Abstract
Thyroid hormone receptor (TR) and liver X-receptor (LXR) are the master regulators of lipid metabolism. Remarkably, a mouse with a targeted deletion of both LXRα and LXRβ is resistant to western diet-induced obesity, and exhibits ectopic liver expression of the thyroid hormone activating type 2 deiodinase (D2). We hypothesized that LXR/retinoid X-receptor (RXR) signaling inhibits hepatic D2 expression, and studied this using a luciferase reporter containing the human DIO2 (hDIO2) promoter in HepG2 cells. Given that, in contrast to mammals, the chicken liver normally expresses D2, the chicken DIO2 (cDIO2) promoter was also studied. 22(R)-OH-cholesterol negatively regulated hDIO2 in a dose-dependent manner (100 μM, approximately twofold), while it failed to affect the cDIO2 promoter. Truncations in the hDIO2 promoter identified the region −901 to −584 bp as critical for negative regulation. We also investigated if 9-cis retinoic acid (9-cis RA), the ligand for the heterodimeric partner of TR and LXR, RXR, could regulate the hDIO2 promoter. Notably, 9-cis RA repressed the hDIO2 luciferase reporter (1 μM, approximately fourfold) in a dose-dependent manner, while coexpression of an inactive mutant RXR abolished this effect. However, it is unlikely that RXR homodimers mediate the repression of hDIO2 since mutagenesis of a DR-1 at −506 bp did not interfere with 9-cis RA-mediated repression. Our data indicate that hDIO2 transcription is negatively regulated by both 22(R)-OH-cholesterol and 9-cis RA, which is consistent with LXR/RXR involvement. In vivo, the inhibition of D2-mediated tri-iodothyronine (T3) production by cholesterol/9-cis RA could function as a feedback loop, given that T3 decreases hepatic cholesterol levels.
Introduction
Thyroid hormone receptor (TR) and liver X-receptors (LXRs) are the key regulators of lipid metabolism. Both these receptors prefer to bind to a direct repeat of the consensus DNA-binding site separated by a 4 bp spacing (DR-4), and thus can coordinately regulate gene expression through this motif (Wu & Koenig 2000, Kalaany & Mangelsdorf 2006). LXR can be activated by cholesterol, while tri-iodothyronine (T3) binding to TR has profound effects on the expression profile of thyroid hormone-dependent genes. Both the receptors can heterodimerize with retinoid X-receptor (RXR), and thus their signaling is also regulated by 9-cis retinoic acid (9-cis RA; Glass 1994, Willy et al. 1995, Castillo et al. 2004).
The DIO2 gene encodes type 2 deiodinase (D2), a tightly regulated oxidoreductase selenoenzyme that catalyzes thyroid hormone activation by converting thyroxine (T4) to T3, thus generating ligand for TR (Gereben et al. 2008). Remarkably, a mouse with a targeted disruption of LXRα and LXRβ (double LXR knockout (KO) mice) is resistant to western diet-induced obesity, and exhibits ectopic liver expression of D2 accompanied by increased expression of T3 target genes involved in fatty acid utilization (Kalaany et al. 2005). In this model, hepatic induction of D2 expression in LXR KO mice was dependent on dietary cholesterol, but not on SREBP-1c-mediated lipogenic pathways. Furthermore, it has been demonstrated that bile acids, the principal products of cholesterol catabolism, prevent obesity in wild-type mice, but not in D2 KO mice, by indirectly increasing D2 expression via the G-protein-coupled receptor TGR5 (GPBAR1; Watanabe et al. 2006).
The molecular links between cholesterol and D2-catalyzed thyroid hormone activation are presently unclear. We hypothesized that the LXR/RXR signaling pathways inhibit hepatic D2 expression in mammals. In order to better understand the regulation of fat metabolism, we investigated the effect of the LXR/RXR pathway on D2 expression by characterizing the response of human DIO2 (hDIO2) promoter to both 22(R)-OH-cholesterol/LXR and 9-cis RA/RXR pathways in human hepatic HepG2 cells. Notably, while D2 is not normally expressed in the mammalian liver (Croteau et al. 1996), it is expressed in the chicken (Gereben et al. 1999). Given this contrast, we also cloned the chicken DIO2 (cDIO2) promoter, and studied its responsiveness to the LXR/RXR signaling pathways. Our results indicate that the hDIO2 promoter is potently down-regulated at the transcriptional level by both LXR and RXR ligands, while in contrast, the cDIO2 promoter is unaffected by 22(R)-OH-cholesterol treatment.
