors, these substrates bind to proteins containing Src homology-2 domains, which in turn activate a variety of signaling pathways, including activation of phosphatidylinositol 3-kinase and mitogen-activated protein kinase (Lienhard 1994, White 2003, Niu & Rosen 2005). These intracellular signaling pathways are essential for bone acquisition, since they impact the recruitment, differentiation, and death of osteoblasts (Cornish et al. 1996, Niu & Rosen 2005). Deletion of Irs1 (either the Irs1tm1Tka or the Irs1tm1Jos allele) on a mixed B6/CBA hybrid mouse background results in growth retardation; however, both female and male mice are relatively healthy and fertile (Araki et al. 1994, Tamemoto et al. 1994). Adult Irs1tm1Tka/Irs1tm1Tka (Irs1tm1Tka/tm1Tka) mice have low aBMD and delayed fracture healing, with reductions in osteoblast and osteoclast numbers and function, resulting in decreased bone turnover. These null mice also exhibit impaired anabolic response to intermittent parathyroid hormone administration (Ogata et al. 2000, Hoshi et al. 2004, Shimoaka et al. 2004, Yamaguchi et al. 2005). Both the Irs1tm1Tka/tm1Tka and the Irs1tm1Jos/Irs1tm1Jos (Irs1tm1Jos/tm1Jos) mice have high serum insulin levels and are insulin resistant despite a lean phenotype, but circulating IGF1 levels were reported not to differ significantly from those of the controls (Araki et al. 1994, Tamemoto et al. 1994, Shirakami et al. 2002). Thus, several animal models have confirmed that insulin and IGF1 signaling are critical for skeletal acquisition and maintenance.

There are no reports of a spontaneous mutation in the Irs1 gene leading to complete loss of function in mice or in humans. However, there are numerous studies on humans demonstrating polymorphisms in the Irs1 gene associated with metabolic disease, some of which induce amino acid changes and variable responsiveness to insulin and/or IGF1 signaling (Imai et al. 1994, Ura et al. 1996, Le Fur et al. 2002). The most common polymorphism, the G972R variant, has been associated with type II diabetes mellitus (Almind et al. 1993, Sesti 2000, Tok et al. 2006). In contrast, there is no data examining the relationship between these polymorphisms and BMD or fracture risk.

Recently, in the Mouse Mutant Resource at The Jackson Laboratory, we discovered a small mouse phenotype that arose as a spontaneous autosomal recessive mutation on a congenic C3.SW-H2b/SnJ inbred background. Molecular genetic studies revealed that this mutation, designated small (allele symbol sml), was due to a frameshift mutation in the Irs1 gene. This report details the molecular and phenotypic characterization of this mutant and the cellular changes that occur in response to altered IRS-1 signaling. Findings from this study add to insights gained from previous work using genetic engineering, and raise important questions about the inter-relationship between the IGF1 regulatory system and bone acquisition.

Materials and Methods

Mouse husbandry

The Irs1sml allele is a spontaneous mutation that occurred in an inbred C3.SW-H2b/SnJ mouse strain. All mice used in this study were produced and maintained in our research colony at The Jackson Laboratory (Bar Harbor, ME, USA). Mice were housed in groups of 4 or 5 of the same sex within polycarbonate boxes of 324 cm2 in area on sterilized shavings of Northern White Pine. Colony environmental conditions included 14 h light:10 h darkness cycles, with free access to acidified water (pH 2.5 with HCl to retard bacterial growth) and irradiated NIH-31 diet containing 6% fat, 19% protein, Ca:P 1.15:0.85, plus vitamin and mineral fortified (Purina Mills International, Gray Summit, MO, USA). All studies were conducted using groups of mutant, heterozygous, and wild-type male and female mice. All procedures involving mice were reviewed and approved by the Institutional Animal Care and Use Committee of The Jackson Laboratory.

Genetic mapping

To map the sml mutation, 204 F2 mice were produced from an intercross between (C3.SW-H2b/SnJ-sml×CAST/Ei) F1 hybrid mice. Genomic DNA from F2 mice was prepared and genotyped using Mit marker primer pairs as described previously (Gagnon et al. 2006). The sml mutation was mapped utilizing recombination frequencies and the Map Manager Program (Manly et al. 2001).

Sequencing of the Irs1 gene

PCR primers used to amplify exons 1 and 2 of the mouse Irs1 gene for sequence comparisons between mutant and control are given in Table 1. PCR conditions were described previously (Gagnon et al. 2006). PCR-amplified products were purified using the Qiaquick PCR Purification Kit (Qiagen Inc). DNA was sequenced using an Applied Biosystems 373A DNA Sequencer (Applied Biosystems, Foster City, CA, USA). The same primers that were used for PCR amplification were also used for sequencing.

Table 1

Irs1 gene amplification and sequencing primers

Primer sequence 5′ to 3′Product size
E1-1FGACTGGGGGAGACATAGTCC804
E1-1RTCCAGAGGAGCAAAACACGTGA
E1-2FCCTTTGCCCGATTATGCAG794
E1-2RTGCTCGAGTCCGATGTAGG
E1-3FAGTACCAGTGGCCATGGCT856
E1-3RCCTTTGCCCGATTATGCAG
E1-4FTCATTAACCCCATCAGACGC930
E1-4RGTGCTAGGGCTCACAGGACT
E1-5FCAACAGCAGCAGCAGTCTTC818
E1-5RAGGAGACATGGGCATATAGCC
E1-6FGAGCAGGGGCTGCAGTAG826
E1-6RCTGTTGGTCTGTGCAGCTGT
E1-7FGGAAGGGTCAGGGTACACAG642
E1-7RCTTGAGTGTCTGCGCGAAT
E1-2FAAAATGTAGCTTTCATTACAGCACA583
E2-1RAATACGGAGAGCTCACCCCT
E2-2FTTCATACATTGCCTCCGAGA725
E2-2RCTCTCCACCCAACATGAACA
E2-3FCCTACCTTGTGTGTTCTGGGA433
E2-3RCAAATTCTAAGCCGACACTTG

Genotyping of the Irs1sml colony

To genotype this mouse colony, we recognized that the deletion of the one adenine nucleotide in exon 1 created a restriction enzyme recognition site, which Taq1 recognizes (T-CGA). We designed primers (Irs1 F 5′-CAA GGA GGT CTG GCA GGT TA-3′ and Irs1 R 5′-CCC ACC TCG ATG AAG AAG AA-3′) to amplify the region of interest and then digested them with Taq1 restriction enzyme as per the manufacturer's instructions. The digested products yielded a control band of 190 bp, with a mutant band of 171 bp.

Quantitative real-time PCR

RNA was extracted from the femurs of four 8-week-old Irs1sml/sml and Irs1+/+ control mice as described previously (DeMambro et al. 2008). Briefly, femurs were isolated and snap frozen in liquid nitrogen, and RNA was then isolated using the Total RNA isolation system (Promega) as per the manufacturer's instructions. DNA was then removed from the RNA samples using the DNA-free DNase Treatment & Removal Reagents (Ambion, Inc., Austin, TX, USA). RNA quality and quantity were assessed using an Agilent bioanalyzer (Caliper Technologies Corp., Hopkinton, MA, USA). Four hundred nanograms of RNA were then converted to cDNA in a reverse transcription reaction using the MessageSensor RT Kit (Ambion, Inc.) and random decamers as primers. The cDNA was then diluted 1:5 with water. Quantification of mRNA expression was carried out using an iQ SYBR Green Supermix in a iQ5 thermal cycler and detection system (Bio-Rad). GAPDH was used as an internal standard control gene for all quantifications. Primer sequences used in this study are as follows: RANKL (forward: 5′-TAC TTT CGA GCG CAG ATG GAT-3′ and reverse: 5′-CTG CGT TTT CAT GGA GTC TCA-3′), osteoprotegerin (forward: 5′-TCC GGC GTG GTG CAA G-3′ and reverse: 5′-AGA ACC CAT CTG GAC ATT TTT TG-3′), and GAPDH (forward: 5′-TGA ACG GGA AGC TCA CTG G-3′ and reverse: 5′-TCC ACC ACC CTG TTG CTG TA-3′).

Western blotting

Mouse livers were collected, frozen in liquid nitrogen, and stored at −80 °C until processing. Total cellular protein lysates were prepared in a buffer consisting of 50 mM Tris base (pH 8.2), 150 mM NaCl, 1% Igepal, and complete protease inhibitor cocktail tablets (Roche) for 30 min at 4 °C, followed by centrifugation at 10 000 g for 20 min at 4 °C. For immunoprecipitation, cell lysates were incubated with a rabbit anti-C-terminus IRS-1 antibody (Upstate #06-248, Millapore, Billerica, MA, USA) for 1 h at 4 °C. The immunocomplexes were then collected using an Immunoprecipitation Kit Protein A (#1719394 Roche) as per the manufacturer's instructions. Proteins were resolved on 10% SDS-polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore). Membranes were blocked with 5% non-fat dry milk (Bio-Rad), and were then incubated with the same anti-C-terminus IRS-1 antibody followed by a HRP-conjugated donkey anti-rabbit antibody (Santa Cruz #sc-2317). Signal was detected using an enhanced chemiluminescence kit (Amersham).

