Abstract
Igf1 and Igf2 stimulate growth and development of vertebrates. Circulating Igfs are produced by the liver. In mammals, Igf1 mediates the postnatal growth-promoting effects of growth hormone (Gh), whereas Igf2 stimulates fetal and placental growth. Hepatic Igf2 production is not regulated by Gh in mammals. Little is known about the regulation of hepatic Igf2 production in nonmammalian vertebrates. We examined the regulation of igf2 mRNA level by metabolic hormones in primary cultured coho salmon hepatocytes. Gh, insulin, the glucocorticoid agonist dexamethasone (Dex), and glucagon increased igf2 mRNA levels, whereas triiodothyronine (T3) decreased igf2 mRNA levels. Gh stimulated igf2 mRNA at physiological concentrations (0.25×10−9 M and above). Insulin strongly enhanced Gh stimulation of igf2 at low physiological concentrations (10−11 M and above), and increased basal igf2 (10−8 M and above). Dex stimulated basal igf2 at concentrations comparable to those of stressed circulating cortisol (10−8 M and above). Glucagon stimulated basal and Gh-stimulated igf2 at supraphysiological concentrations (10−7 M and above), whereas T3 suppressed basal and Gh-stimulated igf2 at the single concentration tested (10−7 M). These results show that igf2 mRNA level is highly regulated in salmon hepatocytes, suggesting that liver-derived Igf2 plays a significant role in salmon growth physiology. The synergistic regulation of igf2 by insulin and Gh in salmon hepatocytes is similar to the regulation of hepatic Igf1 production in mammals.
Introduction
The insulin-like growth factors (Igf1 and Igf2) regulate growth in vertebrates (Humbel 1990, Stewart & Rotwein 1996). These mitogenic peptide hormones are produced throughout the body, and are present at high levels in the blood. Circulating Igfs are mainly derived from the liver. Both Igfs act through the same membrane receptor, the type 1 Igf receptor (Igf1r). The activity of both Igfs is modulated by a family of Igf-binding proteins (Igfbps), which bind strongly to the Igfs and may inhibit or enhance their activity. In mammals, the functions of the Igfs are divided by developmental stage. Igf2 regulates embryonic growth, and regulates the growth of the placenta, but Igf2 is not thought to regulate growth in postnatal mammals. Igf1, in contrast, is a principal regulator of postnatal growth in mammals, and disruption of Igf1 signaling results in severe postnatal growth deficits (Efstratiadis 1998). Both liver-derived endocrine Igf1 and locally produced Igf1 contribute to the regulation of growth. In mice, the contributions of endocrine and local Igf1 are roughly equal (Stratikopoulos et al. 2008).
Research on the role of endocrine Igf1 in growth regulation has been guided by the somatomedin hypothesis, which states that Gh secreted by the pituitary gland stimulates the liver to produce Igf1 (Humbel 1990). Igf1 mediates the growth-promoting effects of Gh, and feeds back at the pituitary and hypothalamus to inhibit Gh secretion, completing the Gh/Igf1 endocrine axis. The basic framework of the somatomedin hypothesis is widely accepted; however, it is now clear that multiple levels of regulation occur downstream from Gh secretion. At the liver, the sensitivity of hepatocytes to stimulation by Gh is modulated by physiological state. During catabolic states such as fasting or disease, liver Igf1 production becomes insensitive to stimulation by Gh, a phenomenon termed Gh resistance (Thissen et al. 1994, Rodgers 1996). After birth, Igf2 circulates at levels comparable to those of Igf1 in most mammalian species, except in rodents (Humbel 1990, Stewart & Rotwein 1996). However, in contrast to Igf1, liver Igf2 production is not stimulated by Gh in adult mammals. Unlike Igf1, plasma Igf2 levels do not respond to physiological status or relate to growth rate (Holly 1998). For these reasons, Igf2 is not considered part of the Gh/Igf1 endocrine axis proposed in the somatomedin hypothesis. The function of endocrine Igf2 in mammalian postnatal life remains enigmatic (Humbel 1990, Holly 1998). In contrast, important roles for locally produced Igf2 in cell growth and differentiation in the muscle and other tissues have been described recently (Chao & D'Amore 2008).
All components of the Gh/Igf1 axis are present in teleost fishes. Major functional relationships, such as stimulation of liver Igf1 production by Gh, modulation of liver Gh sensitivity by physiological state (Gh resistance), and modulation of Igf actions by Igfbps, are well conserved (Kelley et al. 2002, Reinecke et al. 2005, Wood et al. 2005). Variation in individual fish plasma Igf1 level can explain 50–60% of variation in growth rate in fishes (Picha et al. 2008a). Teleost fishes differ from mammals in that liver igf2 gene expression is stimulated by Gh (Shamblott et al. 1995, Tse et al. 2002, Vong et al. 2003, Carnevali et al. 2005, Peterson et al. 2005, Gahr et al. 2008, Moriyama et al. 2008, Ponce et al. 2008, Devlin et al. 2009). Liver igf2 gene expression responds to fasting and metabolic status in fishes (Peterson et al. 2004, Gabillard et al. 2006, Ayson et al. 2007, Terova et al. 2007, Picha et al. 2008b), and plasma Igf2 levels are decreased by fasting (Gabillard et al. 2006, Wilkinson et al. 2006). These findings suggest that Igf2 plays a role in the Gh/Igf1 (henceforward Gh/Igf) axis in fishes. However, the roles of hormones associated with metabolic status in the regulation of liver igf2 gene expression have not been studied in detail.