Materials and Methods
Cell culture and transfection
HepG2 cells of human hepatoma origin were maintained under standard conditions in DMEM supplemented with 10% FBS. To remove lipids for experiments with 22(R)-OH-cholesterol (Sigma), serum was double stripped as described (Larsen et al. 1986). The concentration of 22(R)-OH-cholesterol and 9-cis RA (Sigma) used in the treatments is described in the legends, and treatments were performed for at least 20 h. The vehicles for 22(R)-OH-cholesterol and 9-cis RA were ethanol and DMSO respectively. Transient transfection was performed using Lipofectamine (Invitrogen) according to the manufacturer's instructions.
Constructs and mutagenesis
The human RXRα and LXRβ expression vectors were described earlier (Seol et al. 1995). The human RXRαΔ19C mutant lacks the last 19 amino acids (aa 444–462) and the AF-2 region, but retains heterodimerization (Zavacki et al. 1997). The 6.9 kb 5′ flanking region (FR) hDIO2 luciferase promoter constructs and their truncated forms were described previously (Zeold et al. 2006). PCR-based site-directed mutagenesis was used to mutate the DR-1 site in the hDIO2 5′FR. In short, overlapping PCR was used to generate the mutant cassette that was inserted between the PacI/NheI sites of the 6.9 kb 5′ FR hDIO2 luciferase constructs.
Cloning of the cDIO2 promoter
The GenBank no. AF125575 chicken D2 RNA sequence (Gereben et al. 1999) was aligned to the chicken genomic sequence to locate the DIO2 promoter in the chicken genome with DIO2 being identified on chromosome #5. A ∼5.7 kb cDIO2 5′ FR fragment was isolated using the Expand Long Template PCR System (Roche) with chicken genomic DNA as the template, and it was cloned into pGemT vector. A ∼3.6 kb cDIO2 5′FR was amplified on this template using the same kit and the following oligonucleotides: sense, TGCACTGTGGATAATCCATCCAGGTACCACTCT; antisense, GTTTTAGCTTGCTTCCTTGAAGCCTTTTATACATTC. The resulting fragment was cloned between the KpnI and Klenow blunted NheI sites of the pGL3-basic vector, and was confirmed by sequencing (Promega).
Promoter studies
Promoter studies using a luciferase reporter were performed as described previously (Fekete et al. 2004, Zeold et al. 2006). As internal controls, hGH and Renilla expression vectors (phRL-hβactin-213+932) were used (Gereben et al. 2001, Zeold et al. 2006, Doleschall et al. 2007). The CRE was induced with the coexpression of the α-catalytic subunit of protein kinase A (PKA; Maurer 1989) as described (Gereben et al. 2001). Luciferase activity was determined using the Dual-Luciferase Reporter Assay System (Promega). Where indicated, an empty CDM8 expression vector was used in the control transfections. The results are expressed as Luciferase/hGH or Luciferase/Renilla ratios.
Statistical analysis
Results are presented as means±s.d. Analysis was statistically preformed using an unpaired t-test, or one-way ANOVA followed by Newman–Keuls post hoc testing when multiple comparisons were made. P<0.05 was considered statistically significant.