The calvarial cells post treatment were washed twice with ice-cold PBS and resuspended in a lysis radioimmunoprecipitation assay buffer supplemented with protease and phosphatase inhibitors (Sigma–Aldrich). Cell lysates were homogenized by rotating at 4 °C for 30 min and were then centrifuged at 10 000 g for 20 min at 4 °C. Protein concentrations were measured in the supernatant using Bradford's reagent (Bio-Rad). Proteins were resolved on 10% SDS-polyacrylamide gels and transferred to PVDF membranes. Membranes were incubated with antibodies for phosphorylated AKT (pAKT; Cell Signaling #9271, Danvers, MA, USA) or total AKT (tAKT; Cell Signaling #9272) followed by HRP-conjugated goat anti-rabbit antibody (Cell Signaling #7074). In a separate set of experiments, calvarial cells post treatment were immunoprecipitated with an IRS-2 (Millipore # 06-506) antibody subjected to SDS-PAGE as described above and were then incubated with a phosphotyrosine-specific antibody (Millipore #05-321).

Assessment of hearing by auditory brainstem response

Groups of female and male Irs1sml/sml and littermate Irs1+/sml mice (n=7–10) between 8 and 12 weeks of age were anesthetized with Avertin (tribromoethanol stabilized in tertiary amyl hydrate) given at a dose of 5 mg tribromoethanol/10 g body weight. Body temperature was maintained at 37–38 °C by placing the mice on an isothermal pad in a sound-attenuating chamber. Sub-dermal needles were used as electrodes, which were inserted at the vertex and ventrolaterally to each ear. Stimulus presentation, auditory brainstem response (ABR) acquisition, equipment control, and data management were coordinated using the computerized Intelligent Hearing Systems (IHS, Miami, FL, USA). A pair of high frequency transducers were coupled with the IHS to generate specific acoustic stimuli. Clicks and 8, 16, and 32 kHz tone bursts were respectively channeled through plastic tubes into the animals' ear canals. The amplified brainstem responses were averaged by a computer and displayed on the computer screen. Auditory thresholds were obtained for each stimulus by reducing the sound pressure level at 10 dB steps and finally at 5 dB steps up and down to identify the lowest level at which an ABR pattern can be recognized (Gagnon et al. 2006).

Sample collection for phenotypic studies

For body composition and bone phenotyping (dual energy X-ray absorptiometry (DEXA), pQCT, and micro-computed tomography (MicroCT)), groups of female and male Irs1sml/sml, littermate Irs1+/sml, and Irs1+/+ control mice (n=10) were necropsied and measured at 4, 8, 12, and 16 weeks of age. All time points showed the same pattern and statistical significance, thus for the simplicity of presentation, only the 16-week data are reported here. For each mouse, whole body weight was recorded, whole body DEXA scans were gathered, and tissue samples were collected. Skeletal preparations were prepared as described previously (Beamer et al. 2007, DeMambro et al. 2008). Serum was harvested from the whole blood collected at necropsy and was stored at −20 °C until assayed for hormones.

PIXImus for areal BMD

Groups of Irs1sml/sml, littermate Irs1+/sml, and Irs1+/+ control female and male mice were measured at 4, 8, 12, and 16 weeks (n=10) for lean muscle mass, fat, and bone mineral using the PIXImus dual-energy X-ray densitometer (GE-Lunar, Madison, WI, USA). The PIXImus was calibrated daily with a mouse phantom provided by the manufacturer. Mice were placed ventral side down with each limb and tail positioned away from the body. Full body scans were obtained, and X-ray absorptiometry data were gathered and processed with the manufacturer's supplied software (Lunar PIXImus 2, version 2.1). The head was specifically excluded from all analyses due to concentrated mineral in skull and teeth.

pQCT for volumetric BMD bone densitometry

Volumetric BMD (vBMD) was measured on the left femur from groups (n=10) of female and male Irs1sml/sml, littermate Irs1+/sml, and Irs1+/+ control mice at 4, 8, 12, and 16 weeks of age. Isolated femur lengths were measured with digital calipers (Stoelting, Wood Dale, IL, USA), and femurs were then measured for density using the SA Plus densitometer (Orthometrics, White Plains, NY, USA). Calibration of the SA Plus instrument was performed daily, and femurs were analyzed as described previously (DeMambro et al. 2008).

MicroCT40

Femurs from female and male Irs1sml/sml, littermate Irs1+/sml, and Irs1+/+ control mice were scanned using MicroCT40 (Scanco Medical AG, Bassersdorf, Switzerland) to evaluate trabecular bone volume fraction and microarchitecture in the metaphyseal region of the distal femur. In addition, cortical thickness data were obtained at the mid-shaft. The MicroCT40 unit was calibrated weekly, and femurs were scanned under conditions described previously (DeMambro et al. 2008).

Bone histomorphometry

To determine whether the in vivo histomorphometry differences seen between the Irs1sml/sml and the Irs1tm1Tka/tm1Tka mice were the result of gender differences, we studied groups of Irs1sml/sml and Irs1+/+ females and males (n=6) at 13 weeks of age. Mice were injected with 20 mg/kg calcein i.p. and with 50 mg/kg demeclocycline 7 days later. Mice were sacrificed 48 h following the demeclocycline injection. Femurs were then analyzed as described previously (DeMambro et al. 2008). A separate experiment in which Irs1sml/sml and Irs1+/sml females were evaluated was then used for comparison with the Irs1+/+ females for the presence of any heterozygous effects. The terminology and units used are those recommended by the Histomorphometry Nomenclature Committee of the American Society for Bone and Mineral Research (Parfitt et al. 1987).

Osteoblast and osteoclast cultures

Bone marrow cells were harvested from femurs and tibias of 8-week-old mice. Osteoclast-like cells were generated by plating bone marrow stromal cells at 10×106/well on six-well plates in α-MEM (Invitrogen) and 10% fetal bovine serum (FBS). Osteoclast-like cells were generated by plating bone marrow stromal cells at 1×106 cells/well in 48-well plates in α-MEM supplemented with 10% FCS and M-CSF (30 ng/ml, PeproTech Inc., Rocky Hill, NJ, USA) and RANKL (50 ng/ml PeproTech). Cultures were maintained, fixed, stained, and analyzed as described previously (DeMambro et al. 2008).

Mouse calvarial osteoblasts were harvested from 3- to 6-day-old pups using standard methods (http://skeletalbiology.uchc.edu/30_ResearchProgram/304_gap/index.htm). The cells were cultured in 10% FBS α-MEM to 90% confluence and were then serum starved in 0.1% FBS for 24 h to reduce cellular activity to quiescent levels. Cells were treated with insulin (100 nM) or IGF1 (100 ng/ml) for 15 min and were then harvested for western blot analysis. Data presented for cell culture experiments correspond to three independent experiments with at least three replicate cultures within each experiment.

Serum IGF1 and insulin

Serum IGF1 levels were measured by RIA (ALPCO, Windham, NH, USA) as reported previously (Rosen et al. 2000, 2004, Delahunty et al. 2006). Serum insulin was measured by RIA (LINCO Research, St Charles, MO, USA) as per the manufacturer's instructions. The sensitivities of the assays were 0.01 ng/ml for IGF1 and 0.1 ng/ml for insulin. The intra-assay coefficient of variation for the assays was 4.5–4.6%. All samples were analyzed within the same assay.

Glucose and insulin tolerance tests

Female and male Irs1sml/sml, Irs1+/sml, and Irs1+/+ mice were tested at 8 and 12 weeks of age for glucose and insulin tolerance. For the glucose tolerance test (GTT), mice were placed in a clean cage with water and fasted overnight (16 h). A 1 g/kg dose of glucose was administered i.p., and blood glucose levels were measured at 0, 20, 40, 60, and 120 min post injection. For the insulin tolerance test (ITT), mice were fed ad libitum and injected i.p. with insulin at a dose of 1 U/kg. Glucose levels were then measured at 0, 20, 40, 60, and 120 min post injection.

