Calmodulin and calmodulin-dependent protein kinase II inhibit hormone secretion in human parathyroid adenoma

in Journal of Endocrinology
Authors:
Ming Lu Department of Molecular Medicine and Surgery, Department of Geriatric Endocrinology, Center for Molecular Medicine (CMM), Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden
Department of Molecular Medicine and Surgery, Department of Geriatric Endocrinology, Center for Molecular Medicine (CMM), Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden
Department of Molecular Medicine and Surgery, Department of Geriatric Endocrinology, Center for Molecular Medicine (CMM), Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden

Search for other papers by Ming Lu in
Current site
Google Scholar
PubMed
Close
,
Erik Berglund Department of Molecular Medicine and Surgery, Department of Geriatric Endocrinology, Center for Molecular Medicine (CMM), Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden

Search for other papers by Erik Berglund in
Current site
Google Scholar
PubMed
Close
,
Catharina Larsson Department of Molecular Medicine and Surgery, Department of Geriatric Endocrinology, Center for Molecular Medicine (CMM), Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden
Department of Molecular Medicine and Surgery, Department of Geriatric Endocrinology, Center for Molecular Medicine (CMM), Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden

Search for other papers by Catharina Larsson in
Current site
Google Scholar
PubMed
Close
,
Anders Höög Department of Molecular Medicine and Surgery, Department of Geriatric Endocrinology, Center for Molecular Medicine (CMM), Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden

Search for other papers by Anders Höög in
Current site
Google Scholar
PubMed
Close
,
Lars-Ove Farnebo Department of Molecular Medicine and Surgery, Department of Geriatric Endocrinology, Center for Molecular Medicine (CMM), Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden

Search for other papers by Lars-Ove Farnebo in
Current site
Google Scholar
PubMed
Close
, and
Robert Bränström Department of Molecular Medicine and Surgery, Department of Geriatric Endocrinology, Center for Molecular Medicine (CMM), Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden

Search for other papers by Robert Bränström in
Current site
Google Scholar
PubMed
Close

Free access

Sign up for journal news

Intracellular calcium ([Ca2+]i) is the most relevant modulator of parathyroid hormone (PTH) secretion. Uniquely, an increase in [Ca2+]i results in an inhibition of PTH secretion, and it probably exerts its function via calcium-binding protein pathways. The ubiquitous calcium-binding proteins, calmodulin and calmodulin-dependent protein kinase II (CaMKII), have well-established roles in regulated exocytosis in neurons and neuroendocrine cells. However, their roles in parathyroid cells and PTH secretion are still unclear. Using reverse transcription-PCR and western blot analysis, we have demonstrated the expression of calmodulin and CaMKII in human normal parathyroid and parathyroid chief cell adenomas. Blocking of calmodulin and CaMKII activity by the specific antagonists calmidazolium and KN-62 respectively caused a rise in PTH secretion from parathyroid adenoma cells in spite of increased [Ca2+]i. The inhibitory effect of Ca2+ calmodulin on PTH secretion may be due to the absence of synaptotagmin 1 protein in parathyroid adenomas, as demonstrated by western blot analysis. An increased extracellular calcium level acutely lowered the amount of active phosphorylated CaMKII (pCaMKII) in adenoma cells in vitro, indicating the physiological importance of this pathway. Moreover, a negative correlation between the levels of pCaMKII in parathyroid adenomas and serum calcium was found in 20 patients with primary hyperparathyroidism. Taken together, these results show that calmodulin negatively contributes to the regulation of PTH secretion in parathyroid adenoma, at least partially via a CaMKII pathway.

Abstract

Intracellular calcium ([Ca2+]i) is the most relevant modulator of parathyroid hormone (PTH) secretion. Uniquely, an increase in [Ca2+]i results in an inhibition of PTH secretion, and it probably exerts its function via calcium-binding protein pathways. The ubiquitous calcium-binding proteins, calmodulin and calmodulin-dependent protein kinase II (CaMKII), have well-established roles in regulated exocytosis in neurons and neuroendocrine cells. However, their roles in parathyroid cells and PTH secretion are still unclear. Using reverse transcription-PCR and western blot analysis, we have demonstrated the expression of calmodulin and CaMKII in human normal parathyroid and parathyroid chief cell adenomas. Blocking of calmodulin and CaMKII activity by the specific antagonists calmidazolium and KN-62 respectively caused a rise in PTH secretion from parathyroid adenoma cells in spite of increased [Ca2+]i. The inhibitory effect of Ca2+ calmodulin on PTH secretion may be due to the absence of synaptotagmin 1 protein in parathyroid adenomas, as demonstrated by western blot analysis. An increased extracellular calcium level acutely lowered the amount of active phosphorylated CaMKII (pCaMKII) in adenoma cells in vitro, indicating the physiological importance of this pathway. Moreover, a negative correlation between the levels of pCaMKII in parathyroid adenomas and serum calcium was found in 20 patients with primary hyperparathyroidism. Taken together, these results show that calmodulin negatively contributes to the regulation of PTH secretion in parathyroid adenoma, at least partially via a CaMKII pathway.