Results
Treatment with 22(R)-OH-cholesterol and 9-cis RA negatively regulated the hDIO2 promoter in HepG2 cells transfected with LXRβ and RXRα in a dose-dependent manner with approximately twofold suppression of transcriptional activity at a dose of 100 and 1 μM respectively (Fig. 1A). Treatment with 22(R)-OH-cholesterol alone in LXRβ-transfected HepG2 cells caused a similar effect (Fig. 1B). In contrast, a 3×DR-4 binding site containing luciferase promoter control construct was induced under similar conditions in the presence of only LXRβ by approximately threefold, while coexpression of LXRβ and RXRα induced the control by approximately fourfold (Fig. 1C). In the control experiments, we also tested the responsiveness of a pGL3-basic construct containing 880 bp of the mouse type 1 deiodinase (D1) promoter to 22(R)-OH-cholesterol and no change was observed, further confirming the specificity of this repression of the hDIO2 promoter (data not shown).
Cholesterol negatively regulates hDIO2 in a dose–responsive manner. (A) HepG2 cells were transiently transfected with 6.9 kb 5′FR-hDIO2-Luc and 10 ng RXRα and treated with 1 μM 9-cis retinoic acid in the presence or absence of 10 ng LXRβ. (B) HepG2 cells were transiently transfected with 6.9 kb 5′FR-hDIO2-Luc, 10 ng LXRβ, and 10 ng PKA. (C) Induction of a 3×DR-4-Luc-positive control construct in the presence of 22(R)-OH-cholesterol. Luc/hGH ratios are shown as arbitrary units (a.u). Experiments were repeated at least three times. Mean±s.d.; *P<0.001, **P<0.01, and ***P<0.05 versus vehicle by ANOVA followed by the Newman–Keuls post hoc test; #P<0.001 versus vehicle by t-test.
Citation: Journal of Endocrinology 205, 2; 10.1677/JOE-09-0448
Based on the markedly different hepatic expression of the human and chicken D2, we also cloned the cDIO2 promoter and tested its response to 22(R)-OH-cholesterol in the presence of LXRβ. The sequence of the cloned cDIO2 5′FR fragment has a low homology to hDIO2, and only the proximal ∼160 bp can be aligned. However, this portion has both a putative CRE and a TATA box in the same position as the human promoter (Fig. 2A). Strikingly, coexpression of the cDIO2 promoter with PKA resulted in ∼10-fold increase in promoter activity, but 22(R)-OH-cholesterol treatment in the presence of LXRβ did not suppress the promoter either with or without PKA coexpression (Fig. 2B).
Cholesterol does not affect the chicken DIO2 promoter. (A) Sequence alignment of the proximal region of the cDIO2 and hDIO2 5′ flanking regions with the CRE and the TATA box is shown in bold. (B) HepG2 cells were transiently transfected with 3.6 kb 5′FR-cDIO2-Luc and 10 ng LXRβ. Ten nanograms of PKA were used to induce basal promoter activity as indicated, while PKA-uninduced cultures received CDM8. Luc/hGH ratios are shown as arbitrary units. Experiments were repeated three times, mean±s.d.
Citation: Journal of Endocrinology 205, 2; 10.1677/JOE-09-0448
A series of truncations of the hDIO2 promoter were used to map the region necessary for negative regulation by LXRβ and cholesterol (Fig. 3). Deletion of the region at −117 bp to −3.9 kb resulted in a sharp decrease in the overall promoter activity and a loss of 22(R)-OH-cholesterol responsiveness, despite the presence of the putative DR-4 at −4616 bp. A combined deletion of the regions between −6.9 to −2.1 kb and −912 to −117 bp also resulted in a similar effect. The activity of a construct containing −901 bp of the DIO2 5′ FR was decreased by 22(R)-OH-cholesterol treatment, while a fragment containing −584 bp was unresponsive, indicating that the region between −584 and −901 bp plays an important role in the negative response to cholesterol.
Mapping of cholesterol-mediated suppression of the hDIO2 5′FR. HepG2 cells were transiently transfected with 6.9 kb 5′FR-hDIO2-Luc and its truncated forms as indicated along with 10 ng LXR. Luc/hGH ratios are shown as arbitrary units. Experiments were repeated three times. Mean±s.d.; *P<0.05 versus vehicle by t-test. The DR-1 at −506 bp (AGGACC t AGGTCA; indicated as ○ and DR-4 at −4616 bp (TGACTT tttt TGACCA; indicated as Δ) are putative, and were determined using NHR SCAN (Sandelin & Wasserman 2005) supplemented with manual analysis.
