Abstract
The growth-retarded (grt) mouse shows thyroid dysfunction-related hyporesponsiveness to TSH. Thyroid hormone is a critical regulator of metabolism in many cells; thus, derangement of thyroid function affects many organs and systems. Experiments were conducted focusing on the function of the pancreatic islets in grt mice. We showed occurrence of a fasting hyperglycemia and a decreased plasma insulin level response to a glucose load in grt mice, despite normal insulin molecules being stored in secretory granules of pancreatic islets. We also demonstrated a reduction of insulin secretion in response to glucose administration from islets of grt mice in vitro, while the insulin release in response to KCl stimulation was comparable to that in normal mice, indicating that the isolated islets from grt mice have normal ATP-sensitive K+ channels and postchannel activity. The mRNA expression levels of glucose transporter 2 and glucokinase in the islets of grt mice were similar to those in normal mice. Triiodothyronine administration to grt mice improved insulin secretion very slightly. On the other hand, mRNA for tyrosylprotein sulfotransferase 2 (Tpst2) was found to be expressed in the pancreatic islets of grt mice. Considering that Tpst2 is the responsible gene of grt mice, mutation of which is associated with a poor function of TSH receptor, the findings raise a possibility of involvement of factors including Tpst2 in the insulin hyposecretion in grt mice.
Introduction
The growth-retarded (grt) mouse was first reported as a mutant spontaneously derived from phenotypically normal siblings of the Snell's dwarf mouse (DW/J strain) with a characteristic growth pause followed by delayed onset of pubertal growth in contrast to dw mice (Yoshida et al. 1994). In grt mice, plasma concentrations of thyroxine (T4) are significantly lower, whereas levels of thyroid-stimulating hormone (TSH) are greatly elevated (Yoshida et al. 1994, Tomita et al. 1995, Kobayashi et al. 2001). The unresponsive nature of TSH receptors to TSH is considered to be attributable to dysfunction of the grt thyroid gland (Kobayashi et al. 2001, 2005). Recently, the grt phenotype has been shown to be caused by a single missense mutation in the tyrosylprotein sulfotransferase 2 (Tpst2) gene with a C-to-G transition at nucleotide 798, leading to replacement of a highly conserved histidine with glutamine at codon 266 in the sulfotransferase domain (Sasaki et al. 2007). Impaired tyrosine sulfation of TSH receptor molecules by inactivation of Tpst2 reduces responsiveness to TSH and causes the functional failure of grt mice thyroid (Sasaki et al. 2007).
Thyroid hormones play a fundamental role in the initiation and maintenance of somatic growth in mammalian species, and affect many aspects of metabolism. It has also been reported that insulin secretion is regulated by thyroid hormone (Cortizo et al. 1985, Doong et al. 1997), and that there is a relationship between serum thyroid hormone levels and diabetes risk (Iossa et al. 2001, Crunkhorn & Patti 2008). Hyperthyroidism reduces glucose tolerance in mammals, and the insulin-secretory capacity of the pancreatic islets is reduced by an excess of thyroid hormones (Lenzen & Bailey 1984). On the other hand, hypothyroidism is associated with deterioration of glucose metabolism, and this effect is accompanied by reduced plasma insulin concentrations but increased plasma glucagon concentrations (Handisurya et al. 2008). Thyroid hormone effects on glucose homeostasis and on endocrine function of the pancreas are the result of an interaction of the thyroid hormone with its receptors (Yen 2001). The consequences of hypothyroidism on these metabolic pathways seem to depend on the degree of reduction of circulating thyroid hormones (Mackowiak et al. 1999). To date, only a few studies have investigated the effect of thyroid dysfunction and its recovery by thyroid hormone treatment on glucose metabolism, and the results have been controversial (Dessein et al. 2004, Stanická et al. 2005, Brenta et al. 2007, Handisurya et al. 2008). It is not clear whether the glucose-induced insulin-secretory capacity is reduced in grt mice, and whether thyroid hormone replacement is effective for restoring the insulin secretion.
Impairment in glucose sensing contributes to pancreatic β-cell dysfunction. The glucose transporter 2 (GLUT2) and glucokinase (GK) are key molecules with a high Km for glucose transport and for glucose phosphorylation respectively, which affect various processes of glucose sensing in pancreatic β-cells (Matschinsky 1990). Glucose sensing is the initial event of glucose-stimulated insulin secretion. Therefore, it is necessary to maintain adequate expression levels of GLUT2 and GK to ensure normal β-cell function (Cerf 2007). The expression of GLUT2 and GK is under hormonal control. Triiodothyronine (T3) can modulate the expression of GLUT2 and GK mRNAs and proteins in pancreatic islets (García-Flores et al. 2001) and liver (Kemp et al. 1997). However, the effect of hypothyroidism on the expression of glucose sensors in pancreatic islets is unclear.
Experiments were conducted in order to provide further insight into the relationship between thyroid hormones and glucose homeostasis in hypothyroidal grt mice.
Materials and Methods
Animals
The mice were maintained under controlled temperature (23±1 °C), relative humidity (50±10%), and lighting (0800–2000 h) conditions at the animal facility at Saitama University (Saitama, Japan). A standard laboratory diet (Labo MR Breeder, Nosan, Yokohama, Japan) and tap water were made available ad libitum. Normal phenotype (+/+ or +/grt) and grt (grt/grt) male mice were obtained by mating wild (+/+) or heterozygous (+/grt) female mice with grt male mice. These mice were initially obtained as the offspring born to a pair of phenotypically normal siblings of DW/J strain mice and were distinguished on the basis of their body weights as described elsewhere (Yoshida et al. 1994). Animals were studied at 2–12 months of age, and all experimental procedures were performed in accordance with the Institutional Guidelines for Animal Care and Use of Saitama University.
Glucose tolerance test
Intraperitoneal glucose tolerance tests (IGTTs) were carried out on 3-month-old normal and grt mice that had been subjected to an overnight (24 h) fast. Glucose (1 mg/g body weight) was administered to mice via i.p. injection. Blood samples were collected by retro-orbital sinus puncture before (0 min) and 30, 60, 90, and 120 min after glucose administration. Blood glucose levels were determined using an automated blood glucose meter (Nipro Free Style Meter; NIPRO, Osaka, Japan). Plasma samples were obtained by centrifugation at 4 °C and were stored at −20 °C until analysis. Plasma insulin concentrations were determined using an ELISA (Morinaga Institute of Biological Science, Yokohama, Japan).