Gh reliably stimulates igf1 gene expression in primary cultured fish hepatocytes (Duan et al. 1993, Shamblott et al. 1995, Schmid et al. 2000, Pierce et al. 2004, 2005a, Leung et al. 2008) and liver tissue incubation (Moriyama et al. 2006). In coho salmon (Oncorhynchus kisutch) hepatocytes, glucocorticoids strongly reduced Gh stimulation of igf1 mRNA levels, suggesting that glucocorticoids mediate the development of Gh resistance in this species (Pierce et al. 2005a). Surprisingly, insulin also reduced Gh stimulation of coho salmon hepatocyte igf1 mRNA levels, the inverse of the synergy found in mammals and birds (e.g. Tollet et al. 1990, Houston & O'Neill 1991). Gh stimulates igf2 gene expression in rainbow trout (Oncorhynchus mykiss) primary hepatocytes (Shamblott et al. 1995) and in tissue incubation of eel (Anguilla japonica) liver slices (Moriyama et al. 2008). We hypothesized that metabolic hormones may modulate the effect of Gh on liver Igf2 production in fishes. To test this hypothesis, we examined basal and Gh-dependent effects of insulin, glucagon, dexamethasone (Dex), and triiodothyronine (T3) on igf2 gene expression in primary cultured coho salmon hepatocytes. Our results show that both basal and Gh-stimulated igf2 levels are highly regulated in salmon hepatocytes. In conjunction with our previous studies (Pierce et al. 2004, 2005a), our results suggest that hepatic Igf2 and Igf1 production is inversely regulated by insulin and glucocorticoids in salmon.
Materials and methods
Animals
Coho salmon were raised in 1.3-m diameter cylindrical tanks with recirculated fresh water at 11–12 °C under simulated natural photoperiod at the Northwest Fisheries Science Center (Seattle, WA, USA). Fishes were fed BioOregon-grower (use of trade names does not imply endorsement of NOAA, US Department of Commerce) pellets at a ration of 0.6% body weight per day. Two-year-old coho salmon were used. Fishes were fasted for 1 day prior to cultures. Data shown are from the following cultures: 12/07/02, pooled cells from two immature male fishes, 146 and 179 g for Fig. 1; 10/12/02, independent cultures from three immature female fishes, 143, 149, and 157 g for Fig. 2A and B; 7/10/04, pooled cells from two immature male fishes, 155 and 169 g for the fourth replicate in Fig. 2B; 6/12/04, pooled cells from two immature male fishes, 262 and 275 g for Fig. 3; 8/13/05, independent cultures from three immature fishes, one male, 349 g, and two females, 292 and 411 g, for Fig. 2C; 9/29/08, pooled cells from three immature male fishes, 155, 150, and 120 g for Fig. 4; and 10/06/08, pooled cells from two immature male fishes, 120 and 135 g for Fig. 5.
Effect of Gh (coho salmon) concentration on igf2 mRNA level in primary cultured salmon hepatocytes. Error bars show s.e.m.; points not sharing a superscript letter differ significantly (Student–Newman–Keuls test, P<0.05, n=5–6 wells per point). Data shown is from a single cell preparation and culture.
Citation: Journal of Endocrinology 204, 3; 10.1677/JOE-09-0338
Effects of metabolic hormones on basal and Gh-stimulated igf2 mRNA levels in primary cultured salmon hepatocytes. (A) Effects of dexamethasone (Dex, cyclodextrin encapsulated), triiodothyronine (T3), and Gh (coho salmon). (B) Effects of insulin (Ins, bovine) and Gh. (C) Effects of glucagon (Glu, bovine) and Gh. Error bars show s.e.m.; points or bars not sharing a superscript letter differ significantly (Student–Newman–Keuls test, P<0.05). Data shown are combined from three, four, and three independent cultures respectively, four wells per treatment per culture. For each experiment, data from replicate cultures were normalized to the average response to Gh within that experiment.
Citation: Journal of Endocrinology 204, 3; 10.1677/JOE-09-0338
Effect of dexamethasone concentration on igf2 mRNA level in primary cultured salmon hepatocytes. Error bars show s.e.m.; points not sharing a superscript letter differ significantly (Student–Newman–Keuls test, P<0.05, n=5–6 wells per point). Data shown is from a single cell preparation and culture.
Citation: Journal of Endocrinology 204, 3; 10.1677/JOE-09-0338
Effect of insulin (bovine) concentration on basal and Gh-stimulated (GroPep recombinant salmon/trout) igf2 mRNA levels in primary cultured salmon hepatocytes. Error bars show s.e.m. The effect of Gh was significant at every insulin concentration; within the basal and Gh-stimulated treatment groups, points not sharing a superscript letter differ significantly (Student–Newman–Keuls test, P<0.05, n=6–10 wells per point). Data shown are from a single cell preparation and culture.
Citation: Journal of Endocrinology 204, 3; 10.1677/JOE-09-0338
Effect of glucagon (bovine) concentration on basal and Gh-stimulated (GroPep recombinant salmon/trout) igf2 mRNA levels in primary cultured salmon hepatocytes. Error bars show s.e.m. The effect of Gh was significant at every glucagon concentration; within the basal and Gh-stimulated treatment groups, points not sharing a superscript letter differ significantly (Student–Newman–Keuls test, P<0.05, n=4–10 wells per point). Data shown are from a single cell preparation and culture.
Citation: Journal of Endocrinology 204, 3; 10.1677/JOE-09-0338
Hepatocyte culture and RNA isolation
Hepatocytes were isolated and cultured as described previously (Pierce et al. 2004). Cells were cultured in Falcon Primaria 24-well plates at 15 °C in modified RPMI 1640 medium (Gibco BRL; 20 mM HEPES, 5 mM NaHCO3, and 0.2% BSA) under plain air. Hepatocytes were plated at a density of 1–2×106 cells/ml, 0.5 ml/well, and were allowed to adhere for 24 h, and then the medium was changed to the test medium containing hormones. Cultures were stopped 18 h later by adding Tri Reagent (MRC, Cincinnati, OH, USA) to the wells. This time point was determined previously to be appropriate for the measurement of igf1 gene expression in salmon primary hepatocyte culture (Pierce et al. 2004). We assumed that the 18-h time point would also be appropriate for igf2 gene expression. Please see Duan et al. (1993) for illustrations showing the morphology of cultured salmon hepatocytes. RNA was isolated following the MRC protocol, with bromochloropropane as the phase separation reagent and two 70% ethanol washes. RNA was quantified by spectrophotometry (260:280 ratios 1.8–2.0), and was diluted to 20 ng/μl.