Glucose levels were measured using the OneTouch Ultra Glucometer (LifeScan, Inc., Milpitas, CA, USA) as per the manufacturer's instructions (Messier & Kent 1995, Weitgasser et al. 1999). In a separate experiment, we verified the accuracy and precision of the most recently manufactured OneTouch Ultra portable glucometers against Beckman Synchron CX5 Delta Clinical System (Beckman Coulter, Brea, CA, USA) using blood samples from 8- to 12-week-old C57BL6/J mice (n=16). This comparison confirmed that glucose levels reported using portable glucometers correlated highly (r2=0.92) against the glucose levels reported by the Beckman Synchron CX5 Delta Clinical System (data not shown).

Statistical assessment

Statistical tests were performed using JMP version 6.0 software (SAS, Cary, NC, USA) and StatView version 5.0.1 software (SAS). For the DEXA, pQCT, and MicroCT40 data, differences among Irs1sml/sml, Irs1+/sml, and Irs1+/+ mice were taken into account by including body weight and femur length as covariates in an ANCOVA model. Neither covariate was found to contribute to any of the mutant phenotypes. Data are expressed as mean±s.e.m. in all figures. Differences between means were tested by ANOVA, with significance being declared when a P≤0.05 was observed.

Results

History of the Irs1sml mutation

The original Irs1sml mutant was backcrossed to the C3.SW-H2b/SnJ parental strain resulting in no mutants being observed in the F1 progeny. However, the expected Mendelian ratio of 3:1 unaffected:affected for a recessive mutation was observed in the F2 progeny. Gross histological examination found no lesions in any major organs other than decreased size (data not shown). No eye defects were detected. Hearing was assessed by ABR, and both male and female mutant mice exhibited significantly higher thresholds at 8, 16, and 32 kHz than the control littermates, indicative of hearing impairment in these mice (Table 2). Histological examination of the inner ear found no obvious defects.

Table 2

Auditory brainstem response in Irs1+/sml and Irs1sml/sml mice

+/sml Malessml/sml Males+/sml Femalessml/sml Females
n=7n=9n=10n=12
Click34.3±1.751.1±5.9*33.5±0.853.8±5.2*
8 kHz27.9±4.650.0±6.5*23.5±1.155.0±6.2*
16 kHz15.7±4.634.4±7.1*16.0±1.036.7±5.3*
32 kHz40.0±2.761.7±6.1*41.0±1.066.3±5.4*

*P<0.05 +/sml versus sml/sml.

Genetic mapping and mutation analysis of the Irs1sml mutation

The F2 progeny from an intercross with CAST/Ei were used to map the sml mutation to chromosome 1 between D1Mit216 (79.8 Mb) and D1Mit440 (90.7 Mb). Analysis of 204 F2 mice (408 meioses) positioned sml between D1Mit216 (79.8 Mb, 1.23% recombination) and D1Mit440 (90.7 Mb, 2.45% recombination). Irs1 is located at 82.2 Mb, and was considered a prime candidate for this mutation because of the smaller size of a knockout model reported previously (see Introduction).

Genomic DNA from Irs1sml/sml mice and Irs1+/+ controls was analyzed for the Irs1 gene by PCR amplification using overlapping primer pairs (Table 1) and sequence analysis. We discovered a deletion of one adenine nucleotide in exon 1 at position 1559 bp. This deletion results in a frameshift mutation changing a glutamine to an arginine residue, which produces a premature stop codon, predicted to result in a truncated protein of 211 amino acids instead of the full-length 1233-amino acid protein.

To confirm this mutation, we recognized that the deletion of the one adenine nucleotide created a restriction enzyme recognition site, which Taq1 recognizes (T-CGA). Thus, the region of interest was amplified, and Taq1 digestion yielded the control product of 190 bp, with a mutant product of 171 bp, confirming the deletion. Quantification of Irs1 mRNA levels by real-time RT-PCR revealed no differences in expression between the Irs1+/+ and the Irs1sml/sml mice (data not shown). Western blot analysis of proteins from the livers of the Irs1sml/sml and Irs1+/+ control mice using a C-terminus-specific IRS-1 antibody revealed that the Irs1sml/sml mice had no detectable IRS-1 protein (Fig. 1A).

Figure 1
Figure 1

Western blots of IRS-1 (A) and AKT (B). (A) Liver lysates from Irs1sml/sml mice (lanes 1–2) and an Irs1+/+ control (lane 3) were immunoprecipitated with an IRS-1 C-terminus-specific antibody as described in the Materials and Methods. Following SDS-PAGE, the amount of IRS-1 was determined by immunoblotting. The arrow denotes the position of the IRS-1 band which is lacking in Irs1sml/sml lysates. (B) Mouse calvarial osteoblast cultures from Irs1sml/sml, Irs1+/sml, and Irs1+/+ mice were treated with IGF1 (IGF1) and insulin (INS) or were given no treatment (NT), harvested, and lysed as described in the Materials and Methods. Following SDS-PAGE, membranes were immunoblotted for phosphorylated AKT (pAKT) and total AKT (tAKT).

Citation: Journal of Endocrinology 204, 3; 10.1677/JOE-09-0328

Body composition by DEXA

Homozygous male and female Irs1sml/sml mice are phenotypically recognizable at ∼2 weeks of age by their smaller size and thin short tails, a condition that persists throughout their lives despite normal GH levels. After weaning, mutants are ∼60% the size of their Irs1+/sml control littermates, including a 20% reduction in tail length (Table 3). Whole body DEXA analysis at 16 weeks of age revealed that Irs1sml/sml male and female mice had reduced percent fat and aBMD compared with the Irs1+/+ controls. Irs1+/sml heterozygous mice had lower body weight, aBMD, and percent fat than the Irs1+/+ mice, but these parameters were greater than those of the Irs1sml/sml mutants (Table 3).

Table 3

Body composition and bone phenotype of Irs1+/+, Irs1+/sml, and Irs1sml/sml mice by DEXA, pQCT, and micro-computed tomography at 16 weeks of age

+/+ Males+/sml Malessml/sml Males+/+ Females+/sml Femalessml/sml Females
Body weight37.9±1.032.3±0.9*16.5±0.7†,‡35.6±1.131.9±1.2*15.4±0.4†,‡
F. length (mm)15.58±0.0715.08±0.11*12.55±0.04†,‡15.47±0.0914.99±0.11*12.83±0.06†,‡
Percent fat32.8±0.828.5±1.2*20.6±1.9†,‡39.9±1.435.3±1.3*16.8±1.4†,‡
aBMD (g/cm2)0.057±0.0010.05±0.001*0.039±0.001†,‡0.058±0.0010.049±0.001*0.038±0.001†,‡
vBMD (mm/cm3)0.83±0.010.73±0.01*0.65±0.01†,‡0.86±0.010.76±0.01*0.66±0.01†,‡
Peri. circ. (mm)4.79±0.034.62±0.04*3.73±0.02†,‡4.70±0.024.28±0.03*3.61±0.03†,‡
BA/TA (%)79.0±0.775.2±1.1*71.3±0.8†,‡81.3±0.479.2±0.6*73.9±0.4†,‡
CortTh (mm)37.14±0.6633.26±0.75*25.14±0.44†,‡38.32±0.4334.14±0.47*25.3±0.20†,‡
BV/TV (%)22.0±1.421.0±0.815.4±0.9†,‡28.3±1.226.2±0.67.5±0.7†,‡
TbN (/mm)4.4±0.14.8±0.15.3±0.2†,‡4.2±0.14.1±0.12.8±0.2†,‡
TbTh (mm)73.9±2.766.3±1.3*49.3±0.7†,‡89.6±1.185.5±1.7*51.8±0.8†,‡

n=10, *P<0.05 ++ versus +/sml, P<0.0001 +/+ versus sml/sml, P<0.0001 +/sml versus sml/sml. F. length, femur length; Peri. circ., periosteal circumference; BA/TA, bone area/total area; CortTh, cortical thickness; BV/TV, bone volume/total volume; TbN, trabecular number; TbTh, trabecular thickness.

Skeletal microstructure by pQCT and MicroCT

Analysis of femurs isolated from 16-week-old Irs1+/+, Irs1+/sml, and Irs1sml/sml mice revealed that Irs1sml/sml male and female mice had significant reductions in femur length, with an overall reduction in vBMD as measured by pQCT when compared with the Irs1+/+ control mice. Irs1sml/sml femurs also exhibited a reduction in cortical thickness as well as in periosteal circumference (Table 3). MicroCT analysis confirmed the reduction in cortical thickness with a smaller cortical bone area/total area (percent BA/TA). The distal femoral trabecular bone exhibited a significant reduction in bone volume/total volume (percent BV/TV) in both the female and male Irs1sml/sml mice compared with the controls (Table 3). For the female mutants, this 73% reduction in BV/TV was accompanied by a 33% decrease in trabecular number and a 42% reduction in trabecular thickness. However, the male mutants' distal femoral percent BV/TV was only reduced by 29% when compared with the controls. This gender difference was attributed to a 20% increase in trabecular number in the Irs1sml/sml male femurs. Although, increased in number, these trabeculae were 34% thinner than those of the controls (Table 3).