Insulin tolerance test
Bovine insulin (1 mU/g body weight; 26 U/mg; Wako, Osaka, Japan) was administered via i.p. injection to 3-month-old normal and grt mice. Blood samples were collected via retro-orbital sinus puncture. Blood glucose measurements were also carried out immediately before (0 min) and 15, 30, and 45 min after insulin injection using an automated blood glucose meter.
Islet isolation
Pancreatic islets were isolated from 6- to 8-month-old normal and grt mice, or from 3-month-old grt and T3-treated grt mice, by collagenase digestion, using the modified method of Lacy & Kostianovsky (1967) and Gotoh et al. (1985). Briefly, after the mouse was anesthetized using pentobarbital (0.063 mg/g body weight; Dainippon Sumitomo Pharma, Osaka, Japan), 0.1% collagenase type IV (Worthington Biochemical, Lakewood, NJ, USA), which was dissolved in Hanks' solution (Nissui Pharmaceutical, Tokyo, Japan), was injected into the pancreas via the bile duct. The pancreas was then removed and incubated for 30 min at 37 °C. The pancreas was then dispersed by injecting the mixture through a syringe and was washed in Hanks' balanced salts solution without calcium chloride (Sigma–Aldrich). Islets were handpicked under a stereomicroscope.
Immunohistochemical staining of pancreatic islets
Isolated islets were immunocytochemically characterized using the peroxidase/anti-peroxidase method as follows. Islets were fixed in 10% neutral buffered formaldehyde for 24 h and then placed in 70% ethanol. The islets were dehydrated in graded ethanol and embedded in paraffin. These sections (10 μm thick) were cut using a microtome (model 840; American Optical Corp., Buffalo, NY, USA) and mounted. Deparaffinized sections were hydrated in a series of graded ethanol solutions and 10 mM PBS (pH 7.4). The sections were incubated in a solution of 3% H2O2 (Wako) for 20 min to block endogenous peroxidase activity. After rinsing with PBS, the sections were treated with normal swine serum (1:20; Dako, Glostrup, Denmark) for 60 min at room temperature. The specimens were washed with PBS and were then incubated with guinea pig anti-insulin antibody (ready-to-use primary antibody; Dako; diluted 1:5) overnight at 4 °C to detect β-cells. Secondary antibodies (swine anti-rabbit IgG, 1:100; Dako) were incubated with the specimens for 90 min at room temperature, following which a rabbit peroxidase/anti-peroxidase complex (Dako) was added and incubated for 60 min at room temperature. The sections were rinsed in PBS, and peroxidase activity was visualized using 0.05% diaminobenzidine (Wako) in 0.1 M Tris–HCl (pH 7.4) containing 0.006% H2O2. The slides were counterstained with hematoxylin to visualize the nuclei. These sections were dehydrated through a graded series of ethanol, were cleared using xylene, coverslipped using Canada balsam (Wako), and were studied using conventional light microscopy.
Immunoelectron microscopy of pancreatic β-cells
For immunoelectron microscopy, pancreases of 3-month-old normal and grt mice were fixed with a mixture of 4% paraformaldehyde (Merck KGaA) and 0.5% glutaraldehyde (TAAB Laboratories Equipment, Berks, UK) in 0.1 M PBS (pH 7.4) for 48 h at 4 °C. The tissues were postfixed with a mixture of 1% osmium tetroxide (Merck) and 1.5% potassium ferrocyanide (Wako) in 0.1 M phosphate buffer (PB, pH 7.4) for 1 h at 4 °C. The tissues were then dehydrated through a graded ethanol series, placed in LR White resin (London Resin, Basingstoke, UK), embedded in the pure resin, and were then polymerized in gelatin capsules at 55 °C for 48 h. Ultrathin sections were cut using an ultra microtome (MT2-B; E.I. du Pont de Nemours & Company, Wilmington, DE, USA), were mounted on Formvar-coated nickel grids that had been cooled in a freezer (−20 °C), and were then preincubated with 1% BSA (Sigma) in 0.01 M PBS for 1 h. After washing in PBS, the sections were incubated with guinea pig anti-insulin antibody in 1% BSA–PBS (1:5) overnight at 4 °C. The sections were well washed with PBS, reacted with gold-labeled (10 nm) secondary antibody (1:20; British BioCell International, Cardiff, UK) for 2 h, and were then washed with PBS and distilled water. After air drying, the sections were double stained with saturated aqueous uranyl acetate (TAAB Laboratories Equipment) and Sato's lead citrate (Sato & Shamoto 1973), and were examined using a Hitachi H700H electron microscope operated at 100 kV.
Matrix-assisted laser desorption/ionization time-of-flight mass spectroscopic (MALDI-TOF/MS) analysis
Islets were isolated from mice as described above. They were then placed on to a matrix-assisted laser desorption/ionization (MALDI) sample plate. The matrix of α-cyano 4-hydroxycinnamic acid (Bruker Daltonics, Leipzig, Germany) was saturated in a solution of acetonitrile/water 50:50 (v/v) containing 0.1% trifluoroacetic acid (Wako). The fresh matrix solution was added to the sample and dried. MALDI-TOF mass spectra were acquired using a Bruker AutoflexIII MALDI-TOF mass spectrometer (Bruker Daltonics) equipped with a delayed extraction source and 337 nm pulsed nitrogen laser. External calibration was performed using the Peptide Calibration Standard II (Bruker Daltonics).
Insulin secretion assay
Islets of similar sizes, which were isolated from mice as described above, were grouped separately. Islets were washed in Dulbecco's PBS (DPBS; 137 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, and 8.1 mM Na2HPO4, pH 7.4) (Sigma), containing 0.9 mM CaCl2 and 0.5 mM MgCl2, and were preincubated in the same buffer for 60 min at 37 °C in humidified 5% CO2–95% air. Experiments for insulin secretion were carried out in 96-well plates (ten islets per well) for 60 min in DPBS (300 μl) in the absence (control) or presence of 16.1 mM glucose or 28.9 mM KCl. The medium was collected, gently centrifuged, and stored at −20 °C for measurement of insulin. Insulin concentration was determined using an ELISA.