Hormones
Native coho salmon Gh was purified by HPLC. Recombinant salmon/trout (Oncorhynchus spp.) Gh was purchased from GroPep Ltd (Adelaide, SA, Australia). T3, water-soluble Dex (cyclodextrin encapsulated), native bovine insulin, and native bovine glucagon were purchased from Sigma.
Real-time quantitative RT-PCR
Hepatocyte igf2 mRNA levels were quantified using a TaqMan probe quantitative RT-PCR (qPCR) assay as described previously (Campbell et al. 2006). The amplicon for the igf2 qPCR assay was in the region of the transcript encoding the leader peptide and covering the predicted exon 2/exon 3 junction. Gene expression data were normalized to the expression level of acidic ribosomal phosphoprotein P0 (arp, listed as rplpo in the Zfin Database) using an efficiency-corrected relative expression technique (Pierce et al. 2004). Primer and probe sequences for qPCR assays are listed for reference in Table 1. First-strand cDNA was synthesized in 10-μl reverse transcription (RT) reactions with 2 μl RNA template, 2.5 U/μl SuperScript II reverse transcriptase (Invitrogen), 5 μM random hexamer primers, 500 μM dNTPs, 0.4 U/μl RNase inhibitor (Applied Biosystems, Inc. (ABI), Foster City, CA, USA), 10 mM dithiothreitol, and 1× RT buffer, and was incubated at 25 °C for 10 min, 48 °C for 60 min, and 95 °C for 5 min. PCR assays were run in 96-well format on an ABI 7700 qPCR machine using the standard cycling conditions recommended by the manufacturer (50 °C for 2 min, 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 1 min). Wells contained 25 μl PCR mixture, prepared from ABI Universal PCR Master Mix, with 200 nM probe, 900 nM forward and reverse primers, and 2 μl cDNA template. As a standard, a fivefold serial dilution from a coho salmon liver (highest concentration of 100 ng/ml RNA input to RT reaction, four standards, three replicate wells per standard) was run on each plate. A single replicate of each PCR was run. TaqMan PCRs for target and reference genes were run from the same RT reaction.
Primer and probe sequences for coho salmon RT-PCR assays
| Sequence (5′–3′) | |
|---|---|
| Element | |
| Igf2 F primer | AACACCATCCGCAAGAAACTG |
| Igf2 R primer | TTGTCCAGAGCTGCATGCA |
| Igf2 probe | Fam-TGGAACAGGGTCCCTGCCACATTG-Tamra |
| Arp F primer | GAAAATCATCCAATTGCTGGATG |
| Arp R primer | CTTCCCACGCAAGGACAGA |
| Arp probe | Vic-CTATCCCAAATGTTTCATTGTCGGCGC-Tamra |
Data analysis
Gene expression levels were expressed relative to the control treatment for each hepatocyte preparation. Descriptions of increases or decreases in gene expression refer only to the comparison of control and treatment groups at the single time point used in this study. Gene expression data were log2 transformed prior to analysis to achieve homogeneity of variance. In the factorial experiments (Fig. 2), the pattern of responses to different treatments was similar between hepatocyte preparations, but the magnitude of responses differed sometimes. Therefore, for each experiment, the data from each hepatocyte culture were normalized to the average Gh response level of all cultures within that experiment. Treatment and culture effects were examined by one- or two-way ANOVA, followed by the Student–Newman–Keuls test. Statistical analysis was conducted with PRISM 4 (GraphPad Software, San Diego, CA, USA). Results were considered statistically significant at P<0.05.
Results
Gh increased igf2 mRNA level in salmon hepatocytes in a concentration-dependent manner (Fig. 1). The increase in igf2 mRNA became significant at 0.25 nM Gh and was maximal at 5 nM Gh (3.35-fold). Decreases from maximal igf2 expression occurred at higher Gh concentrations; however, igf2 mRNA levels were not significantly lower than the maximal level (Gh 500 vs 5 nM: P=0.0891, Fisher's LSD).
Factorial experiments were conducted to assess basal and Gh-dependent effects of metabolic hormones on igf2 gene expression (Fig. 2). At least three replicate cultures were tested in each experiment. All cultures responded to Gh with a significant increase in igf2 mRNA level. After normalization to the average response to Gh, replicate cultures showed strong and highly significant effects of experimental treatments with metabolic hormones, and much weaker effects of culture and treatment×culture interaction in two-way ANOVA (Fig. 2A: treatment 85.61% of variation, P<0.0001; culture 0.42% of variation, P=0.2089; interaction 6.90% of variation, P<0.0001; Fig. 2B: treatment 74.9% of variation, P<0.0001; culture 0.96% of variation, P=0.3356; interaction 8.82% of variation, P=0.002; Fig. 2C: treatment 80.54% of variation, P<0.0001; culture 6.82% of variation, P<0.0001; interaction 8.59% of variation, P<0.0001). Therefore, data are presented for combined replicate cultures.
T3 (10−7 M) significantly decreased basal and Gh-stimulated igf2 mRNA levels (Fig. 2A). The decrease was of a comparable magnitude (basal: 0.49; Gh-stimulated: 0.67 copies of igf2 mRNA). In contrast, Dex (10−6 M) significantly increased basal and Gh-stimulated igf2 mRNA levels. The increase was of a comparable magnitude (basal: 0.76; Gh-stimulated: 0.86 copies of igf2 mRNA). Insulin (10−6 M) significantly and strongly increased basal and Gh-stimulated igf2 mRNA levels (Fig. 2B). The increase was greater in the presence of Gh (basal: 1.19; Gh-stimulated: 2.27 copies of igf2 mRNA). Glucagon (10−6 M) significantly and even more strongly increased basal and Gh-stimulated igf2 mRNA levels (Fig. 2C). The increase was much greater in the presence of Gh (basal: 2.14; Gh-stimulated: 7.11 copies igf2 mRNA). These findings suggest that glucagon and insulin may interact with Gh in the regulation of igf2 gene expression in salmon hepatocytes, but provide no support for interactions between Gh and Dex or Gh and T3. Therefore, concentration–response studies were conducted with Dex by itself, and with insulin and glucagon in combination with Gh.