Comparison of the Irs1+/sml female and male bones with those of the Irs1+/+ and Irs1sml/sml mice revealed a significant intermediate phenotype for femur length, vBMD, and periosteal circumference (Table 3). Likewise, a significant intermediate phenotype was found at the mid-shaft for cortical thickness and percent BA/TA as measured by MicroCT. Interestingly, the heterozygous genotype did not affect percent BV/TV or trabecular number in the distal femur compartment, although a slight but significant reduction in trabecular thickness was observed when compared with the Irs1+/+ controls (Table 3).

Histomorphometry

Histomorphometry from the distal femur of male and female Irs1+/+ and Irs1sml/sml mice at 13 weeks of age showed a marked and significant decrease in the percent BV/TV analogous to what was observed by MicroCT. For both genders, the Irs1sml/sml mice had markedly reduced mineralizing surface/bone surface (percent MS/BS), mineral apposition rate (MAR), and bone formation rate (BFR). Furthermore, the numbers of osteoblasts and osteoclasts per bone perimeter (Nob/BPm and Noc/BPm) were increased in both genders of Irs1sml/sml mice compared with the Irs1+/+ controls. However, this increase was only significant for Irs1sml/sml females (Table 4). Remarkably, there was no evidence of marrow adiposity in the histological sections of the Irs1sml/sml femurs compared with the Irs1+/+ femurs (Supplementary Figure 1, see section on supplementary data given at the end of this article). Inspection of the growth plate in the proximal femur revealed a marked reduction in thickness in the Irs1sml/sml mice compared with the Irs1+/+ mice, which was consistent with their reduced bone length (Fig. 2). The Irs1+/sml growth plate was also mildly reduced compared with the Irs1+/+ mice.

Table 4

Histomorphometry of Irs1+/+ and Irs1sml/sml distal femurs at 13 weeks of age

+/+ Malessml/sml Males+/+ Femalessml/sml Females
Percent BV/TV12.09±0.637.80±0.08*13.47±1.636.94±1.24*
Nob/BPm (/mm)28.00±1.2329.82±2.1227.28±1.5231.83±1.05*
Noc/BPm (/mm)3.70±0.374.32±0.773.90±0.355.75±0.38*
ES/BS (%)12.5±1.2913.58±1.6912.87±1.2217.06±0.67*
MS/BS (%)6.89±0.512.41±0.38*7.14±0.844.10±0.32*
MAR (μm/day)0.441±0.0260.290±0.024*0.640±0.0270.439±0.047*
BFR/BS (μm3/μm2 per day)0.031±0.0030.007±0.001*0.046±0.0060.017±0.003*

n=6, *P≤0.05. Percent BV/TV, bone volume/total volume; Tb. Th, trabecular thickness; Nob/BPm, number of osteoblasts/bone perimeter; Noc/BPm, number of osteoclasts/bone perimeter; ES/BS, eroded surface/bone surface; MS/BS, mineral surface/bone surface; MAR, mineral apposition rate; BFR/BS, bone formation rate/bone surface.

Figure 2
Figure 2

Toluidine blue staining of the proximal femur growth plate at 10× magnification of 13-week-old Irs1+/+, Irs1+/sml, and Irs1sml/sml mice.

Citation: Journal of Endocrinology 204, 3; 10.1677/JOE-09-0328

Bone volume fraction by histomorphometry in the Irs1+/sml female mice at 13 weeks of age was not different from percent BV/TV in the Irs1+/+ mice, akin to the findings by MicroCT. However, osteoclast numbers per bone perimeter were significantly increased (P<0.05) in the Irs1+/sml heterozygote mice compared with the Irs1+/+ females, and there was a significant (P<0.05) reduction in MAR, although no statistical differences were noted in the overall BFRs nor eroded surfaces/bone surface (see Supplementary Table S1, see section on supplementary data given at the end of this article).

Cell culture

Alkaline phosphatase (ALP) staining of bone marrow stromal cell cultures of both male and female Irs1sml/sml mice on day 7 in culture revealed reductions in the number of CFU-ALP+ pre-OBs compared with the Irs1+/+ cultures. Similarly, on days 18 and 24, the amount of ALP staining and mineral visually detected by von Kossa staining were less in the Irs1sml/sml mice than in the Irs1+/sml heterozygotes, and both were less than those detected in the Irs1+/+ control cultures (Fig. 3). When non-adherent marrow cells were cultured in m-CSF and RANKL, no differences in tartrate-resistant acid phosphatase-positive multinucleated cells were seen among mutant, heterozygote, or control mice (Fig. 3).

Figure 3
Figure 3

Bone marrow stromal cultures (BMSCs) of Irs1sml/sml, Irs1+/sml, and Irs1+/+ control females. (A) On day 18, adherent OB progenitor cells were identified by alkaline phosphatase staining (CFU-ALP) and mineralization was identified by von Kossa staining. (B) Numbers of osteoclast cells in the bone marrow stromal cultures of Irs1sml/sml, Irs1+/sml, and Irs1+/+ mice. On day 7, the cells were fixed and stained for TRAP5b. TRAP5b-positive multinucleated (>3 nuclei) osteoclasts were then counted using light microscopy. In all the experiments, male BMSCs exhibited a pattern that was similar to that exhibited by the females. Full colour version of this figure available via http://dx.doi.org/10.1677/JOE-09-0328.

Citation: Journal of Endocrinology 204, 3; 10.1677/JOE-09-0328

To determine if the increased osteoclast number in the Irs1sml/sml mice as noted by histomorphometry was related to the secretion of osteoclastogenic cytokines, we measured RANKL and OPG (listed as TNFRSF11B in the MGI Database) expression in calvarial osteoblasts and in 8-week-old femoral samples from the Irs1sml/sml and Irs1+/+ controls. There were no statistical differences in RANKL expression by real-time PCR between mutants and controls from either site. Similarly for OPG, no strain differences were noted in calvarial osteoblast expression of Opg (Tnfrs11b) mRNA, although in the femoral samples from the Irs1sml/sml mice, there was a modest but non-significant (∼10%) reduction in OPG expression by real-time PCR compared with the controls.

Western blot analysis of the protein isolated from calvarial osteoblast cultures revealed that at baseline, both the Irs1+/sml and Irs1sml/sml cultures had significantly less pAKT compared with the Irs1+/+ control cultures (Fig. 1B). Upon stimulation with IGF1 or insulin, tAKT protein was the same across the genotypes, but the Irs1+/+ cultures showed higher levels of AKT phosphorylation than the Irs1sml/sml and the Irs1+/sml cells. Finally, we examined the amount of IRS2 in calvarial osteoblasts from Irs1+/+, Irs1+/sml, and Irs1sml/sml mice. Although total protein was the same for all the three genotypes, both Irs1sml/sml and Irs1+/sml calvarial osteoblasts showed enhanced phosphorylation of IRS-2 in response to IGF1 but not to insulin (Fig. 4) compared with the Irs1+/+ osteoblasts.

Figure 4
Figure 4

Mouse calvarial osteoblast cultures from Irs1sml/sml, Irs1+/sml, and Irs1+/+ mice were treated with IGF1 (IGF1) and insulin (INS) or were given no treatment (NT), harvested, and lysed as described in the Materials and Methods. Lysates were immunoprecipitated with an IRS-2 antibody and were then immunoblotted with IRS-2 for total protein levels or p-Tyr for phosphorylation of IRS-2.

Citation: Journal of Endocrinology 204, 3; 10.1677/JOE-09-0328

Serum analysis

Circulating levels of insulin and IGF1 were analyzed under fasting conditions. Irs1sml/sml mice were found to be relatively hyperinsulinemic, with 3.5- to 4-fold higher insulin levels compared with the Irs1+/+ controls. Notably, heterozygous Irs1+/sml mice of both genders exhibit an intermediate phenotype marked by significantly higher serum levels of insulin compared with the Irs1+/+ controls, but lower insulin levels compared with the Irs1sml/sml mice (Fig. 5A). Serum IGF1 levels were modestly, but significantly reduced in the Irs1sml/sml mice relative to the controls. In addition, a gender effect was observed in the serum IGF1 levels such that the heterozygous Irs1+/sml and Irs1sml/sml serum IGF1 levels were significantly lower in the females than in the males of the same genotype (P<0.0005). Unexpectedly, there was no intermediate phenotype for the Irs1+/sml males. However, in the female Irs1+/sml mice, we observed the same intermediate phenotype for serum IGF1 seen in the previous phenotypic datasets (Fig. 5B).