Real-time PCR analysis of GLUT2 and GK mRNA expression
Total RNA was extracted from 750 to 850 islets using the Spin Tissue RNA Mini Kit (Invitek Gmbh, Berlin, Germany) and RNA stabilizer (Wako) according to the manufacturer's protocol. Total RNA (0.4 μg) was then reverse transcribed using a Random Primer (TaKaRa Bio, Otsu, Japan) and the M-MLV reverse transcriptase (Invitrogen). Real-time PCR was performed using the LightCycler ST300 (Roche Diagnostics). To prepare standard samples for each gene transcript, an equal amount of each cDNA sample was combined and then serially diluted with EASY Dilution (TaKaRa Bio). For PCR of standards and single samples of unknowns, 2 μl of RT product were amplified in 20 μl of a reaction mixture containing 200 nM of each primer (Table 1) and 10 μl of 2×SYBR premix Ex Taq (TaKaRa Bio). The gene-specific primer sets, designed using LightCycler Probe Design Software 2.0 (Roche) with reference to Genbank sequences downloaded from the Mouse Genome Informatics (http://www.informatics.jax.org/) website, were designed so as to have a melting temperature of ∼60 °C, a GC content of ∼50%, and to generate amplicon lengths ranging from 150 to 200 bp. The conditions of real-time PCR included an initial step of 10 s at 95 °C to activate Taq polymerase, followed by 40 cycles of 95 °C for 5 s for denaturation and 60 °C for 20 s for annealing and extension, with a temperature transition rate of 20 °C/s. After real-time PCR, a melting curve analysis was carried out to demonstrate the specificity of the PCR products, and showed that the melting curve for the PCR products targeting each gene transcript had a single peak (data not shown). The mRNA levels of Glut2 and Gk in each sample were normalized by division by the mRNA level of the housekeeping gene Gapdh in the same sample.
Sequences of the primers used for real-time PCR of pancreatic islets of mice
| Forward primer sequence (5′–3′) | Reverse primer sequence (5′–3′) | Product length (bp) | NCBI reference sequence | |
|---|---|---|---|---|
| Target gene | ||||
| Glut2 | GAGAGATCGCTCCAACCAC | CACAGCAGATAGGCCAAGT | 152 | NM_031197 |
| Gk | GGTGAGCTGGACGAGTT | AAGATTCTCCTCTACCAGCTT | 153 | NM_010292 |
| Gapdh | CCAAGGCTGTGGGCAA | CCCTCAGATGCCTGCT | 189 | NM_008084 |
In vivo T3 treatment
T3, dissolved in PBS (pH 7.4), was injected i.p. (0.2 μg/g body weight; Sigma–Aldrich) into 3-week-old grt mice once every other day for 9 weeks. Mice injected with the vehicle alone were used as controls.
Reverse transcription-PCR analysis of TPST1 and TPST2 mRNA expression
Total RNA (0.4 μg) from normal and grt mice was reverse transcribed as described above. The gene-specific primer sets were designed using the Primer3 (http://primer3.sourceforge.net/) website with reference to Genbank sequences downloaded from the Mouse Genome Informatics website (Table 2). PCR amplifications were performed using TaKaRa Ex Taq (TaKaRa Bio). The PCR cycle conditions consisted of denaturation at 94 °C for 2 min, followed by 40 cycles of 94 °C for 1 min (denaturation), 61 °C (TPST1), 63 °C (TPST2), or 58 °C (GAPDH) for 1 min (annealing), and then 72 °C for 1 min (elongation).
Sequences of the primers used for RT-PCR of pancreatic islets of mice
| Forward primer sequence (5′–3′) | Reverse primer sequence (5′–3′) | Product length (bp) | NCBI reference sequence | |
|---|---|---|---|---|
| Target gene | ||||
| Tpst1 | TACTCTTGGCGTGTCTGGTG | TGCATGGCAGAATCTAGCAC | 391 | NM_001130476 |
| Tpst2 | ACTGCCTCACCAAGTGGAAC | AAGCCATGTGCTTGGGTTAG | 587 | NM_009419 |
| Gapdh | ACCACAGTCCATGCCATCAC | TCCACCACCCTGTTGCTGTA | 452 | NM_008084 |
Statistical analysis
Values were expressed as the mean±s.e.m. The statistical significance (P<0.05) of differences was determined using Student's t-test.
Results
Intraperitoneal glucose tolerance tests
Results of the IGTTs in 3-month-old normal and grt mice are shown in Fig. 1. Blood glucose levels under fasting conditions (0 min) were higher in grt mice compared with normal mice (114.2±3.1 vs 51.0±5.5 mg/100 ml, P<0.05, Fig. 1A). Thirty minutes after glucose administration, blood glucose levels increased 3.8-fold in the normal mice. Thereafter, those levels were slightly decreased. On the other hand, blood glucose levels continued to increase in grt mice after glucose administration, and these levels were significantly higher at 90 and 120 min compared with normal mice. Quantitatively, the area under the glucose curve was significantly increased in grt mice as compared with that in normal mice (Fig. 1B).
Intraperitoneal glucose tolerance test (IGTT). Blood glucose levels and plasma insulin levels were measured at the indicated time points following i.p. glucose administration (1 mg/g body weight) to normal (□) and grt mice (▪). Blood samples were collected via retro-orbital sinus puncture. Blood glucose levels were measured using an automated blood glucose meter (A). To clarify the blood glucose levels quantitatively, the glucose AUC was calculated (B). Plasma insulin concentrations were determined using an ELISA (C). The blood glucose levels under fasting conditions were measured in 2- to 12-month-old mice (D). Results are presented as means±s.e.m. (n=5–6). *Significantly different from normal mice (P<0.05).
Citation: Journal of Endocrinology 206, 2; 10.1677/JOE-09-0465
Plasma insulin levels under fasting conditions (0 min) did not differ between normal and grt mice. Thirty minutes after glucose administration, plasma insulin levels increased in the normal mice, but not in grt mice, which showed significantly lower levels (284.0±58.2 vs 658.0±78.1 pg/ml, P<0.05, Fig. 1C). Thereafter, these levels decreased rapidly in normal mice and remained significantly lower in grt mice compared with normal mice, indicating that grt mice have an impaired glucose tolerance and reduced insulin secretion.