Dex increased igf2 mRNA levels in salmon hepatocytes in a concentration-dependent and biphasic manner (Fig. 3). Dex concentrations as low as 10−12 M were tested because 10−12 M Dex significantly repressed Gh-stimulated igf1 mRNA levels in a previous study (Pierce et al. 2005a). However, in the current study, Dex did not affect hepatocyte igf2 mRNA levels at concentrations from 10−12 to 10−9 M. The igf2 mRNA increase in response to Dex became significant at 10−8 M and was maximal at 10−7 M (3.16-fold). igf2 mRNA was significantly reduced from maximal at 10−6 M Dex.
The effect of insulin on igf2 mRNA levels, and potential interactions between insulin and Gh were assessed in a concentration–response study (Fig. 4). The effects of Gh, insulin, and the interaction term were significant in a two-way ANOVA (Gh 48.9% of variation, P<0.0001; insulin 27.3% of variation, P<0.0001; interaction 5.9% of variation, P<0.0001). Gh (5 nM) significantly increased igf2 mRNA levels at all concentrations of insulin (1.7-fold with no insulin). Insulin increased basal igf2 mRNA levels in a concentration-dependent manner. The increase became significant at 10−8 M and was maximal at 10−6 M (1.9-fold). There was a significant linear trend toward increased igf2 mRNA with increasing insulin concentration from 10−10 to 10−6 M (P<0.0001, r2=0.416), but not with that from 0 to 10−10 M (P=0.97). Insulin increased Gh-stimulated igf2 mRNA levels in a concentration-dependent manner. The increase versus Gh alone became significant at 10−11 M. The steepest increase occurred from 10−12 to 10−10 M insulin, and maximal response occurred at 10−8 M (3.0-fold increase versus Gh alone; approximately fivefold versus basal). A nonsignificant decrease from maximal response was found at 10−6 M insulin (10−8 vs 10−6 M, P=0.0578, Fisher's LSD).
Interactions between glucagon and Gh were assessed in a concentration–response study (Fig. 5). The effects of Gh and glucagon were significant in a two-way ANOVA; however, the interaction term was not (Gh 55.1% of variation, P<0.0001; glucagon 18.1% of variation, P<0.0001; interaction 1.1% of variation, P=0.5536). Gh (5 nM) significantly increased igf2 mRNA levels at all concentrations of glucagon (2.2-fold with no glucagon). Glucagon significantly increased basal igf2 mRNA levels at 10−7 and 10−6 M; the increase was maximal at 10−6 M (1.8-fold). Similarly, glucagon increased Gh-stimulated igf2 mRNA levels versus controls at 10−7 and 10−6 M, with maximal response at 10−7 M glucagon (1.7-fold versus Gh alone).
The Ct for arp did not vary between treatments in any experiment, indicating that treatments did not affect our reference gene.
Discussion
This study shows that igf2 mRNA levels are highly regulated in primary cultured salmon hepatocytes. igf2 mRNA levels were increased by Gh, Dex, insulin, and glucagon, and were decreased by T3. In tetrapods, in contrast, liver Igf2 production has not been shown to be regulated by hormones in adult animals (Humbel 1990, Stewart & Rotwein 1996, Holly 1998). This suggests that liver-derived endocrine Igf2 may play a greater role in growth regulation in sexually immature subadult salmon than in adult tetrapods.
Gh stimulated igf2 gene expression in salmon hepatocytes (Fig. 1). Stimulation became significant at 0.25 nM Gh, and was maximal at 5 nM. Stimulation by Gh occurred reliably with 5 nM Gh (Fig. 2). Physiological concentrations of Gh range from <50 pM to over 5 nM in salmonids (Gomez et al. 1996, Pierce et al. 2005b). Thus, the response of cultured hepatocytes occurred over the physiological range. igf2 gene expression levels declined at Gh concentrations above 5 nM (P=0.0891), suggesting that the response is probably biphasic. Previous in vitro studies in fishes found Gh stimulation of igf2 gene expression in cultured rainbow trout hepatocytes (Shamblott et al. 1995) and in tissue incubation of eel liver slices (Moriyama et al. 2008). The response of igf2 to Gh in salmon hepatocytes is quite similar to the response of igf1 (Pierce et al. 2005a). In vivo, Gh treatment increases liver igf2 gene expression in a diverse array of teleost species (Shamblott et al. 1995, Tse et al. 2002, Vong et al. 2003, Carnevali et al. 2005, Peterson et al. 2005, Gahr et al. 2008, Moriyama et al. 2008, Ponce et al. 2008, Devlin et al. 2009). These studies and the present study add to a growing consensus that Igf2 functions as a somatomedin in teleost fishes.
The glucocorticoid receptor agonist Dex increased igf2 mRNA levels in cultured salmon hepatocytes (Fig. 2A). Dex stimulated igf2 at 10−9–10−6 M, with maximal stimulation at 10−7 M and a decrease from maximal stimulation at 10−6 M (Fig. 3). The native glucocorticoid hormone in fishes is cortisol. Cortisol concentrations range from ∼10−9 to 10−6 M from basal to stressed respectively in salmonids (Norris & Hobbs 2006). Dex is five- to ten-fold stronger than cortisol (Mommsen et al. 1999). Thus, the response of igf2 to Dex in cultured salmon hepatocytes occurred over the stressed range. In a study in gilthead sea bream (Sparus aurata), both Gh-injected and saline-injected fishes showed very high liver igf2 gene expression (Duguay et al. 1996), possibly mediated by a cortisol response to the injection.