Figure 5
Figure 5

Fasted serum insulin and IGF1 levels and the glucose/insulin tolerance tests of Irs1sml/sml, Irs1+/sml, and Irs1+/+ fasted mice during the glucose and insulin tolerance tests. At 16 weeks of age, males and females were tested for (A) insulin and (B) IGF1 serum levels (n=10 per genotype *P≤0.05 Irs1+/sml versus Irs1+/+, **P≤0.05 Irs1sml/sml versus Irs1+/+, and ***P≤0.05 Irs1sml/sml versus Irs1+/sml). Male Irs1+/+, Irs1+/sml, and Irs1sml/sml mice at 8 weeks of age were fasted overnight and then subjected to a (C) GTT or fed ad libitum and then subjected to a (D) ITT as described in the Materials and Methods. Females were tested at the same time and they showed a similar pattern of significance (n=10 per genotype *P≤0.05).

Citation: Journal of Endocrinology 204, 3; 10.1677/JOE-09-0328

GTT and ITT

To investigate whether the mild hyperinsulinemia in Irs1sml/sml mice was indicative of a pre-diabetic state, GTTs were performed on fasted Irs1+/+, Irs1+/sml, and Irs1sml/sml males and females at 8 weeks of age (Fig. 5C and D). At baseline, Irs1sml/sml mice exhibited significantly lower (30–40%) fasting glucose levels compared with the controls (Fig. 5C). When challenged with glucose, Irs1sml/sml glucose values rose as expected, but remained significantly lower than either Irs1+/+ or Irs1+/sml levels throughout the study. Although baseline glucose levels differed, glucose levels peaked 20 min post injection in Irs1sml/sml mice, as in both Irs1+/+ or Irs1+/sml mice, and the rate of glucose metabolism was similar among all the three genotypes of mice.

For the ITT under non-fasting conditions, the Irs1sml/sml glucose levels decreased, but not to the full extent as seen in either Irs1+/+ or Irs1+/sml mice. The glucose-lowering effect of insulin, as assessed by an ITT (Fig. 5D), revealed a mild insulin insensitivity, which was depicted as a slight, but significant, upward shift in the curve for Irs1sml/sml mice, relative to either Irs1+/+ or Irs1+/sml mice (at 20-, 40-, and 60-min intervals). By 2 h post injection of insulin, Irs1sml/sml glucose levels were comparable to those of the Irs1+/+ and Irs1+/sml mice.

Discussion

In this study, we have characterized for the first time a spontaneous mutation in the Irs1 gene that results in a pronounced metabolic and skeletal phenotype. The Irs1sml mutation is a spontaneous frameshift mutation that results from a single nucleotide deletion in the Irs1 gene leading to a premature stop codon and a truncated protein. This results in a hyperinsulinemic, lean, small mouse with reductions in serum IGF1 levels, BMD, and hearing. Mutant mice, although hyperinsulinemic, were only mildly insulin resistant as exogenous insulin treatment was effective in reducing circulating glucose levels. This partial ability of Irs1sml/sml mice to respond to exogenous insulin most likely prevents the development of overt hyperglycemia or diabetes.

The skeletal phenotype of the Irs1sml/sml mice is remarkable and differs from that of the genetically engineered Irs1 null mice. Irs1sml/sml bones exhibited reductions in femur length, cortical and trabecular thicknesses, and trabecular number. In addition, Irs1sml/sml mice had a pronounced reduction in MAR and BFRs. But unexpectedly, these mutants had more osteoclasts and more osteoblasts per bone perimeter than the controls. To understand the mechanism for this surprising finding, we performed in vitro studies which demonstrated that Irs1sml/sml osteoblasts had impaired cell proliferation and differentiation, but no differences were found in osteoclast recruitment, differentiation, or appearance. Histological sections demonstrated that there was adequate recruitment of osteoblast precursors; hence the defect in bone formation was likely a result of poor osteoblast function due to reduced IRS-1 signaling. Taken together, we postulate that the markedly reduced bone volume fraction in the Irs1sml/sml mice is due to the inability of osteoblasts to form new bone coupled to an increase in osteoclastic activity, as evident by the larger eroded surfaces and the greater number of osteoclasts in the Irs1sml/sml mice. The absence of an in vitro effect on osteoclast differentiation from this mutation (see Fig. 3B) suggests that the osteoclastic changes are due to a non-cell autonomous process. In preliminary studies using real-time PCR on femoral and calvarial samples, we were unable to detect differences in gene expression for RANKL, but we did find slightly lower Opg mRNA in the Irs1sml/sml bones versus Irs1+/+ controls. Whether the enhanced osteoblast recruitment is a compensatory response to a major defect in differentiative osteoblast function or another process remains to be determined. But, interestingly, Zhang et al. (2002) reported that mice with a conditional Igf1r deletion in osteoblasts exhibited defective mineralization, and had markedly increased osteoblast numbers. This would imply there must be feedback signals that operate during terminal differentiation that attempt to compensate for impaired skeletal function.

Similarities and differences exist between this spontaneous mutation and two genetically engineered mice, Irs1tm1Tka and Irs1tm1Jos with knockout alleles. For example, much like the Irs1sml mutation, the Irs1tm1Tka and Irs1tm1Jos null mutations result in small, lean, hyperinsulinemic mice, while the Irs1tm1Tka mice have reduced aBMD. Differences in phenotypes between the spontaneous Irs1sml/sml and the engineered Irs1tm1Tka/tm1Tka and Irs1tm1Jos/tm1Jos null mice include the lack of gender and heterozygous effects, as well as the degree of insulin resistance. Comparison of the spontaneous mutant to the Irs1tm1Tka allele also revealed differences in osteoblast and osteoclast numbers in vivo versus +/+ controls (Araki et al. 1994, Tamemoto et al. 1994, Ogata et al. 2000).

Phenotypic differences between the Irs1tm1Tka/tm1Tka, Irs1tm1Jos/tm1Jos, and the Irs1sml/sml mice may be the result of the different background strains. Reports have alluded to the importance of genetic background-contributing alleles that alter bone and growth phenotypes in mutants (Gonzalez et al. 1992, Bouxsein et al. 2002, Martelli et al. 2005). The genetically engineered Irs1 null models are reported to be on a hybrid B6/CBA background strain, whereas the Irs1sml spontaneous mutation is on an inbred C3.SWR-H2b/SnJ congenic strain, which contains C3H alleles at all genetic regions except for a small fixed region on chromosome 17 carrying the H2 allele. Thus, this background is more uniform compared with the segregating B6/CBA hybrid background. Modifier alleles within either background may account for the phenotypic variations observed between nulls and the spontaneous mutation.

Gender effects were not mentioned in the initial studies of the Irs1tm1Tka/tm1Tka and the Irs1tm1Jos/tm1Jos mice. Further characterization of the Irs1tm1Tka/tm1Tka mice reported no apparent differences by gender in serum IGF1 levels or in skeletal phenotyping (Ogata et al. 2000). However, phenotypic characterization of the Irs1sml mutation revealed gender differences for circulating IGF1, microarchitectural characteristics of bone, and osteoblast and osteoclast numbers by histomorphometry. In fact, Irs1tm1Tka/tm1Tka males are reported to have decreased numbers of both osteoblasts and osteoclasts (Hoshi et al. 2004, Yamaguchi et al. 2005), while the Irs1sml/sml male mice had normal numbers of both, and Irs1sml/sml female mice actually had more osteoblasts and osteoclasts. The gender effects are likely to be complex, but they may be a consequence of interactions involving estrogen, IGF1 signaling, and bone turnover.

Ogata et al. (2000) reported no phenotypic differences between the heterozygous and +/+ controls in the Irs1tm1Tka/tm1Tka nulls. The Irs1+/sml mice on the other hand exhibited a heterozygous phenotype for body weight, serum insulin, IGF1, femur length, aBMD and vBMD, and body fat. Moreover, the Irs1+/sml calvarial osteoblasts had some impairment in the phosphorylation of AKT that could explain the phenotypic changes. Furthermore, closer examination of bone microstructure revealed a heterozygous phenotype for the cortical compartment, such that the Irs1+/sml mice exhibited an intermediate phenotype for cortical thickness and periosteal circumference, but not for the trabecular compartment for bone volume fraction (See Table 2). On dynamic histomorphometry, the Irs1+/sml mice also had increased numbers of osteoclasts and reduced MAR compared with the controls (see Supplementary Table S1), suggesting that the heterozygote mice truly exhibit an intermediate phenotype for several components of skeletal turnover. It is interesting to speculate as to why the cortical component but not the trabecular component of the skeleton is affected by gene dosing. One possibility is that the increase in resorption in the heterozygotes is not as dramatic as that in the mutants, and this combined with minimal alterations in BFRs results in barely detectable changes in the trabecular bone volume fraction of Irs1+/sml mice. In contrast, despite body composition change in the Irs1+/sml mice, there was no intermediate metabolic phenotype when the mice were challenged with glucose or insulin. Although no heterozygous phenotype was reported for the bones of Irs1tm1Tka/tm1Tka mice, a study done by Pete et al. (1999) did report small but significant reductions in body and organ weight in heterozygous Irs1+/tm1Jos mice. Once again, it is likely that these strain differences could be related to the background of the mice and/or any compensatory effect of IRS-2 (see Fig. 4) that might result from the loss of a single allele in the Irs1 gene.