In addition, fasting hyperglycemia that was comparable to that in 3-month-old grt mice was observed in 2-, 6-, and 12-month-old grt mice (Fig. 1D), suggesting that grt mice are in a state of impaired glucose tolerance during their lives.
Insulin tolerance tests
To study the degree of insulin sensitivity, insulin tolerance tests were performed in 3-month-old normal and grt mice using a fixed dose of insulin (1 mU/g body weight i.p). The fall in blood glucose levels was almost the same for normal and grt mice, except for at 15 min after insulin administration, illustrating nearly equal insulin sensitivity (Fig. 2). Therefore, impaired insulin secretion in grt mice does not seem to be associated with insulin resistance.
Insulin tolerance test. Blood glucose levels were measured at the indicated time points following i.p. insulin administration (1 mU/g body weight) to normal (□) and grt (▪) mice. The results are expressed as a percentage of the value at time 0 (before insulin loading). Results are presented as means±s.e.m. (n=5–6). *Significantly different from normal mice (P<0.05).
Citation: Journal of Endocrinology 206, 2; 10.1677/JOE-09-0465
Histology of pancreatic islets
Isolated islets from normal and grt mice were immunocytochemically stained with anti-insulin antibodies. There were no differences in the population or location of anti-insulin antibody-positive β-cells between islets of normal and grt mice (Fig. 3A and B respectively). We further examined the localization of insulin in pancreatic β-cells in detail using immunogold electron microscopy. Anti-insulin antibody-positive gold particles were detected in secretory granules in the islets of both normal and grt mice (Fig. 3C and D respectively). These observations indicate that, although grt mice as well as normal mice have insulin stored in secretory granules, pancreatic β-cells in grt mice may not be able to secrete insulin in a normal manner.
Immunohistochemical and immunoelectron microscopic analysis of insulin in pancreatic islets. Isolated pancreatic islets of normal (A and C) and grt (B and D) mice were stained for insulin using guinea pig anti-insulin antibodies. (A) and (B) were immunohistochemically analyzed following the addition of the peroxidase anti-peroxidase complex (PAP) (Bar=50 μm). (C) and (D) were analyzed by immunoelectron microscopy following reaction with gold-labeled (10 nm) secondary antibodies. Gold particles were detected in secretory granules (SG) (Bar=250 nm).
Citation: Journal of Endocrinology 206, 2; 10.1677/JOE-09-0465
MALDI-TOF/MS
To analyze the molecular weight of insulin in the islets of normal and grt mice, we used MALDI-TOF/MS. The molecular weight of insulin in the islets of grt mice produced a major peak at an m/z ratio of 5794.1, which is very close to the major peak for insulin from normal islets which have an m/z ratio of 5793.4 (Fig. 4).
Matrix-assisted laser desorption/ionization time-of-flight mass spectroscopic (MALDI-TOF/MS) analysis. MALDI-TOF mass spectra of the islets from normal (upper stand) and grt (lower stand) mice were acquired using a Bruker AutoflexIII MALDI-TOF mass spectrometer.
Citation: Journal of Endocrinology 206, 2; 10.1677/JOE-09-0465
Effect of glucose and KCl treatment on insulin release from isolated islets
To evaluate the effects of glucose (16.1 mM) or KCl (28.9 mM) treatment on insulin secretion from isolated islets, size-matched islets from 6- to 8-month-old normal and grt mice were statically incubated under in vitro conditions. Insulin secretion from islets in control medium did not differ between islets of normal and grt mice (0.32±0.12 vs 0.27±0.08 ng/ml, Fig. 5). The insulin-secretory response to glucose (16.1 mM) treatment of grt mice islets was markedly reduced compared with normal mouse islets (0.99±0.15 vs 2.88±0.57 ng/ml, P<0.05, Fig. 4); however, there was no difference in insulin secretion from islets in DPBS containing KCl (28.9 mM) between normal and grt mouse islets (2.82±1.22 vs 2.71±1.24 ng/ml, Fig. 5). These observations indicate that isolated islets in grt mice have normal 
Glucose-mediated insulin secretion in isolated islets. Islets from normal (□) and grt (▪) mice were isolated, and batches of ten islets were preincubated in DPBS for 60 min. Insulin secretion was assessed in the absence of glucose and KCl (control), in the presence of 16.1 mM glucose, or in the presence of 28.9 mM KCl for 60 min. The medium was collected and gently centrifuged. Insulin concentrations were determined using an ELISA. Results are presented as means±s.e.m. (n=5–6). *Significantly different from normal mice (P<0.05).
Citation: Journal of Endocrinology 206, 2; 10.1677/JOE-09-0465
Glut2 and Gk mRNA levels
To determine the defect in insulin secretion in grt mice, the mRNA levels of the glucose sensors, Glut2 and Gk, in pancreatic islets were analyzed using real-time PCR. There was no difference in Glut2 (Fig. 6A) or Gk (Fig. 6B) mRNA levels between islets of normal and grt mice. This observation indicates that reduction of insulin secretion from islets of grt mice involves a process other than a decrease in the expression of Glut2 and Gk mRNA.
Real-time PCR analysis of the glucose transporter 2 (Glut2) and glucokinase (Gk) in pancreatic islets. Expression of the Glut2 (A) and Gk (B) mRNA levels in pancreatic islets of normal (□) and grt (▪) mice. Total RNA was extracted from 750 to 850 islets and reverse transcribed. The level of mRNA expression was analyzed by real-time PCR. The mRNA level was normalized by dividing the level of mRNA of the housekeeping gene, Gapdh, in the same sample. Results are presented as means±s.e.m. (n=3).