In mammals, glucocorticoid signaling plays a role in the development of liver Gh resistance in terms of Igf1 production (Thissen et al. 1994, Rodgers 1996). Glucocorticoid induction of Gh resistance in terms of Igf1 production appears to be conserved in fishes (e.g. Kajimura et al. 2003). In silver sea bream (Sparus sarba) hepatocytes, cortisol decreased basal igf1 mRNA levels at physiological concentrations (Leung et al. 2008). In salmon hepatocytes, Dex did not affect basal igf1, but it strongly inhibited Gh-stimulated igf1 over an extremely wide range of concentrations (10−12 to 10−6 M; Pierce et al. 2005a). These and other studies show that liver igf1 gene expression and circulating Igf1 levels decrease during stress in fishes. The current study suggests that liver igf2 gene expression and circulating Igf2 levels would be expected to increase during stress. Further studies are required to determine whether this inverse regulation occurs in vivo.
The most striking finding of the current study was the synergism between insulin and Gh in stimulation of hepatocyte igf2 gene expression. Insulin stimulated basal igf2 at 10−6 M, and the combination of insulin and Gh appeared greater than additive (Fig. 2B). A detailed concentration–response study revealed that insulin synergized with Gh at concentrations of 10−11 M and above (Fig. 4). The steepest increase occurred from 10−12 to 10−10 M insulin, with a decline from maximal stimulation at 10−6 M (P=0.0578). Insulin significantly stimulated basal igf2 at 10−8 M and above. In salmonids, insulin concentrations in the hepatic portal vein are approximately fivefold higher than those in the general circulation (Plisetskaya & Sullivan 1989), suggesting that coho salmon hepatocytes experience insulin concentrations from ∼10−9 M during fasting to 10−7 M postprandially in vivo (Shimizu et al. 2009). Salmon hepatocytes would be expected to respond more strongly to salmon insulin than the bovine insulin used in this study (Navarro et al. 2006). Therefore, the present study suggests that physiological concentrations of insulin are required for normal Gh stimulation of Igf2 production by the salmon liver.
We are not aware of any studies in fishes addressing the regulation of hepatic igf2 by insulin. The only relevant mammalian hepatocyte culture studies used fetal hepatocytes. In fetal rat hepatocytes, Igf2 gene expression was positively regulated by insulin, but it was not responsive to Gh (Goya et al. 1999, 2001). Based on this very limited dataset, basal insulin regulation of igf2 in juvenile salmon hepatocytes is similar to insulin regulation of igf2 in fetal rat hepatocytes. In contrast to the scarcity of information on igf2 regulation, there are many studies in tetrapods on insulin regulation of liver igf1 gene expression and Igf1 secretion. Insulin synergizes with GH to stimulate hepatocyte Igf1 gene expression and IGF1 protein secretion in mammals and birds, and also stimulates basal igf1 and IGF1 (Tollet et al. 1990, Boni-Schnetzler et al. 1991, Houston & O'Neill 1991, Phillips et al. 1991). The synergism is found over physiological concentrations of insulin. In rats, normal secretion of insulin into the hepatic portal vein is required to maintain liver IGF1 production, plasma IGF1 levels, and growth in vivo (Griffen et al. 1987). In catabolic lactating cows, insulin infusion is sufficient to restore liver GH sensitivity and plasma IGF1 levels (Butler et al. 2003). Thus, the regulation of salmon hepatocyte igf2 by insulin and Gh found in the present study is similar to the regulation of hepatic Igf1 production by insulin and Gh in tetrapods.
Insulin regulation of igf2 gene expression contrasts with insulin regulation of igf1 gene expression in salmon hepatocytes. Insulin did not affect basal igf1 in salmon hepatocytes, but it inhibited Gh-stimulated igf1 (Pierce et al. 2005a). Although insulin can bind Igf1r with lower affinity than Igf1 (Wood et al. 2005), addition of 5 nM Igf1 to culture medium did not affect basal or Gh-stimulated igf1 mRNA level, suggesting that these effects are not mediated by the Igf1r pathway (Pierce et al. 2004). In the present study, the significant increase in Gh-stimulated igf2 mRNA level with 10−11 M insulin treatment is not consistent with an effect mediated by Igf1r, and also argues against an effect mediated by insulin-induced changes in hepatocyte metabolism. Plasma insulin increased strongly after a meal in fed salmon, whereas plasma Igf1 increased more weakly, and the response of Igf1 but not of insulin was abolished by fasting for 1–3 weeks (Shimizu et al. 2009). In the context of the present study, these findings predict that, in vivo, liver igf2 gene expression and plasma Igf2 may increase more strongly than plasma Igf1 in response to postprandial increases in hepatic portal insulin. This could provide a mechanism for nutritional regulation of plasma Igf2. Plasma Igf2 levels are positively regulated by nutritional status in salmonids (Gabillard et al. 2006, Wilkinson et al. 2006). Further studies are required to investigate these relationships.
Glucagon increased basal and Gh-stimulated igf2 in salmon hepatocytes (Fig. 2C). The combination appeared synergistic at 10−6 M glucagon and 5×10−9 M Gh. A concentration–response experiment showed that glucagon concentrations of 10−7 M and above increased basal and Gh-stimulated igf2 (Fig. 5). However, the synergism between glucagon and Gh was not apparent in this experiment. Hepatic portal glucagon concentrations are around 10−10 M in salmonids (Plisetskaya & Mommsen 1996). Therefore, the effect of glucagon on igf2 is probably not important in the normal physiological regulation of igf2. In our previous study, glucagon inhibited Gh-stimulated igf1 at 10−6 M (Pierce et al. 2005a). At concentrations as low as 10−8 M, heterologous glucagons increase glycogenolysis and lipid catabolism in fish hepatocytes (Plisetskaya & Mommsen 1996). Regulation of the Igfs by high concentrations of glucagon in salmon hepatocytes suggests that the Igfs may respond to cellular concentrations of metabolic substrates. In fetal rat hepatocytes, both Igfs are stimulated by glucose (Goya et al. 1999). An indirect effect of glucagon through changes in hepatocyte metabolism might also explain the variability in magnitude of response found in the present study, since hepatocyte preparations would be expected to vary in stores of glycogen and lipids. The effect of high concentrations of insulin on basal igf2 could also be mediated by an effect on hepatocyte metabolism. Further studies are required to address these possibilities.