Numerous studies have provided evidence of hyperinsulinemia, impaired glucose tolerance, and insulin resistance in Irs1 null mice (Araki et al. 1994, Tamemoto et al. 1994, Yamauchi et al. 1996, Kido et al. 2000). Initial studies on both Irs1tm1Tka/tm1Tka and Irs1tm1Jos/tm1Jos mice reported normal physiological glucose levels after fasting conditions. However, upon glucose challenge, Irs1tm1Jos/tm1Jos mice were reported to be somewhat glucose intolerant as their circulating glucose levels significantly increased compared with the +/+ controls, whereas the Irs1tm1Tka/tm1Tka mice were reported to have no differences compared with the +/+ controls. When Irs1tm1Jos/tm1Jos and Irs1tm1Tka/tm1Tka mice were challenged with insulin, significantly increased levels of glucose were observed again in both the groups compared with the controls, indicating insulin resistance. The Irs1sml/sml mice, on the other hand, exhibited a compensatory hyperinsulinemia due to the lack of IRS1, but retained some insulin sensitivity, as shown by their nearly intact response to the glucose-lowering effects of exogenous insulin. Furthermore, the Irs1sml/sml mice exhibited one-third lower glucose levels after fasting and throughout the GTT. This attenuated glucose response can be explained by the moderate hyperinsulinemia found in Irs1sml/sml mice.

Initial characterizations of the Irs1tm1Tka/tm1Tka mice reported no significant differences in serum IGF1 levels (Tamemoto et al. 1994). However, Pete et al. (1999) reported a decrease in IGF1 levels in Irs1tm1Jos/tm1Jos mice compared with the controls, but the change did not reach significance, most likely due to low sampling numbers. In the spontaneous Irs1sml/sml mice, there was a consistent 20% decrease in IGF1 levels compared with the Irs1+/+ control mice. Dong et al. (2006) also reported a 20% decrease in IGF1 levels in the Irs1tm1Jos/tm1Jos mouse compared with the controls. The 20% reduction in the IGF1 serum levels in the Irs1sml/sml mice is an unexpected observation. A defect in signaling should result in increased IGF1 levels rather than in a decrease, presumably as a compensatory mechanism. It is probable that the overexpression of IGF1 could partially compensate for the lack of IRS1 in postnatal growth (Pete et al. 1999). However, we postulate the emergence of a negative feedback loop in the absence of IRS1 that leads to reduced IGF1 synthesis. How that inhibition occurs (perhaps locally by alterations in GH signaling) is a subject of further investigations.

We assume that the Irs1sml mutation results in complete loss of function, but cannot rule out the possibility of a hypomorphic mutation. Indeed, it is possible that a 211-amino acid truncated peptide is produced and may bind to the IGF1 receptor by its phosphotyrosine-binding (PTB) domain. If so, all the sites of binding and phosphorylation downstream of the PTB domain are missing resulting in defective signaling as evidenced by the lack of AKT phosphorylation in mouse calvarial osteoblast cells when stimulated with IGF1 or insulin. This deleted region includes serine residues, which when phosphorylated, trigger protein degradation. Thus, it is possible that the truncated peptide may attach to the IGF1 receptor and perturb the system, resulting in the phenotypic differences observed between our spontaneous mutant and the engineered mutants of the Irs1 gene. Repeated attempts to use the only commercially available N-terminus-specific antibody were unsuccessful. However, since the PTB domain of the IRS1 protein comprises residues 144–316, our predicted protein would contain <50% of the PTB domain, and thus binding to the receptor is unlikely.

Reduced circulating IGF1 and mutations in the Igf1 gene have been directly linked to hearing loss in both mice and humans (Woods et al. 1996, Camarero et al. 2001, Barrenäs et al. 2003, Bonapace et al. 2003, Cediel et al. 2006). Mice lacking the Igf1 gene have been shown to lose many auditory neurons and exhibit increased auditory thresholds indicative of hearing impairment (Camarero et al. 2001, Cediel et al. 2006). It has also been shown that IGF1 is critical in the development of the cochleovestibular ganglion in the inner ear (Varela-Nieto et al. 2004). Furthermore, lack of IGF1, or mutations in the IGF1 gene, has been associated with sensorineural hearing loss in humans (Woods et al. 1996, Bonapace et al. 2003). Thus, the fact that Irs1sml mice exhibit hearing loss further supports the existence of a major defect in the IGF1 signaling pathway.

Recently, a SNP located adjacent to the Irs1 gene has been associated with type 2 diabetes, insulin resistance, and hyperinsulinemia in a human cohort of more than 14 000 individuals. The investigators reported a 40% reduction in the basal levels and function of IRS1 protein in the skeletal muscle of patients carrying this variant (Rung et al. 2009). Likewise, there are numerous studies on humans demonstrating polymorphisms in the Irs1 gene associated with variable responsiveness to insulin signaling (Imai et al. 1994, Ura et al. 1996, Le Fur et al. 2002). The most common polymorphism, the G972R variant, has also been associated with type II diabetes mellitus (Almind et al. 1993, Sesti 2000, Tok et al. 2006). However, there are no data examining the relationship between these polymorphisms and BMD or fracture risk. Based on our work combined with previous studies performed on the Irs1 knockout models, we predict that patients with IRS1 polymorphisms could have a subclinical but important skeletal phenotype.

There are several limitations of our studies. First, the mechanism responsible for the low serum IGF1 levels in the Irs1sml/sml mice is not readily apparent from our data. Secondly, the degree of compensation between IRS1 and IRS2 in the mutant and heterozygote models requires further study. Thirdly, the hyperinsulinemia along with the mild insulin resistance phenotype is intriguing and raises new questions about the importance of IRS1 in glucose homeostasis. Fourthly, the heterozygous phenotype is particularly provocative as it lends credence to the theory that similar mutations in the Irs1 gene may exist in humans. These are likely to be characterized by relatively modest reductions of IGF1, low fat mass, hyperinsulinemia, reduced BMD, and short stature. However, this theory will need to be verified in large population studies. Finally, the increase in osteoclastogenesis in both the mutant and heterozygote mice requires further study to determine if the relatively modest reduction in Opg mRNA in the pre-osteoblasts of these mice is partly responsible for the skeletal phenotype. Notwithstanding, this paper reports the first spontaneous ‘loss of function’ mutation in the Irs1 gene. The unique phenotypic presentation of this mutant raises new questions about the role of IRS1 in both skeletal acquisition and glucose homeostasis.

Supplementary data

This is linked to the online version of the paper at http://dx.doi.org/10.1677/JOE-09-0328.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by the National Institute of Heath (grants: RR01183, ARMYLRD, DK042424, DK073267, AR46544, and AR043618).

Acknowledgements

The authors would like to thank Lindsay G Horton, Colleen Kane, Belinda Harris, Leona Gagnon, Krista Delahunty, Lisa Carney, Pat Ward-Bailey, and Cheryl Ackert-Bicknell for assistance with this research.

References

  • Almind K, Bjørbaek C, Vestergaard H, Hansen T, Echwald S & Pedersen O 1993 Aminoacid polymorphisms of insulin receptor substrate-1 in non-insulin-dependent diabetes mellitus. Lancet 342 828832.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Araki E, Lipes MA, Patti ME, Brüning JC, Haag B, Johnson RS & Kahn CR 1994 Alternative pathway of insulin signalling in mice with targeted disruption of the IRS-1 gene. Nature 10 186190.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Atti E, Boskey AL & Canalis E 2005 Overexpression of IGF-binding protein 5 alters mineral and matrix properties in mouse femora: an infrared imaging study. Calcified Tissue International 76 187193.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Barrenäs ML, Bratthall A & Dahlgren J 2003 The thrifty phenotype hypothesis and hearing problems. BMJ 327 11992000.

  • Baumann G 1999 Mutations in the growth hormone releasing hormone receptor: a new form of dwarfism in humans. Growth Hormone and IGF Research 9 2429.