Citation: Journal of Endocrinology 206, 2; 10.1677/JOE-09-0465
Effect of T3 treatment to grt mice on IGTTs
Since grt mice are hypothyroid animals, the effect of T3 treatment on the impaired insulin secretion of these mice was studied. The results of IGTTs of normal, grt, and T3-treated grt mice are shown in Fig. 7. As described previously, the blood glucose levels under fasting conditions in grt mice were higher than in normal mice (Fig. 7A). The blood glucose levels continued to increase in grt mice after glucose administration, and were significantly higher than the corresponding values in normal mice at 90 and 120 min. Following T3 treatment of grt mice, the blood glucose levels after fasting and blood glucose levels after glucose administration were restored to nearly the same levels as those in normal mice (Fig. 7A). The plasma insulin levels were significantly increased at 30 min after the administration of glucose as compared with the levels at time 0 in normal mice (Fig. 7B). However, this increase of the insulin levels induced by glucose administration was not observed in grt mice (Fig. 7C). On the other hand, the plasma insulin levels were slightly increased at 30 min after a glucose load as compared with the levels at time 0 in T3-treated grt mice (P=0.056, Fig. 7D). However, this increase was not comparable to that observed in normal mice (Fig. 7B and D). Altogether, these observations indicate that there is no significant relationship between the thyroid dysfunction and the insulin hyposecretion in grt mice.
Effect of T3 treatment on the results of IGTT in grt mice. T3 (0.2 μg/g body weight) was injected i.p. into 3-week-old grt mice once every other day for 9 weeks. Mice injected with the vehicle alone were used as the control. Blood glucose levels following i.p. glucose administration (1 mg/g body weight) in normal (□), grt (▪) and T3-treated grt (
) mice were measured by an automated blood glucose meter (A). Plasma insulin levels in normal (B), grt (C), and T3-treated grt (D) mice were assayed by an ELISA. Results are presented as means±s.e.m. (n=7–9). *,#Significantly different from normal mice and at time 0 respectively (P<0.05).
Citation: Journal of Endocrinology 206, 2; 10.1677/JOE-09-0465
Effect of T3 treatment on insulin secretion from the islets of grt mice
To confirm the effect of the thyroid hormones on the impaired insulin secretion in grt mice, we investigated the glucose-stimulated insulin secretion from the isolated islets of T3-treated grt mice. There was no difference in the insulin secretion in response to glucose exposure between the islets of T3-treated grt mice and those of control grt mice (Fig. 8). Thus, T3 treatment was ineffective in correcting the impaired insulin secretion from the islets of grt mice.
Effect of T3 treatment on glucose-stimulated insulin secretion in isolated islets of grt mice. T3 (0.2 μg/g body weight) was injected i.p. into 3-week-old grt mice once every other day for 9 weeks. Mice injected with the vehicle alone were used as the control. Isolated islets from control grt (▪) and T3-treated grt () mice were preincubated in DPBS for 60 min. Insulin secretion was assessed in the absence of glucose (control) or in the presence of 16.1 mM glucose for 60 min. The medium was collected and gently centrifuged. Insulin concentrations were measured using an ELISA. Results are presented as means±s.e.m. (n=3).
Citation: Journal of Endocrinology 206, 2; 10.1677/JOE-09-0465
Expression of Tpst1 and Tpst2 mRNA in pancreatic islets
In order to investigate the relationship between islet function and TPST, the mRNA expression of Tpst1 and Tpst2 was analyzed in isolated islets from 6- to 8-month-old normal and grt mice using RT-PCR and gene-specific primers (Table 2). The mRNA of these enzymes was expressed in pancreatic islets of both normal and grt mice (Fig. 9). This observation suggests the existence of some target proteins for TPSTs in pancreatic islets.
Expression of tyrosylprotein sulfotransferase (Tpst) 1 and Tpst2 mRNA in islets of normal and grt mice. The mRNA expression of Tpst1, Tpst2, and the internal control Gapdh was analyzed by RT-PCR. PCR products were separated on 1.5% ethidium bromide (EtBr)–agarose gels.
Citation: Journal of Endocrinology 206, 2; 10.1677/JOE-09-0465
Discussion
It has been reported that overt hypothyroidism is associated with profound changes in insulin sensitivity and insulin secretion, and that these changes are reversible, at least in part, after recovery of thyroid function (Rochon et al. 2003, Stanická et al. 2005). The results of the present study indicated that hypothyroidal grt mice also have a significant reduction in glucose-induced insulin secretion.
In this study, we showed that grt mice secrete less insulin, both in vivo and in vitro, in response to glucose administration compared with normal mice, indicating a functional failure of pancreatic islets. In addition, it was inferred that the insulin secretion was impaired throughout the life in grt mice, since significant elevation of the blood glucose levels under fasting conditions compared with those in normal mice was observed in grt mice ranging in age from 2 to 12 months. The function of pancreatic β-cells varies with differences in insulin sensitivity (Kahn et al. 1993). Insulin resistance produces a compensatory increase in insulin secretion and, ultimately, it is the failure of the β-cell that causes fasting hyperglycemia and development of type 2 diabetes (Kahn 1994). Low T4 levels, even when within the physiological range, were significantly associated with increased insulin resistance (Roos et al. 2007). In addition, the level of insulin receptors was reported to be decreased in hypothyroidism (Mackowiak et al. 1999). On the other hand, it has also been reported that hypothyroidism has no impact on insulin sensitivity (Owecki et al. 2006). We therefore examined the influence of hypothyroidism on insulin sensitivity in grt mice, and demonstrated that blood glucose levels in response to insulin treatment were almost the same between normal and grt mice. Our observation suggested that thyroid dysfunction does not affect insulin sensitivity, and that impaired insulin secretion is not attributable to insulin resistance in grt mice.
Histological examination showed that insulin was localized in secretory granules in pancreatic β-cells of both normal and grt mice. In addition, the size of isolated islets and of β-cells in islets and the ratio of β-cells in the islets were almost the same between normal and grt mice (data not shown). These findings suggest that reduced insulin secretion in grt mice is not attributable to the number of β-cells in the islets or to a change in insulin synthesis or storage in pancreatic β-cells. This finding was further supported by analysis of the molecular weight of insulin in the islets of normal and grt mice using MALDI-TOF/MS. We, therefore, speculated that insulin of the same molecular weight as that in normal mice is synthesized and stored in the islets of grt mice.