T3 (10−7 M) suppressed both basal and Gh-stimulated igf2 in salmon hepatocytes (Fig. 2A). We are not aware of any vertebrate hepatocyte culture studies reporting the effects of thyroid hormones on igf2. In cultured tilapia (Oreochromis mossambicus) hepatocytes, thyroid hormones increased basal igf1 (Schmid et al. 2003), and in silver sea bream hepatocytes, thyroid hormones increased basal igf1 at high concentrations (Leung et al. 2008). In coho salmon hepatocytes, no effect of 10−7 M T3 was found on basal or Gh-stimulated igf1 (Pierce et al. 2005a). In anadromous salmonids such as coho salmon, thyroid hormones increase during smoltification, the series of preadaptive physiological, developmental, and behavioral changes that occur prior to migration to the ocean (Folmar & Dickhoff 1980). It is possible that suppression of liver igf2 gene expression by T3 plays a role in smoltification.
Most of the effects of hormonal treatment on igf2 mRNA levels found in this study occurred at physiological concentrations. Furthermore, in other studies using identical culture conditions, we found differential and often inverse regulation of different transcripts. Gh increased igf1 and igf2 mRNA levels, but decreased igfbp1 mRNA and protein levels (present study; Pierce et al. 2005a, 2006). Insulin increased basal and Gh-stimulated igf2, decreased Gh-stimulated igf1, and decreased ghr mRNA levels. Dex increased igf2, igfbp1, and ghr mRNA levels, but strongly decreased Gh-stimulated igf1 mRNA levels. These considerations suggest that most of the effects found in this study cannot be due to nonspecific improvements in cell health due to hormonal treatment.
In conclusion, this study shows that metabolic hormones strongly regulate both basal and Gh-stimulated igf2 mRNA levels in salmon primary hepatocytes. This level of regulation suggests that liver-derived endocrine Igf2 must play a significant role in salmon growth regulation. Insulin strongly synergized with Gh to stimulate igf2, and this effect was found at low concentrations of insulin. This suggests that insulin is a major positive regulator of liver Igf2 production in salmon via enhancement of the effect of Gh, which is similar to the way liver Igf1 production is regulated in tetrapods. However, insulin suppresses hepatocyte ghr mRNA levels, suggesting that enhancement of Gh sensitivity in terms of igf2 gene expression may occur downstream from Ghr (Pierce et al. 2005a). In combination with our previous studies (Pierce et al. 2004, 2005a), our findings suggest that liver Igf1 and Igf2 production is differentially regulated by insulin, glucocorticoids, glucagon, and thyroid hormones in salmon. This suggests that differential effects of the two Igfs may exist. All our data are at the level of igf2 gene expression in vitro. It will be necessary to confirm these findings at the level of protein secretion and circulating Igf2 in vivo. However, as far as it is known, Igf2 is constitutively secreted; gene expression and secreted protein levels correlate well in mammalian hepatocyte culture studies (Goya et al. 1999, 2001), and liver igf2 gene expression and Igf2 production drive circulating levels in vivo (Humbel 1990).
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This project was supported by National Research Initiative Competitive Grant nos 2003-35206-13631 and 2006-35206-16647 from the USDA Cooperative State Research, Education, and Extension service. Support was also provided by fellowships from the University of Washington School of Aquatic and Fishery Sciences.
Author contribution statement
ALP and WWD designed the studies, analyzed the results, and wrote the manuscript. ALP conducted the cell culture experiments and qPCR assays. PS provided native salmon Gh. JTD designed the igf2 qPCR and managed the laboratory. LF ran qPCR assays. PS and WWD provided funding, laboratory facilities, reagents, and project oversight.
Acknowledgements
We thank Dr Brian Beckman of the NMFS Montlake Physiology group for providing the fishes used in this study, and Paul Parkins and Abby Tillotson of NMFS for fish care. Fishes used in this study were raised from eggs provided by the Issaquah Salmon Hatchery run by the State of Washington Department of Fish and Wildlife. We thank the NMFS Montlake Microbiology group for the use of cell culture facilities. We thank Victoria Seely, Terrance Plumb, and Ron Wilson for providing housing for the first author during the final portions of the study.
References
Ayson FG, de Jesus-Ayson EG & Takemura A 2007 mRNA expression patterns for GH, PRL, SL, IGF-I and IGF-II during altered feeding status in rabbitfish, Siganus guttatus. General and Comparative Endocrinology 150 196–204.
Boni-Schnetzler M, Schmid C, Meier PJ & Froesch ER 1991 Insulin regulates insulin-like growth factor I mRNA in rat hepatocytes. American Journal of Physiology 260 E846–E851.
Butler ST, Marr AL, Pelton SH, Radcliff RP, Lucy MC & Butler WR 2003 Insulin restores GH responsiveness during lactation-induced negative energy balance in dairy cattle: effects on expression of IGF-I and GH receptor 1A. Journal of Endocrinology 176 205–217.
Campbell B, Dickey J, Beckman B, Young G, Pierce A, Fukada H & Swanson P 2006 Previtellogenic oocyte growth in salmon: relationships among body growth, plasma insulin-like growth factor-1, estradiol-17beta, follicle-stimulating hormone and expression of ovarian genes for insulin-like growth factors, steroidogenic-acute regulatory protein and receptors for gonadotropins, growth hormone, and somatolactin. Biology of Reproduction 75 34–44.
Carnevali O, Cardinali M, Maradonna F, Parisi M, Olivotto I, Polzonetti-Magni AM, Mosconi G & Funkenstein B 2005 Hormonal regulation of hepatic IGF-I and IGF-II gene expression in the marine teleost Sparus aurata. Molecular Reproduction and Development 71 12–18.