Citation: Journal of Endocrinology 205, 2; 10.1677/JOE-09-0448
We also studied whether 9-cis RA, the other ligand of LXR/RXR heterodimer, could also negatively regulate the hDIO2 promoter in a dose-dependent manner. One-micromolar 9-cis RA caused a approximately fourfold suppression of hDIO2 transcription both in the absence and in the presence of PKA-mediated CRE stimulation (Fig. 4A and B). However, coexpression of an inactive RXRα mutant completely abolished the suppressive effect of 9-cis RA on the hDIO2 promoter (Fig. 4C). In the control experiments, we also tested the response of the 880 bp mouse D1 promoter pGL3-basic construct to 9-cis RA, and no change was observed (data not shown).
9-cis Retinoic acid negatively regulates hDIO2 in a dose–responsive manner. HepG2 cells were transiently transfected with 6.9 kb 5′FR-hDIO2-Luc, empty CDM8 vector as a control, and (A) wild-type RXRα, (B) wild-type RXRα plus PKA, or (C) mutant RXRα plus PKA. Luc/hGH ratios are shown as arbitrary units. Experiments were repeated three times. Mean±s.d.; *P<0.01, **P<0.001 versus vehicle by ANOVA followed by the Newman–Keuls post hoc test.
Citation: Journal of Endocrinology 205, 2; 10.1677/JOE-09-0448
Site-directed mutagenesis of a putative DR-1 site at −506 bp in the 6.9 kb hDIO2 promoter construct did not interfere with the 9-cis RA-mediated suppression of hDIO2, suggesting that binding of a RXR homodimer at this site is not involved in this process (Fig. 5); however, we cannot rule out that signaling of RXR through another heterodimer complex is not involved. Deletion constructs containing −2.1 kb, −901 bp, and −584 bp of the hDIO2 promoter remained responsive to 9-cis RA-mediated suppression, although only the higher dose was effective. In addition, while the proximal −117 bp of the hDIO2 promoter had a low basal activity, this was suppressed by 9-cis RA treatment. Interestingly, 9-cis RA could also suppress the ∼3.5 kb cDIO2 promoter, although basal activity of this reporter construct was very low.
Effect of 9-cis retinoic acid on the suppression of the DIO2 5′FR. HepG2 cells were transiently transfected with the 5′FR-hDIO2-Luc deletion constructs and cdio2-Luc along with 200 ng RXRα as indicated. A putative DR-1 (indicated as ○) was mutated for Att ACC TA tt TCA, while the putative DR-4 is shown as Δ. Luc/Renilla ratios are shown as arbitrary units. Experiments were repeated four times. Mean±s.d.; *P<0.05 versus vehicle by ANOVA followed by the Newman–Keuls post hoc test; **P<0.01 versus vehicle; and ***P<0.001 versus vehicle.
Citation: Journal of Endocrinology 205, 2; 10.1677/JOE-09-0448
Discussion
The LXR/FXR/TGR5 system plays a key role in both the maintenance of cholesterol and lipid homeostasis (Houten et al. 2006, Kalaany & Mangelsdorf 2006). LXR and FXR coordinately regulate cholesterol and bile acid metabolism, with LXR being activated by oxysterols, while FXR is activated by the clearance products of cholesterol, bile acids. In addition, LXR also transcriptionally controls genes associated with hepatic lipogenesis including SREBP-1c, a key regulator of fatty acid and triglyceride synthesis. On the other hand, bile acids, acting through both FXR and TGR5, decrease trigylceride levels through a variety of mechanisms including the repression of SREBP-1c expression and modulation of fatty acid uptake and β-oxidation (Houten et al. 2006, Kalaany & Mangelsdorf 2006).