Glucose is transported by membrane-bound GLUT2 into the β-cell, where it is phosphorylated by GK to yield glucose-6-phosphate, thereby initiating glycolysis. The resultant increase in the ATP:ADP ratio causes the closure of the ATP-sensitive K+ channels (
We hypothesized that the reduction in insulin release from pancreatic islets of grt mice might be associated with the expression of Glut2 and Gk mRNA, since it has been reported that the expression of these glucose sensors is regulated by thyroid hormone. For example, T3 can modulate the mRNA and protein levels of these molecules in pancreatic islets (García-Flores et al. 2001). In addition, thyroid hormones regulate hepatic glucose transport by altering the expression of Glut2 mRNA and protein levels in hepatocytes (Weinstein et al. 1994, Kemp et al. 1997, Mokuno et al. 1999). Thyroid hormone is also involved in the regulation of Gk gene transcription in liver (Höppner & Seitz 1989). We showed that there is no difference in the level of expression of Glut2 or Gk mRNA between islets of normal and grt mice. Therefore, we predicted that there must be a functional failure of glucose sensors in grt mice, including glucose sensors involved in glucose transport, GK activity, glycolysis, and glucose oxidation. Since GLUT2 has a high Michaelis–Menten constant for glucose, the action of GLUT2 is needed for a high physiological concentration of glucose. Therefore, GLUT2 would not be expected to be rate-limiting to consequent glucose utilization, indicating that it is not possible to evaluate insulin secretion only by assay of the expression of GLUT2 (Kooptiwut et al. 2002). In support of this idea, it has been shown in rat pancreatic β-cells that the rates of glucose transport were at least 50-fold higher than the corresponding rates of glucose utilization, and that glucose phosphorylation, not glucose transport, correlated with glucose sensitivity (Heimberg et al. 1993). In addition, glucose could stimulate insulin secretion from mouse islets in which there was a complete absence of GLUT2 (Guillam et al. 2000). On the other hand, GK activity can be elevated in the presence of increased GLUT2 protein levels (Ferber et al. 1994). Finally, the observed reduction in insulin secretion from pancreatic islets of grt mice may be associated with the protein levels and function of GLUT2 and GK rather than with their mRNA expression, as well as with other factors. Further studies will determine whether there is a link between insulin hyposecretion and glucose utilization in grt mice.
T3 replacement restores growth retardation (Yoshida et al. 1994) and serum TSH levels (Tomita et al. 1995) in grt mice. Thyroid hormone receptor α (TRα) and TRβ mRNA and protein have been detected in pancreatic islets (Zinke et al. 2003). We demonstrated that T3 replacement can completely recover the impaired glucose tolerance in grt mice, and that the plasma levels of insulin in response to a glucose load were only slightly increased in T3-treated grt mice, indicating that hypothyroidism is associated with a deterioration of glucose metabolism. The recovery of impaired blood glucose levels in T3-treated grt mice may be associated with increased GLUT4 localized in the myocytes and adipocytes that is involved in glucose transport, since GLUT4 protein expression is regulated by T3 (Shimizu & Shimazu 2002). It has been reported that although subjects with hypothyroidism are characterized by attenuated plasma insulin concentrations and increased glucagon concentrations in the basal state, T4 replacement can, among other effects, result in partial amelioration of insulin secretion and improved insulin sensitivity (Handisurya et al. 2008). In the present study, insulin sensitivity in grt mice was almost the same as that of normal mice, suggesting that the effect of T3 replacement may be mediated by mechanisms other than modulation of insulin resistance in grt mice.
Our data further suggest that complete restoration of insulin secretion cannot be achieved by T3 treatment of grt mice. In addition, we could not observe any improvement in insulin secretion from the isolated islets of T3-treated grt mice. We, therefore, presumed that a mechanism other than hypothyroidism is involved in the regulation of insulin secretion. We hypothesized that there may be a relationship between insulin hyposecretion in grt mice and the gene responsible for the grt phenotype, Tpst2. TPST catalyzes the transfer of a sulfuryl group from the universal sulfation substrate, 3′-phosphoadenosine 5′-phosphosulfate, to a tyrosyl residue within acidic motifs of proteins that transit the Golgi apparatus (Moore 2003). In mammals, two isozymes, TPST1 and TPST2, catalyze the tyrosine sulfation of proteins. Although mammalian TPST1 and TPST2 have 65–67% amino acid sequence identity (Moore 2003), they appear to have different acceptor preferences (Seibert et al. 2002). Evidence indicates that posttranslational modification by tyrosine sulfation regulates many important protein–protein interactions and modulates binding affinity and specificity (Niehrs et al. 1990, Pittman et al. 1994, Sasaki et al. 2007). TPST2 plays a crucial role in tyrosine sulfation of the TSH receptor (Sasaki et al. 2007). Sulfation of the tyrosine 385 residue of the TSH receptor by TPST2 is indispensable for activation of TSH signaling. This means that grt mice develop hypothyroidism and growth retardation because they are unable to fully respond to TSH (Sasaki et al. 2007). It has been reported that TPST2 is ubiquitously expressed (Mishiro et al. 2006). However, there has been no report concerning the expression of TPST2 in mouse pancreatic islets. To evaluate the relationship between TPST2 and insulin secretion in grt mice, we analyzed the expression of Tpst mRNA in islets of grt mice using RT-PCR, to confirm that the mRNA of Tpst1 and Tpst2 is expressed in islets of grt mice. These observations indicate that target proteins of TPST2 may be expressed in pancreatic islets. Chromogranin A and secretogranin II are known to be expressed in islets, although the physiological role of insulin secretion by these molecules in pancreatic islets is unclear (Schmid et al. 2007, Koshimizu et al. 2010). Tyrosine residues of these proteins are sulfonated by TPST (Moore 2003), and they play a significant role in granule formation in endocrine cells (Koshimizu et al. 2010). On the other hand, it has been reported that cholecystokinin and gastrin regulate insulin secretion (Unger et al. 1967, Ubilluz 1994), and that these proteins also require tyrosine sulfation for optimal function (Rehfeld 1998). Then, it is of great interest to investigate whether TPST2 is directly and/or indirectly involved in the regulation of insulin secretion from the pancreatic islets. A study of the relationship between these molecules and insulin secretion from pancreatic islet is currently in progress.