Chao W & D'Amore PA 2008 IGF2: epigenetic regulation and role in development and disease. Cytokine and Growth Factor Reviews 19 111–120.
Devlin RH, Sakhrani D, Tymchuk WE, Rise ML & Goh B 2009 Domestication and growth hormone transgenesis cause similar changes in gene expression in coho salmon (Oncorhynchus kisutch). PNAS 106 3047–3052.
Duan C, Hanzawa N, Takeuchi Y, Hamada E, Miyachi S & Hirano T 1993 Use of primary cultures of salmon hepatocytes for the study of hormonal regulation of insulin-like growth factor I expression in vitro. Zoological Science 10 473–480.
Duguay SJ, Lai-Zhang J, Steiner DF, Funkenstein B & Chan SJ 1996 Developmental and tissue-regulated expression of IGF-I and IGF-II mRNAs in Sparus aurata. Journal of Molecular Endocrinology 16 123–132.
Efstratiadis A 1998 Genetics of mouse growth. International Journal of Developmental Biology 42 955–976.
Folmar LC & Dickhoff WW 1980 The parr-smolt transformation (smoltification) and seawater adaptation in salmonids. Aquaculture 21 1–37.
Gabillard JC, Kamangar BB & Montserrat N 2006 Coordinated regulation of the GH/IGF system genes during refeeding in rainbow trout (Oncorhynchus mykiss). Journal of Endocrinology 191 15–24.
Gahr SA, Vallejo RL, Weber GM, Shepherd BS, Silverstein JT & Rexroad CE III 2008 Effects of short-term growth hormone treatment on liver and muscle transcriptomes in rainbow trout (Oncorhynchus mykiss). Physiological Genomics 32 380–392.
Gomez JM, Boujard T, Fostier A & Le Bail PY 1996 Characterization of growth hormone nycthemeral plasma profiles in catheterized rainbow trout (Oncorhynchus mykiss). Journal of Experimental Zoology 274 171–180.
Goya L, de la Puente A, Ramos S, Martin MA, Escriva F & Pascual-Leone AM 1999 Regulation of insulin-like growth factor-I and -II by glucose in primary cultures of fetal rat hepatocytes. Journal of Biological Chemistry 274 24633–24640.
Goya L, de la Puente A, Ramos S, Martin MA, Escriva F, Alvarez C & Pascual-Leone AM 2001 Regulation of IGF-I and -II by insulin in primary cultures of fetal rat hepatocytes. Endocrinology 142 5089–5096.
Griffen SC, Russell SM, Katz LS & Nicoll CS 1987 Insulin exerts metabolic and growth-promoting effects by a direct action on the liver in vivo: clarification of the functional significance of the portal vascular link between the beta cells of the pancreatic islets and the liver. PNAS 84 7300–7304.
Holly JMP 1998 Editorial: the IGF-II enigma. Growth Hormone and IGF Research 8 183–184.
Houston B & O'Neill IE 1991 Insulin and growth hormone act synergistically to stimulate insulin-like growth factor-I production by cultured chicken hepatocytes. Journal of Endocrinology 128 389–393.
Humbel RE 1990 Insulin-like growth factors I and II. European Journal of Biochemistry 190 445–462.
Kajimura S, Hirano T, Visitacion N, Moriyama S, Aida K & Grau EG 2003 Dual mode of cortisol action on GH/IGF-I/IGF binding proteins in the tilapia, Oreochromis mossambicus. Journal of Endocrinology 178 91–99.
Kelley KM, Schmidt KE, Berg L, Sak K, Galima MM, Gillespie C, Balogh L, Hawayek A, Reyes JA & Jamison M 2002 Comparative endocrinology of the insulin-like growth factor-binding protein. Journal of Endocrinology 175 3–18.
Leung LY, Kwong AK, Man AK & Woo NY 2008 Direct actions of cortisol, thyroxine and growth hormone on IGF-I mRNA expression in sea bream hepatocytes. Comparative Biochemistry and Physiology 151A 705–710.
Mommsen TP, Vijayan MM & Moon TW 1999 Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Reviews in Fish Biology and Fisheries 9 211–268.
Moriyama S, Yamaguchi K, Takasawa T, Chiba H & Kawauchi H 2006 Insulin-like growth factor I of Japanese eel, Anguilla japonica: cDNA cloning, tissue distribution, and expression after treatment with growth hormone and seawater acclimation. Fish Physiology and Biochemistry 32 189–201.
Moriyama S, Yamaguchi K, Takasawa T, Chiba H & Kawauchi H 2008 Identification of two insulin-like growth factor IIs in the Japanese eel, Anguilla japonica: cloning, tissue distribution, and expression after growth hormone treatment and seawater acclimation. Comparative Biochemistry and Physiology 149B 47–57.
Navarro I, Capilla E, Castillo J, Albalat A, Diaz M, Gallardo MA, Blasco J, Planas JV & Gutierrez J 2006 Insulin metabolic effects in fish tissues. In Fish Endocrinology, pp 15–48. Eds Reinecke M, Zaccone G, Kapoor BG. Enfield, NH: Science Publishers.
Norris DO & Hobbs SL 2006 The HPA axis and functions of corticosteroids in fishes. In Fish Endocrinology, pp 721–766. Eds Reinecke M, Zaccone G, Kapoor BG. Enfield, NH: Science Publishers.
Peterson BC, Waldbieser GC & Bilodeau L 2004 IGF-I and IGF-II mRNA expression in slow and fast growing families of USDA103 channel catfish (Ictalurus punctatus). Comparative Biochemistry and Physiology 139A 317–323.
Peterson BC, Waldbieser GC & Bilodeau L 2005 Effects of recombinant bovine somatotropin on growth and abundance of mRNA for IGF-I and IGF-II in channel catfish (Ictalurus punctatus). Journal of Animal Science 83 816–824.
Phillips LS, Goldstein S & Pao CI 1991 Nutrition and somatomedin. XXVI. Molecular regulation of IGF-I by insulin in cultured rat hepatocytes. Diabetes 40 1525–1530.