Thyroid hormones also play a crucial role in the regulation of body composition and lipid homeostasis (Baxter & Webb 2009). Recently, it has emerged that a key point in thyroid hormone action is the local generation of thyroid hormone by T4 to T3 conversion by D2 (Gereben et al. 2008). Thus, it is not surprising that local T3 generation by D2 can also be modulated by regulators of fat metabolism. Bile acids, via TGR5, have been shown to up-regulate D2 expression in brown adipose tissue, leading to resistance to diet-induced obesity (Watanabe et al. 2006). In addition, the double LXR KO mouse is resistant to western diet-induced obesity, and exhibits ectopic liver expression of D2 (Kalaany et al. 2005). Taken together as a whole, this suggests that bile acid-mediated pathways act to promote pathways associated with lipolysis, which would include the T3-generating D2. In contrast, sterols via LXR would promote lipogenesis and the down-regulation of factors such as D2.
To test this hypothesis, we investigated whether D2 was negatively regulated by the LXR/RXR pathway in HepG2 cells. The human LXRα and LXRβ share almost 80% amino acid identity in their DNA-binding domain and ligand-binding domain (Zhao & Dahlman-Wright 2010). In these studies, we used LXRβ, which is the more ubiquitously expressed LXR isoform (Annicotte et al. 2004).
When cells were cotransfected with LXRβ, treatment with 22(R)-OH-cholesterol negatively regulated the hDIO2 promoter in HepG2 cells in a dose-dependent manner with a approximately twofold suppression of transcriptional activity at 100 μM (Fig. 1A and B). While sequence analysis identified a putative DR-4 at −4616 bp of hDIO2 promoter that showed significant similarity to the LXR response element of ATP-binding cassette subfamily G member 1 (Varga & Su 2007), deletion of this element demonstrated that this DR-4 is not involved in the suppression of hDIO2 (Fig. 3). Notably, it has been recently shown that LXR response elements could be more diverse than previously thought and beyond the classical DR-4, and that DR-1 and inverted repeat 1 motifs may also bind to LXR (Varga & Su 2007). Deletion mapping further localized this negative regulation by 22(R)-OH-cholesterol to a region between −901 and −584 bp of the hDIO2 promoter, although no obvious LXR-consensus binding sequences could be identified in this region (Fig. 3). Although this region contains a functional binding site for the homeodomain-containing transcription factor TTF1/Nkx2.1 (−619 to −627; Gereben et al. 2001), it is presently not clear how Nkx2.1 could be involved in the demonstrated mechanism.
While numerous LXR target genes have been identified, our knowledge of LXR-suppressed genes is still rather limited (Baranowski 2008). It is known that LXR activation down-regulates hepatic enzymes essential for gluconeogenesis including phosphoenolpyruvate carboxykinase, fructose-1,6-bisphosphatase, and glucose-6-phosphatase (Stulnig et al. 2002). In the murine intestine, LXR agonists decreased the expression of Niemann-Pick C1-like 1 protein, a critical player of intestinal cholesterol absorption (Duval et al. 2006). To our knowledge, the negative regulation of the hDIO2 gene represents the first link between T3 generation and LXR/RXR signaling.
In the liver, D1 is expressed abundantly, but due to its high Km for T4, its contribution to circulating T3 in euthyroid humans is considered to be minimal (Maia et al. 2005). It has also been suggested that hepatic D1 might contribute to local T3 generation in the liver (St Germain et al. 2009), and thus the local regulation of the DIO1 gene via the LXR/RXR pathway could be important. However, we did not find any evidence in HepG2 cells that the DIO1 gene could be regulated via this pathway.
While the hDIO2 promoter was down-regulated by the LXR/22(R)-OH-cholesterol pathway (Fig. 1A and B), this suppression was not observed with the cDIO2 promoter (Fig. 2B). This finding is in accordance with observations that D2 is not normally expressed in the mammalian liver (Croteau et al. 1996), while the chicken liver has D2 expression and activity (Gereben et al. 1999). Although the cDIO2 5′ promoter fragment that was tested was shorter than the hDIO2 promoter (3.7 vs 6.9 kb of 5′ FR), the 22(R)-OH-cholesterol-responsive region in the hDIO2 promoter was mapped between −901 and −584 bp, which would also have been included in the 3.7 kb cDIO2 reporter construct. In both chickens and humans, the liver is the major site of cholesterol synthesis (Hermier 1997), and thus further studies will be required to elucidate the potential physiological consequences of the differential sensitivity of the two DIO2 promoters to 22(R)-OH-cholesterol-mediated repression between these species.