In summary, the present study demonstrates that grt mice show reduced glucose-stimulated insulin secretion, and that the administration of T3 to these mice improves the insulin hyposecretion, albeit only to a slight extent. Further studies are required to investigate the underlying mechanism, including the role of TPST2, in the reduction of insulin secretion in grt mice.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This study was supported by a research grant from Saitama University to TK and TM. This work was supported by a grant from the Rational Evolutionary Design of Advanced Biomolecules (REDS) Project, Saitama Prefecture Collaboration of Regional Entities for the Advancement of Technological Excellence, supported by JST.
Acknowledgements
We sincerely thank Dr Yoshida (Stardust Square, Studio & Acupuncture Practice, Tokyo, Japan) for supplying grt mice. We also thank Drs Tsukahara and Kuroda (Saitama University) for their advice regarding real-time PCR analysis. We are also grateful to Mr Niimi (Saitama University) for his support on the MALDI-TOF/MS analysis.
References
Bergsten P, Grapengiesser E, Gylfe E, Tengholm A & Hellman B 1994 Synchronous oscillations of cytoplasmic Ca2+ and insulin release in glucose-stimulated pancreatic islets. Journal of Biological Chemistry 269 8749–8753.
Brenta G, Berg G, Arias P, Zago V, Schnitman M, Muzzio M, Sinay I & Schreier L 2007 Lipoprotein alterations, hepatic lipase activity, and insulin sensitivity in subclinical hypothyroidism: response to l-T4 treatment. Thyroid 17 453–460.
Cerf ME 2007 High fat diet modulation of glucose sensing in the beta-cell. Medical Science Monitor 13 RA12–RA17.
Cortizo AM, Gómez Dumm CL & Gagliardino JJ 1985 Effect of thyroid hormone levels upon pancreatic islet function. Acta Physiologica et Pharmacologica Latinoamericana 35 181–191.
Crunkhorn S & Patti ME 2008 Links between thyroid hormone action, oxidative metabolism, and diabetes risk? Thyroid 18 227–237.
Dessein PH, Joffe BI & Stanwix AE 2004 Subclinical hypothyroidism is associated with insulin resistance in rheumatoid arthritis. Thyroid 14 443–446.
Doong ML, Wang JW, Chung SC, Liu JY, Hwang C, Hwang CY, Day CH, Liu YF, Young TK & Ho LL et al. 1997 Regulation of thyroid hormones in the secretion of insulin and gastric inhibitory polypeptide in male rats. Metabolism 46 154–158.
Ferber S, BeltrandelRio H, Johnson JH, Noel RJ, Cassidy LE, Clark S, Becker TC, Hughes SD & Newgard CB 1994 GLUT-2 gene transfer into insulinoma cells confers both low and high affinity glucose-stimulated insulin release. Relationship to glucokinase activity. Journal of Biological Chemistry 269 11523–11529.
García-Flores M, Blázquez E & Zueco JA 2001 Effects of triiodothyronine and bovine growth hormone on glucose transporter isoform-2 (GLUT-2) and glucokinase (GK) gene expression in pancreatic islets of fetal and adult rats. Pflügers Archiv 442 662–667.
Gilon P, Shepherd RM & Henquin JC 1993 Oscillations of secretion driven by oscillations of cytoplasmic Ca2+ as evidences in single pancreatic islets. Journal of Biological Chemistry 268 22265–22268.
Gotoh M, Maki T, Kiyoizumi T, Satomi S & Monaco AP 1985 An improved method for isolation of mouse pancreatic islets. Transplantation 40 437–438.
Guillam MT, Dupraz P & Thorens B 2000 Glucose uptake, utilization, and signaling in GLUT2-null islets. Diabetes 49 1485–1491.
Handisurya A, Pacini G, Tura A, Gessl A & Kautzky-Willer A 2008 Effects of T4 replacement therapy on glucose metabolism in subjects with subclinical (SH) and overt hypothyroidism (OH). Clinical Endocrinology 69 963–969.
Heimberg H, De Vos A, Vandercammen A, Van Schaftingen E, Pipeleers D & Schuit F 1993 Heterogeneity in glucose sensitivity among pancreatic beta-cells is correlated to differences in glucose phosphorylation rather than glucose transport. EMBO Journal 12 2873–2879.
Höppner W & Seitz HJ 1989 Effect of thyroid hormones on glucokinase gene transcription in rat liver. Journal of Biological Chemistry 264 20643–20647.
Iossa S, Lionetti L, Mollica MP, Crescenzo R, Barletta A & Liverini G 2001 Fat balance and serum leptin concentrations in normal, hypothyroid, and hyperthyroid rats. International Journal of Obesity and Related Metabolic Disorders 25 417–425.
Kahn CR 1994 Banting Lecture. Insulin action, diabetogenes, and the cause of type II diabetes. Diabetes 43 1066–1084.
Kahn SE, Prigeon RL, McCulloch DK, Boyko EJ, Bergman RN, Schwartz MW, Neifing JL, Ward WK, Beard JC & Palmer JP 1993 Quantification of the relationship between insulin sensitivity and beta-cell function in human subjects. Evidence for a hyperbolic function. Diabetes 42 1663–1672.
Kemp HF, Hundal HS & Taylor PM 1997 Glucose transport correlates with GLUT2 abundance in rat liver during altered thyroid status. Molecular and Cellular Endocrinology 128 97–102.
Kobayashi K, Yamamoto H, Kobayashi T & Machida T 2001 Responses of the thyroid gland to TSH and other thyroid stimulators in the growth retarded (grt) mouse. Zoological Science 18 955–961.
Kobayashi K, Sato M, Machida T & Kobayashi T 2005 Thyroid-stimulating hormone receptor levels and binding affinity in the thyroid gland of growth-retarded mice. Congenital Anomalies 45 89–92.
Kooptiwut S, Zraika S, Thorburn AW, Dunlop ME, Darwiche R, Kay TW, Proietto J & Andrikopoulos S 2002 Comparison of insulin secretory function in two mouse models with different susceptibility to β-cell failure. Endocrinology 143 2085–2092.
Koshimizu H, Kim T, Cawley NX & Loh YP 2010 Chromogranin A: a new proposal for trafficking, processing and induction of granule biogenesis. Regulatory Peptides 25 153–159.