  • Beamer WG, Shultz KL, Ackert-Bicknell CL, Horton LG, Delahunty KM, Coombs HF III, Donahue LR, Canalis E & Rosen CJ 2007 Genetic dissection of mouse distal chromosome 1 reveals three linked BMD QTLs with sex-dependent regulation of bone phenotypes. Journal of Bone and Mineral Research 22 11871196.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ben Lagha N, Seurin D, Le Bouc Y, Binoux M, Berdal A, Menuelle P & Babajko S 2006 Insulin-like growth factor binding protein (IGFBP-1) involvement in intrauterine growth retardation: study on IGFBP-1 overexpressing transgenic mice. Endocrinology 147 47304737.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bikle D, Majumdar S, Laib A, Powell-Braxton L, Rosen C, Beamer W, Nauman E, Leary C & Halloran B 2001 The skeletal structure of insulin-like growth factor I-deficient mice. Journal of Bone and Mineral Research 16 23202329.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bonapace G, Concolino D, Formicola S & Strisciuglio P 2003 A novel mutation in a patient with insulin-like growth factor 1 (IGF1) deficiency. Journal of Medical Genetics 40 913917.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bouxsein ML, Rosen CJ, Turner CH, Ackert LC, Shultz KL, Donahue LR, Churchill GA, Adamo ML, Powell DR & Turner RT et al. 2002 Generation of a new congenic mouse strain to test the relationships among serum insulin-like growth factor I, bone mineral density, and skeletal morphology in vivo. Journal of Bone and Mineral Research 17 570579.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Camarero G, Avendano C, Fernandez-Moreno C, Villar A, Contreras J, de Pablo F, Pichel JG & Varela-Nieto I 2001 Delayed inner ear maturation and neuronal loss in postnatal Igf-1 deficient mice. Journal of Neuroscience 21 76307641.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cediel R, Riquelme R, Contreras J, Díaz A & Varela-Nieto I 2006 Sensorineural hearing loss in insulin-like growth factor I-null mice: a new model of human deafness. European Journal of Neuroscience 23 587590.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Cornish J, Callon KE & Reid IR 1996 Insulin increases histomorphometric indices of bone formation in vivo. Calcified Tissue International 59 492495.

  • Delahunty KM, Shultz KL, Gronowicz GA, Koczon-Jaremko B, Adamo ML, Horton LG, Lorenzo J, Donahue LR, Ackert-Bicknell CL & Kream BE et al. 2006 Congenic mice provide in vivo evidence for a genetic locus that modulates serum insulin-like growth factor-1 and bone acquisition. Endocrinology 147 39153923.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • DeMambro VE, Clemmons DR, Horton LG, Bouxsein ML, Wood TL, Beamer WG, Canalis E & Rosen CJ 2008 Gender-specific changes in bone turnover and skeletal architecture in igfbp-2-null mice. Endocrinology 149 20512061.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Donahue LR & Beamer WG 1993 Growth hormone deficiency in ‘little’ mice results in aberrant body composition, reduced insulin-like growth factor-I and insulin-like growth factor-binding protein-3 (IGFBP-3), but does not affect IGFBP-2, -1 or -4. Journal of Endocrinology 136 91104.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Dong X, Park S, Lin X, Copps K, Yi X & White MF 2006 Irs1 and Irs2 signaling is essential for hepatic glucose homeostasis and systemic growth. Journal of Clinical Investigation 116 101114.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gagnon LH, Longo-Guess CM, Berryman M, Shin JB, Saylor KW, Yu H, Gillespie PG & Johnson KR 2006 The chloride intracellular channel protein CLIC5 is expressed at high levels in hair cell stereocilia and is essential for normal inner ear function. Journal of Neuroscience 26 1018810198.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Garnero P, Sornay-Rendu E & Delmas PD 2000 Low serum IGF-1 and occurrence of osteoporotic fractures in postmenopausal women. Lancet 355 898899.

  • Giustina A, Mazziotti G & Canalis E 2008 Growth hormone, insulin-like growth factors, and the skeleton. Endocrine Reviews 29 535559.

  • Godfrey P, Rahal JO, Beamer WG, Copeland NG, Jenkins NA & Mayo KE 1993 GHRH receptor of little mice contains a missense mutation in the extracellular domain that disrupts receptor function. Nature Genetics 4 227232.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Gonzalez CD, Meyer RAJ & Iorio RJ 1992 Craniometric measurements of craniofacial malformations in the X-linked hypophosphatemic (Hyp) mouse on two different genetic backgrounds: C57BL/6J and B6C3H. Teratology 46 605613.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • He J, Rosen CJ, Adams DJ & Kream BE 2006 Postnatal growth and bone mass in mice with IGF-I haploinsufficiency. Bone 38 826835.

  • Hoshi K, Ogata N, Shimoaka T, Terauchi Y, Kadowaki T, Kenmotsu S, Chung UI, Ozawa H, Nakamura K & Kawaguchi H 2004 Deficiency of insulin receptor substrate-1 impairs skeletal growth through early closure of epiphyseal cartilage. Journal of Bone and Mineral Research 19 214223.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Imai Y, Fusco A, Suzuki Y, Lesniak MA, D'Alfonso R, Sesti G, Bertoli A, Lauro R, Accili D & Taylor SI 1994 Variant sequences of insulin receptor substrate-1 in patients with noninsulin-dependent diabetes mellitus. Journal of Clinical Endocrinology and Metabolism 79 16551658.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Janghorbani M, Feskanich D, Willett WC & Hu F 2006 Prospective study of diabetes and risk of hip fracture: the Nurses' Health Study. Diabetes Care 29 15731578.

  • Janghorbani M, Van Dam RM, Willett WC & Hu FB 2007 Systematic review of type 1 and type 2 diabetes mellitus and risk of fracture. American Journal of Epidemiology 166 495505.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kido Y, Burks DJ, Withers D, Bruning JC, Kahn CR, White MF & Accili D 2000 Tissue-specific insulin resistance in mice with mutations in the insulin receptor, IRS-1, and IRS-2. Journal of Clinical Investigation 105 199205.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Le Fur S, Le Stunff C & Bougnères P 2002 Increased insulin resistance in obese children who have both 972 IRS-1 and 1057 IRS-2 polymorphisms. Diabetes 51 S304S307.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lienhard GE 1994 Insulin. Life without the IRS. Nature 372 128129.

  • Liu JP, Baker J, Perkins AS, Robertson EJ & Efstratiadis A 1993 Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 75 5972.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Maheshwari HG, Silverman BL, Dupuis J & Baumann G 1998 Phenotype and genetic analysis of a syndrome caused by an inactivating mutation in the growth hormone-releasing hormone receptor: dwarfism of Sindh. Journal of Clinical Endocrinology and Metabolism 88 40654074.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Manly KF, Cudmore RHJ & Meer JM 2001 Map Manager QTX, cross-platform software for genetic mapping. Mammalian Genome 12 930932.

  • Martelli F, Ghinassi B, Panetta B, Alfani E, Gatta V, Pancrazzi A, Bogani C, Vannucchi AM, Paoletti F & Migliaccio G et al. 2005 Variegation of the phenotype induced by the Gata1low mutation in mice of different genetic backgrounds. Blood 106 41024113.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Messier C & Kent P 1995 Repeated blood glucose measures using a novel portable glucose meter. Physiology & Behavior 57 807811.

  • Mukherjee A, Murray RD & Shalet SM 2004 Impact of growth hormone status on body composition and the skeleton. Hormone Research 62 3541.

  • Niu T & Rosen CJ 2005 The insulin-like growth factor-I gene and osteoporosis: a critical appraisal. Gene 361 3856.

  • Ogata N, Chikazu D, Kubota N, Terauchi Y, Tobe K, Azuma Y, Ohta T, Kadowaki T, Nakamura K & Kawaguchi H 2000 Insulin receptor substrate-1 in osteoblast is indispensable for maintaing bone turnover. Journal of Clinical Investigation 105 935943.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Parfitt AM, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM & Reckner RR 1987 Bone histomorphometry: standardization of nomenclature, symbols and units. Report of the ASBMR nomenclature committee. Journal of Bone and Mineral Research 2 595610.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Pete G, Fuller CR, Oldham JM, Smith DR, D'Ercole AJ, Kahn CR & Lund PK 1999 Postnatal growth responses to insulin-like growth factor I in insulin receptor substrate-1-deficient mice. Endocrinology 140 54785487.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Räkel A, Sheehy O, Rahme E & LeLorier J 2008 Osteoporosis among patients with type 1 and type 2 diabetes. Diabetes & Metabolism 34 193205.