LXR/RXR forms a ‘permissive heterodimer’ that can be independently activated by ligands of either heterodimerization partner (Willy et al. 1995). We also demonstrated that the RXR/9-cis RA pathway strongly represses the hDIO2 promoter in HepG2 cells (Fig. 4). This is in agreement with previous findings that the RXR-specific retinoid LG268 suppressed D2 expression in the mouse pituitary and the TαT1 cell line (Sharma et al. 2006). However, we were unable to clearly define the region responsible for the negative regulation of the hDIO2 promoter using deletion mapping, since despite a drastic loss of basal activity, a construct containing −117 bp of the hDIO2 promoter was still repressed by 9-cis RA treatment unlike the pGL3-basic backbone vector. Furthermore, mutagenesis of a putative DR-1-binding site at −506 site in hDIO2 promoter did not interfere with 9-cis RA-mediated suppression, indicating that either this site is not functional, or RXR homodimers, which prefer the DR-1 motif, are not involved in the observed suppression (Fig. 5). Notably, while the cDIO2 promoter could not be suppressed with 22(R)-OH-cholesterol, its expression was decreased with 9-cis RA (Figs 3 and 5). Taken together, our data with regard to both deletion mapping of the 22(R)-OH-cholesterol and 9-cis RA and the responsiveness of the hDIO2 and cDIO2 promoters, and the fact that 22(R)-OH-cholesterol will only repress the hDIO2 promoter but not the cDIO2 promoter while both are negatively regulated by 9-cis RA, might suggest that these two modes of repression are independent of one another.
Both the mammalian (Gereben & Salvatore 2005) and the cDIO2 5′FRs are cAMP sensitive (Fig. 2). A cross-talk between the LXR- and cAMP-mediated gene expression has been suggested (Kalaany & Mangelsdorf 2006). However, we did not find any evidence that the effects of the LXR/RXR pathway on DIO2 expression were modulated by PKA (Figs 1B, 2B and 4B).
LXRβ expression is ubiquitous, leading to the conclusion that the suppression of D2-mediated T3 generation via LXR/RXR might not be confined to the liver. Further studies are required to understand the potential importance of this pathway in different tissues. For example, brain should be considered as an important target for future studies of this pathway based on the fundamental importance played by D2 in the brain T3 content (Gereben et al. 2008), and on the findings demonstrating cholesterol and RA synthesis in brain tissue (Wagner et al. 2002, Dietschy & Turley 2004). Furthermore, 22(R)-OH-cholesterol and 9-cis RA have also been shown to modulate specific LXR/RXR targets in the brain such as the ATP-binding cassette transporter A1 (Koldamova et al. 2003).
In conclusion, the hDIO2 promoter appears to be an LXR/RXR target gene, since it can be negatively regulated by either 22(R)-OH-cholesterol or 9-cis RA. Moreover, the repression of this promoter appeared to map to a region between −584 and −901 bp for 22(R)-OH-cholesterol and before −117 bp for 9-cis RA, although no classical binding sites with LXR/RXR heterodimers or RXR/RXR homodimers could be defined. Furthermore, these effects are independent of a known strong activator of DIO2 gene transcription, cAMP. Previous studies demonstrated that the LXR double KO mice on a western diet exhibit resistance to diet-induced obesity along with ectopic hepatic D2 expression; T3 decreases hepatic cholesterol levels, and CYP7a1, the rate-limiting enzyme in hepatic bile acid synthesis, is positively regulated by both LXR and TR (Lehmann et al. 1997, Gullberg et al. 2000). Taking these findings together, it can be speculated that in vivo the cholesterol/9-cis RA-mediated inhibition of D2-catalyzed T3 production could function as a negative feedback loop.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the Medical Research Council (ETT Grant 02-121/2009), Hungarian Research Fund Grant OTKA K81226, NIH DK65055 and NIH DK076117.