Lacy PE & Kostianovsky M 1967 Method for the isolation of intact islets of Langerhans from the rat pancreas. Diabetes 16 35–39.
Lenzen S & Bailey CJ 1984 Thyroid hormones, gonadal and adrenocortical steroids and the function of the islets of Langerhans. Endocrine Reviews 5 411–434.
Mackowiak P, Ginalska E, Nowak-Strojec E & Szkudelski T 1999 The influence of hypo- and hyperthyreosis on insulin receptors and metabolism. Archives of Physiology and Biochemistry 107 273–279.
Matschinsky FM 1990 Glucokinase as glucose sensor and metabolic signal generator in pancreatic beta-cells and hepatocytes. Diabetes 39 647–652.
Mishiro E, Sakakibara Y, Liu MC & Suiko M 2006 Differential enzymatic characteristics and tissue-specific expression of human TPST-1 and TPST-2. Journal of Biochemistry 140 731–737.
Mokuno T, Uchimura K, Hayashi R, Hayakawa N, Makino M, Nagata M, Kakizawa H, Sawai Y, Kotake M & Oda N et al. 1999 Glucose transporter 2 concentrations in hyper- and hypothyroid rat livers. Journal of Endocrinology 160 285–289.
Moore KL 2003 The biology and enzymology of protein tyrosine O-sulfation. Journal of Biological Chemistry 278 24243–24246.
Niehrs C, Huttner WB, Carvallo D & Degryse E 1990 Conversion of recombinant hirudin to the natural form by in vitro tyrosine sulfation. Differential substrate specificities of leech and bovine tyrosylprotein sulfotransferases. Journal of Biological Chemistry 265 9314–9318.
Owecki M, Nikisch E & Sowiński J 2006 Hypothyroidism has no impact on insulin sensitivity assessed with HOMA-IR in totally thyroidectomized patients. Acta Clinica Belgica 61 69–73.
Pittman DD, Tomkinson KN, Michnick D, Selighsohn U & Kaufman RJ 1994 Posttranslational sulfation of factor V is required for efficient thrombin cleavage and activation and for full procoagulant activity. Biochemistry 33 6952–6959.
Rehfeld JF 1998 The new biology of gastrointestinal hormones. Physiological Reviews 78 1087–1108.
Rochon C, Tauveron I, Dejax C, Benoit P, Capitan P, Fabricio A, Berry C, Champredon C, Thieblot P & Grizard J 2003 Response of glucose disposal to hyperinsulinaemia in human hypothyroidism and hyperthyroidism. Clinical Science 104 7–15.
Roos A, Bakker SJ, Links TP, Gans RO & Wolffenbuttel BH 2007 Thyroid function is associated with components of the metabolic syndrome in euthyroid subjects. Journal of Clinical Endocrinology and Metabolism 92 491–496.
Santos RM, Rosario LM, Nadal A, Garcia-Sancho J, Soria B & Valdeolmillos M 1991 Widespread synchronous [Ca2+]i oscillations due to bursting electrical activity in single pancreatic islets. Pflügers Archiv 418 417–422.
Sasaki N, Hosoda Y, Nagata A, Ding M, Cheng JM, Miyamoto T, Okano S, Asano A, Miyoshi I & Agui T 2007 A mutation in Tpst2 encoding tyrosylprotein sulfotransferase causes dwarfism associated with hypothyroidism. Molecular Endocrinology 21 1713–1721.
Sato T & Shamoto M 1973 A simple rapid polychrome stain for epoxy-embedded tissue. Stain Technology 48 223–227.
Schmid GM, Meda P, Caille D, Wargent E, O'Dowd J, Hochstrasser DF, Cawthorne MA & Sanchez JC 2007 Inhibition of insulin secretion by betagranin, an N-terminal chromogranin A fragment. Journal of Biological Chemistry 27 12717–12724.
Seibert C, Cadene M, Sanfiz A, Chait BT & Sakmar TP 2002 Tyrosine sulfation of CCR5 N-terminal peptide by tyrosylprotein sulfotransferases 1 and 2 follows a discrete pattern and temporal sequence. PNAS 99 11031–11036.
Shimizu Y & Shimazu T 2002 Thyroid hormone augments GLUT4 expression and insulin-sensitive glucose transport system in differentiating rat brown adipocytes in culture. Journal of Veterinary Medical Science 64 677–681.
Stanická S, Vondra K, Pelikánová T, Vlcek P, Hill M & Zamrazil V 2005 Insulin sensitivity and counter-regulatory hormones in hypothyroidism and during thyroid hormone replacement therapy. Clinical Chemistry and Laboratory Medicine 43 715–720.
Tomita K, Yoshida T, Morita J, Atsumi S & Totsuka T 1995 In vivo responsiveness of thyroid glands to TSH in normal and novel ‘growth-retarded’ mice: transient elevation in normal mice and impairment in ‘growth-retarded’ mice. Journal of Endocrinology 144 209–214.
Ubilluz R 1994 Advances in gastrointestinal hormones: cholecystokinin. Revista de Gastroenterología del Perú 14 222–232.
Unger RH, Ketterer H, Dupré J & Eisentraut AM 1967 The effects of secretin, pancreozymin, and gastrin on insulin and glucagon secretion in anesthetized dogs. Journal of Clinical Investigation 46 630–645.
Weinstein SP, O'Boyle E, Fisher M & Haber RS 1994 Regulation of GLUT2 glucose transporter expression in liver by thyroid hormone: evidence for hormonal regulation of the hepatic glucose transport system. Endocrinology 135 649–654.
Yen PM 2001 Physiological and molecular basis of thyroid hormone action. Physiological Reviews 81 1097–1142.
Yoshida T, Yamanaka K, Atsumi S, Tsumura H, Sasaki R, Tomita K, Ishikawa E, Ozawa H, Watanabe K & Totsuka T 1994 A novel hypothyroid ‘growth-retarded’ mouse derived from Snell's dwarf mouse. Journal of Endocrinology 142 435–446.
Zinke A, Schmoll D, Zachmann M, Schmoll J, Junker H, Grempler R, Kirsch G & Walther R 2003 Expression of thyroid hormone receptor isoform alpha1 in pancreatic islets. Experimental and Clinical Endocrinology and Diabetes 111 198–202.