Picha ME, Turano MJ, Beckman BR & Borski RJ 2008a Endocrine biomarkers of growth and applications to aquaculture: a minireview of growth hormone, insulin-like growth factor (IGF)-I, and IGF-binding proteins as potential growth indicators in fish. North American Journal of Aquaculture 70 196–211.
Picha ME, Turano MJ, Tipsmark CK & Borski RJ 2008b Regulation of endocrine and paracrine sources of Igfs and Gh receptor during compensatory growth in hybrid striped bass (Morone chrysops X Morone saxatilis). Journal of Endocrinology 199 81–94.
Pierce AL, Dickey JT, Larsen DA, Fukada H, Swanson P & Dickhoff WW 2004 A quantitative real-time RT-PCR assay for salmon IGF-I mRNA, and its application in the study of GH regulation of IGF-I gene expression in primary culture of salmon hepatocytes. General and Comparative Endocrinology 135 401–411.
Pierce AL, Fukada H & Dickhoff WW 2005a Metabolic hormones modulate the effect of growth hormone (GH) on insulin-like growth factor-I (IGF-I) mRNA level in primary culture of salmon hepatocytes. Journal of Endocrinology 184 341–349.
Pierce AL, Shimizu M, Beckman BR, Baker DM & Dickhoff WW 2005b Time course of the GH/IGF axis response to fasting and increased ration in chinook salmon (Oncorhynchus tshawytscha). General and Comparative Endocrinology 140 192–202.
Pierce AL, Shimizu M, Felli L, Swanson P & Dickhoff WW 2006 Metabolic hormones regulate insulin-like growth factor binding protein-1 mRNA levels in primary cultured salmon hepatocytes; lack of inhibition by insulin. Journal of Endocrinology 191 379–386.
Plisetskaya EM & Mommsen TP 1996 Glucagon and glucagon-like peptides in fishes. International Review of Cytology 168 187–257.
Plisetskaya EM & Sullivan CV 1989 Pancreatic and thyroid hormones in rainbow trout (Salmo gairdneri): what concentration does the liver see? General and Comparative Endocrinology 75 310–315.
Ponce M, Infante C, Funes V & Manchado M 2008 Molecular characterization and gene expression analysis of insulin-like growth factors I and II in the redbanded seabream, Pagrus auriga: transcriptional regulation by growth hormone. Comparative Biochemistry and Physiology 150B 418–426.
Reinecke M, Bjornsson BT, Dickhoff WW, McCormick SD, Navarro I, Power DM & Gutierrez J 2005 Growth hormone and insulin-like growth factors in fish: where we are and where to go. General and Comparative Endocrinology 142 20–24.
Rodgers BD 1996 Catabolic hormones and growth hormone resistance in acquired immunodeficiency syndrome and other catabolic states. Proceedings of the Society for Experimental Biology and Medicine 212 324–331.
Schmid AC, Reinecke M & Kloas W 2000 Primary cultured hepatocytes of the bony fish, Oreochromis mossambicus, the tilapia: a valid tool for physiological studies on IGF-I expression in liver. Journal of Endocrinology 166 265–273.
Schmid AC, Lutz I, Kloas W & Reinecke M 2003 Thyroid hormone stimulates hepatic IGF-I mRNA expression in a bony fish, the tilapia Oreochromis mossambicus, in vitro and in vivo. General and Comparative Endocrinology 130 129–134.
Shamblott MJ, Cheng CM, Bolt D & Chen TT 1995 Appearance of insulin-like growth factor mRNA in the liver and pyloric ceca of a teleost in response to exogenous growth hormone. PNAS 92 6943–6946.
Shimizu M, Cooper KA, Dickhoff WW & Beckman BR 2009 Postprandial changes in plasma growth hormone, insulin, insulin-like growth factor (IGF)-I, and IGF-binding proteins in coho salmon fasted for varying periods. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 297 R352–R361.
Stewart CE & Rotwein P 1996 Growth, differentiation, and survival: multiple physiological functions for insulin-like growth factors. Physiological Reviews 76 1005–1026.
Stratikopoulos E, Szabolcs M, Dragatsis I, Klinakis A & Efstratiadis A 2008 The hormonal action of IGF1 in postnatal mouse growth. PNAS 105 19378–19383.
Terova G, Rimoldi S, Chini V, Gornati R, Bernardini G & Saroglia M 2007 Cloning and expression analysis of insulin-like growth factor I and II in liver and muscle of sea bass (Dicentrarchus labrax, L.) during long-term fasting and refeeding. Journal of Fish Biology 70 219–233.
Thissen JP, Ketelslegers JM & Underwood LE 1994 Nutritional regulation of the insulin-like growth factors. Endocrine Reviews 15 80–101.
Tollet P, Enberg B & Mode A 1990 Growth hormone (GH) regulation of cytochrome P-450IIC12, insulin-like growth factor-I (IGF-I), and GH receptor messenger RNA expression in primary rat hepatocytes: a hormonal interplay with insulin, IGF-I, and thyroid hormone. Molecular Endocrinology 4 1934–1942.
Tse MC, Vong QP, Cheng CH & Chan KM 2002 PCR-cloning and gene expression studies in common carp (Cyprinus carpio) insulin-like growth factor-II. Biochimica et Biophysica Acta 1575 63–74.
Vong QP, Chan KM & Cheng CH 2003 Quantification of common carp (Cyprinus carpio) IGF-I and IGF-II mRNA by real-time PCR: differential regulation of expression by GH. Journal of Endocrinology 178 513–521.
Wilkinson RJ, Porter M, Woolcott H, Longland R & Carragher JF 2006 Effects of aquaculture related stressors and nutritional restriction on circulating growth factors (GH, IGF-I and IGF-II) in Atlantic salmon and rainbow trout. Comparative Biochemistry and Physiology 145 214–224.
Wood AW, Duan C & Bern HA 2005 Insulin-like growth factor signaling in fish. International Review of Cytology 243 215–285.