References
Annicotte JS, Schoonjans K & Auwerx J 2004 Expression of the liver X receptor alpha and beta in embryonic and adult mice. Anatomical Record. Part A, Discoveries in Molecular, Cellular, and Evolutionary Biology 277 312–316.
Baranowski M Biological role of liver X receptors Journal of Physiology and Pharmacology 59 Suppl 7 2008 31–55.
Baxter JD & Webb P 2009 Thyroid hormone mimetics: potential applications in atherosclerosis, obesity and type 2 diabetes. Nature Reviews. Drug Discovery 8 308–320.
Castillo AI, Sanchez-Martinez R, Moreno JL, Martinez-Iglesias OA, Palacios D & Aranda A 2004 A permissive retinoid X receptor/thyroid hormone receptor heterodimer allows stimulation of prolactin gene transcription by thyroid hormone and 9-cis-retinoic acid. Molecular and Cellular Biology 24 502–513.
Croteau W, Davey JC, Galton VA & St Germain DL 1996 Cloning of the mammalian type II iodothyronine deiodinase. A selenoprotein differentially expressed and regulated in human and rat brain and other tissues. Journal of Clinical Investigation 98 405–417.
Dietschy JM & Turley SD 2004 Thematic review series: brain lipids. Cholesterol metabolism in the central nervous system during early development and in the mature animal. Journal of Lipid Research 45 1375–1397.
Doleschall M, Mayer B, Cervenak J, Cervenak L & Kacskovics I 2007 Cloning, expression and characterization of the bovine p65 subunit of NFkappaB. Developmental and Comparative Immunology 31 945–961.
Duval C, Touche V, Tailleux A, Fruchart JC, Fievet C, Clavey V, Staels B & Lestavel S 2006 Niemann–Pick C1 like 1 gene expression is down-regulated by LXR activators in the intestine. Biochemical and Biophysical Research Communications 340 1259–1263.
Fekete C, Gereben B, Doleschall M, Harney JW, Dora JM, Bianco AC, Sarkar S, Liposits Z, Rand W & Emerson C et al. 2004 Lipopolysaccharide induces type 2 iodothyronine deiodinase in the mediobasal hypothalamus: implications for the nonthyroidal illness syndrome. Endocrinology 145 1649–1655.
Gereben B & Salvatore D 2005 Pretranslational regulation of type 2 deiodinase. Thyroid 15 855–864.
Gereben B, Bartha T, Tu HM, Harney JW, Rudas P & Larsen PR 1999 Cloning and expression of the chicken type 2 iodothyronine 5′- deiodinase. Journal of Biological Chemistry 274 13768–13776.
Gereben B, Salvatore D, Harney JW, Tu HM & Larsen PR 2001 The human, but not rat, dio2 gene is stimulated by thyroid transcription factor-1 (TTF-1). Molecular Endocrinology 15 112–124.
Gereben B, Zavacki AM, Ribich S, Kim BW, Huang SA, Simonides WS, Zeold A & Bianco AC 2008 Cellular and molecular basis of deiodinase-regulated thyroid hormone signaling. Endocrine Reviews 29 898–938.
Glass CK 1994 Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocrine Reviews 15 391–407.
Gullberg H, Rudling M, Forrest D, Angelin B & Vennstrom B 2000 Thyroid hormone receptor beta-deficient mice show complete loss of the normal cholesterol 7α-hydroxylase (CYP7A) response to thyroid hormone but display enhanced resistance to dietary cholesterol. Molecular Endocrinology 14 1739–1749.
Hermier D 1997 Lipoprotein metabolism and fattening in poultry. Journal of Nutrition 127 805S–808S.
Houten SM, Watanabe M & Auwerx J 2006 Endocrine functions of bile acids. EMBO Journal 25 1419–1425.
Kalaany NY & Mangelsdorf DJ 2006 LXRS and FXR: the yin and yang of cholesterol and fat metabolism. Annual Review of Physiology 68 159–191.