  • Rosen C, Churchill G, Donahue L, Shultz K, Burgess J, Powell D & Beamer W 2000 Mapping quantitative trait loci for serum insulin-like growth factor-1 levels in mice. Bone 27 521528.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rosen CJ, Ackert-Bicknell CL, Adamo ML, Shultz KL, Rubin J, Donahue LR, Horton LG, Delahunty KM, Beamer WG & Sipos J et al. 2004 Congenic mice with low serum IGF-1 have increased body fat, reduced bone mineral density, and an altered osteoblast differentiation program. Bone 35 10461058.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Rung J, Cauchi S, Albrechtsen A, Shen L, Rocheleau G, Cavalcanti-Proença C, Bacot F, Balkau B, Belisle A & Borch-Johnsen K et al. 2009 Genetic variant near IRS1 is associated with type 2 diabetes, insulin resistance and hyperinsulinemia. Nature Genetics 41 11101115.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Sesti G 2000 Insulin receptor substrate polymorphisms and type 2 diabetes mellitus. Pharmacogenetics 1 343357.

  • Shimoaka T, Kamekura S, Chikuda H, Hoshi K, Chung UI, Akune T, Maruyama Z, Komori T, Matsumoto M & Ogawa W et al. 2004 Impairment of bone healing by insulin receptor substrate-1 deficiency. Journal of Biological Chemistry 279 1531415322.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Shirakami A, Toyonaga T, Tsuruzoe K, Shirotani T, Matsumoto K, Yoshizato K, Kawashima J, Hirashima Y, Miyamura N & Kahn CR et al. 2002 Heterozygous knockout of the IRS-1 gene in mice enhances obesity-linked insulin resistance: a possible model for the development of type 2 diabetes. Journal of Endocrinology 174 309319.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Silha JV, Mishra S, Rosen CJ, Beamer WG, Turner RT, Powell DR & Murphy LJ 2003 Perturbations in bone formation and resorption in insulin-like growth factor binding protein-3 transgenic mice. Journal of Bone and Mineral Research 18 18341841.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tamemoto H, Kadowaki T, Tobe K, Yagi T, Sakura H, Hayakawa T, Terauchi Y, Ueki K, Kaburagi Y & Satoh S et al. 1994 Insulin resistance and growth retardation in mice lacking insulin receptor substrate-1. Nature 372 182186.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Tok EC, Ertunc D, Bilgin O, Erdal EM, Kaplanoglu M & Dilek S 2006 Association of insulin receptor substrate-1 G972R variant with baseline characteristics of the patients with gestational diabetes mellitus. American Journal of Obstetrics and Gynecology 194 868872.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Ura S, Araki E, Kishikawa H, Shirotani T, Todaka M, Isami S, Shimoda S, Yoshimura R, Matsuda K & Motoyoshi S et al. 1996 Molecular scanning of the insulin receptor substrate-1 (IRS-1) gene in Japanese patients with NIDDM: identification of five novel polymorphisms. Diabetologia 39 600608.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Varela-Nieto I, Morales-Garcia JA, Vigil P, Diaz-Casares A, Gorospe I, Sánchez-Galiano S, Cañon S, Camarero G, Contreras J & Cediel R et al. 2004 Trophic effects of insulin-like growth factor-I (IGF-I) in the inner ear. Hearing Research 196 1925.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vestergaard P, Jørgensen JO, Hagen C, Hoeck HC, Laurberg P, Rejnmark L, Brixen K, Weeke J, Andersen M & Conceicao FL et al. 2002 Fracture risk is increased in patients with GH deficiency or untreated prolactinomas – a case–control study. Clinical Endocrinology 56 159167.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang Y, Nishida S, Elalieh HZ, Long RK, Halloran BP & Bikle DD 2006 Role of IGF-I signaling in regulating osteoclastogenesis. Journal of Bone and Mineral Research 21 13501358.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Weitgasser R, Gappmayer B & Pichler M 1999 Newer portable glucose meters – analytical improvement compared with previous generation devices. Clinical Chemistry 45 18211825.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • White MF 2003 Insulin signaling in health and disease. Science 302 17101711.

  • Woods KA, Camacho-Hübner C, Savage MO & Clark AJ 1996 Intrauterine growth retardation and postnatal growth failure associated with deletion of the insulin-like growth factor I gene. New England Journal of Medicine 335 13631367.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer B & LeRoith D 1999 Normal growth and development in the absence of hepatic insulin-like growth factor I. PNAS 96 73247329.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yakar S, Rosen CJ, Bouxsein ML, Sun H, Mejia W, Kawashima Y, Wu Y, Emerton K, Williams V & Jepsen K et al. 2009 Serum complexes of insulin-like growth factor-1 modulate skeletal integrity and carbohydrate metabolism. FASEB Journal 23 709719.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yamaguchi M, Ogata N, Shinoda Y, Akune T, Kamekura S, Terauchi Y, Kadowaki T, Hoshi K, Chung UI & Nakamura K et al. 2005 Insulin receptor substrate-1 is required for bone anabolic function of parathyroid hormone in mice. Endocrinology 146 26202628.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yamauchi T, Tobe K, Tamemoto H, Ueki K, Kaburagi Y, Yamamoto-Honda R, Takahashi Y, Yoshizawa F, Aizawa S & Akanuma Y et al. 1996 Insulin signaling and insulin actions in the muscles and livers of insulin-resistant, insulin receptor substrate 1-deficient mice. Molecular and Cellular Biology 116 101114.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhang M, Xuan S, Bouxsein ML, von Stechow D, Akeno N, Faugere MC, Malluche H, Zhao G, Rosen CJ & Efstratiadis A et al. 2002 Osteoblast-specific knockout of the insulin-like growth factor (IGF) receptor gene reveals an essential role of IGF signaling in bone matrix mineralization. Journal of Biological Chemistry 277 4400544012.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Zhang M, Faugere MC, Malluche H, Rosen CJ, Chernausek SD & Clemens TL 2003 Paracrine overexpression of IGFBP-4 in osteoblasts of transgenic mice decreases bone turnover and causes global growth retardation. Journal of Bone and Mineral Research 18 836843.

    • PubMed
    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • Western blots of IRS-1 (A) and AKT (B). (A) Liver lysates from Irs1sml/sml mice (lanes 1–2) and an Irs1+/+ control (lane 3) were immunoprecipitated with an IRS-1 C-terminus-specific antibody as described in the Materials and Methods. Following SDS-PAGE, the amount of IRS-1 was determined by immunoblotting. The arrow denotes the position of the IRS-1 band which is lacking in Irs1sml/sml lysates. (B) Mouse calvarial osteoblast cultures from Irs1sml/sml, Irs1+/sml, and Irs1+/+ mice were treated with IGF1 (IGF1) and insulin (INS) or were given no treatment (NT), harvested, and lysed as described in the Materials and Methods. Following SDS-PAGE, membranes were immunoblotted for phosphorylated AKT (pAKT) and total AKT (tAKT).

  • Toluidine blue staining of the proximal femur growth plate at 10× magnification of 13-week-old Irs1+/+, Irs1+/sml, and Irs1sml/sml mice.

  • Bone marrow stromal cultures (BMSCs) of Irs1sml/sml, Irs1+/sml, and Irs1+/+ control females. (A) On day 18, adherent OB progenitor cells were identified by alkaline phosphatase staining (CFU-ALP) and mineralization was identified by von Kossa staining. (B) Numbers of osteoclast cells in the bone marrow stromal cultures of Irs1sml/sml, Irs1+/sml, and Irs1+/+ mice. On day 7, the cells were fixed and stained for TRAP5b. TRAP5b-positive multinucleated (>3 nuclei) osteoclasts were then counted using light microscopy. In all the experiments, male BMSCs exhibited a pattern that was similar to that exhibited by the females. Full colour version of this figure available via http://dx.doi.org/10.1677/JOE-09-0328.

  • Mouse calvarial osteoblast cultures from Irs1sml/sml, Irs1+/sml, and Irs1+/+ mice were treated with IGF1 (IGF1) and insulin (INS) or were given no treatment (NT), harvested, and lysed as described in the Materials and Methods. Lysates were immunoprecipitated with an IRS-2 antibody and were then immunoblotted with IRS-2 for total protein levels or p-Tyr for phosphorylation of IRS-2.

  • Fasted serum insulin and IGF1 levels and the glucose/insulin tolerance tests of Irs1sml/sml, Irs1+/sml, and Irs1+/+ fasted mice during the glucose and insulin tolerance tests. At 16 weeks of age, males and females were tested for (A) insulin and (B) IGF1 serum levels (n=10 per genotype *P≤0.05 Irs1+/sml versus Irs1+/+, **P≤0.05 Irs1sml/sml versus Irs1+/+, and ***P≤0.05 Irs1sml/sml versus Irs1+/sml). Male Irs1+/+, Irs1+/sml, and Irs1sml/sml mice at 8 weeks of age were fasted overnight and then subjected to a (C) GTT or fed ad libitum and then subjected to a (D) ITT as described in the Materials and Methods. Females were tested at the same time and they showed a similar pattern of significance (n=10 per genotype *P≤0.05).