Kalaany NY, Gauthier KC, Zavacki AM, Mammen PP, Kitazume T, Peterson JA, Horton JD, Garry DJ, Bianco AC & Mangelsdorf DJ 2005 LXRs regulate the balance between fat storage and oxidation. Cell Metabolism 1 231–244.
Koldamova RP, Lefterov IM, Ikonomovic MD, Skoko J, Lefterov PI, Isanski BA, DeKosky ST & Lazo JS 2003 22R-hydroxycholesterol and 9-cis-retinoic acid induce ATP-binding cassette transporter A1 expression and cholesterol efflux in brain cells and decrease amyloid beta secretion. Journal of Biological Chemistry 278 13244–13256.
Larsen PR, Harney JW & Moore DD 1986 Sequences required for cell-type specific thyroid hormone regulation of rat growth hormone promoter activity. Journal of Biological Chemistry 261 14373–14376.
Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver BB, Su JL, Sundseth SS, Winegar DA, Blanchard DE & Spencer TA et al. 1997 Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. Journal of Biological Chemistry 272 3137–3140.
Maia AL, Kim BW, Huang SA, Harney JW & Larsen PR 2005 Type 2 iodothyronine deiodinase is the major source of plasma T3 in euthyroid humans. Journal of Clinical Investigation 115 2524–2533.
Maurer RA 1989 Both isoforms of the cAMP-dependent protein kinase catalytic subunit can activate transcription of the prolactin gene. Journal of Biological Chemistry 264 6870–6873.
Sandelin A & Wasserman WW 2005 Prediction of nuclear hormone receptor response elements. Molecular Endocrinology 19 595–606.
Seol W, Choi HS & Moore DD 1995 Isolation of proteins that interact specifically with the retinoid X receptor: two novel orphan receptors. Molecular Endocrinology 9 72–85.
Sharma V, Hays WR, Wood WM, Pugazhenthi U, St Germain DL, Bianco AC, Krezel W, Chambon P & Haugen BR 2006 Effects of rexinoids on thyrotrope function and the hypothalamic–pituitary–thyroid axis. Endocrinology 147 1438–1451.
St Germain DL, Galton VA & Hernandez A 2009 Minireview: defining the roles of the iodothyronine deiodinases: current concepts and challenges. Endocrinology 150 1097–1107.
Stulnig TM, Steffensen KR, Gao H, Reimers M, Dahlman-Wright K, Schuster GU & Gustafsson JA 2002 Novel roles of liver X receptors exposed by gene expression profiling in liver and adipose tissue. Molecular Pharmacology 62 1299–1305.
Varga G & Su C 2007 Classification and predictive modeling of liver X receptor response elements. BioDrugs 21 117–124.
Wagner E, Luo T & Drager UC 2002 Retinoic acid synthesis in the postnatal mouse brain marks distinct developmental stages and functional systems. Cerebral Cortex 12 1244–1253.
Watanabe M, Houten SM, Mataki C, Christoffolete MA, Kim BW, Sato H, Messaddeq N, Harney JW, Ezaki O & Kodama T et al. 2006 Bile acids induce energy expenditure by promoting intracellular thyroid hormone activation. Nature 439 484–489.
Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA & Mangelsdorf DJ 1995 LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes and Development 9 1033–1045.
Wu Y & Koenig RJ 2000 Gene regulation by thyroid hormone. Trends in Endocrinology and Metabolism 11 207–211.
Zavacki AM, Lehmann JM, Seol W, Willson TM, Kliewer SA & Moore DD 1997 Activation of the orphan receptor RIP14 by retinoids. PNAS 94 7909–7914.
Zeold A, Doleschall M, Haffner MC, Capelo LP, Menyhert J, Liposits Z, da Silva WS, Bianco AC, Kacskovics I & Fekete C et al. 2006 Characterization of the nuclear factor-kappa B responsiveness of the human dio2 gene. Endocrinology 147 4419–4429.
Zhao C & Dahlman-Wright K 2010 LXR in cholesterol metabolism. Journal of Endocrinology 204 233–240.
(M A Christoffolete and M Doleschall contributed equally to this work)