Introduction

The parathyroid glands are important organs for calcium regulation in the human body. Parathyroid cells sense small changes in serum calcium levels and adjust parathyroid hormone (PTH) secretion to keep serum calcium within a narrow range. In this sense, parathyroid cells are unique because intracellular Ca2+([Ca2+]i) inhibits PTH secretion, instead of stimulating secretion as in other endocrine cell types (Shoback et al. 1983). The calcium-sensing receptor (CaSR) is a G-protein-coupled receptor located in the cell membrane. Upon binding of extracellular calcium ([Ca2+]e) to CaSR, a phospholipase C–inositol triphosphate pathway is activated, resulting in several fold increase in [Ca2+]i and subsequent inhibition of PTH secretion. [Ca2+]i has been established as the central second messenger for PTH secretion (Shoback et al. 1984), involving, e.g. the PLA2-AA and the MAP kinase pathways (Kifor et al. 2001, Almaden et al. 2002). In addition to that, the mechanism behind [Ca2+]i increase and PTH inhibition remains unclear.

Calmodulin is a calcium-binding protein involved in the sensing of increased [Ca2+]i concentrations and subsequent signal transduction to a variety of cellular targets. Calmodulin-dependent protein kinase II (CaMKII) is a calmodulin-binding protein participating in functions such as exocytosis, [Ca2+]i oscillation, and ion-channel activation (Wang 2008). Calmodulin is ubiquitously expressed and has been detected in both normal and pathological parathyroid (Brown et al. 1981). However, a correlation between levels of calmodulin expression, calcium sensitivity, and PTH secretion has not been demonstrated (Brown et al. 1981, Oldham et al. 1982). Expression of CaMKII has also been reported in hyperfunctioning human parathyroid cells where modulation of CaMKII activity was found to be calcium and calmodulin dependent (Kinder et al. 1987, Kato et al. 1991). However, the interaction between calcium, calmodulin, and CaMKII in human parathyroid has not been clarified. In this study, we have investigated the relationship between calmodulin and CaMKII activity and PTH secretion.

Materials and Methods

Parathyroid tissue samples

Normal parathyroid tissue and parathyroid adenomas were collected with informed consent and ethical approval at the Karolinska University Hospital, Sweden. Histopathological diagnoses were according to the WHO classification (DeLellis et al. 2004). Histopathological examination of representative sections verified a high tumor cell content of the analyzed tissue samples.

Reverse transcription-PCR

The reverse transcription (RT)-PCR analysis included previously published samples of one normal parathyroid (Juhlin et al. 2010), and four or more parathyroid adenoma samples (Lu et al. 2010) for each gene analyzed. Total RNA was extracted using TRIzol reagent (Invitrogen), purified by DNAse I (Amplification Grade, Invitrogen), and quantified by spectrophotometry. Total RNA (3 μg) from each sample was reverse transcribed into 40 μl cDNA using the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, Cat. no. 18080-051). In all, 2 μl of each cDNA were used for amplification of calmodulin 1, 2, and 3 genes (CALM1, CALM2, and CALM3) and of CaMKII α, β, γ, and δ genes (CAMK2A, CAMK2B, CAMK2G, and CAMK2D) with the Platinum Taq DNA polymerase high-fidelity kit (Invitrogen). Gene-specific forward and reverse PCR primers (Table 1) were designed in house according to published genomic data and PCR primer design guidelines. CAMK2A, CAMK2B, CAMK2G, and CAMK2D have several transcript variants due to alternative splicing. Primers were designed based on the common sequence of each gene; therefore, it does not identify specific transcript variants. The PCR reactions were performed in 20 μl reactions with amplification conditions as follows: initial denaturation for 2 min at 94 °C, followed by 40 cycles of 30 s at 95 °C, 30 s at 50–55 °C, and 1 min at 68 °C. Human brain cDNA (Invitrogen, Cat. no. B1110033) was used as a positive control. The PCR products were subsequently size verified by agarose gel electrophoresis and were observed and photographed under u.v. light. To further verify the quality, all PCR products were purified using a PCR purification kit (Qiagen, Cat. no. Q28104) and were sequenced with the assistance of the KISeq core facility at Karolinska Institutet, Stockholm, Sweden.

Table 1

Details and primers used for reverse transcription-PCR of the CALM1–3 and CAMK2A, CAMK2B, CAMK2G, and CAMK2D genes

Gene symbolGene locationProtein productPrimer orientationPrimer sequence (5′–3′)Amplicon length (bp)Annealing temperature (°C)
CALM114q24–q31CalmodulinForwardCAGATATTGATGGAGACGGA62951
ReverseGAGCACACGAAGTACAAGAG
CALM22p21CalmodulinForwardGACAAAGATGGTGATGGAAC39451
ReverseGTCTTCACTTTGCTGTCATC
CALM319q13.2CalmodulinForwardACAAGGATGGAGATGGCAC31357
ReverseATCTCATCCACCTCCTCATC
CAMK2A5q32CaMKII α subunitForwardACCAGCTCTTCGAGGAATTG24156
ReverseGTGACCAGGTCGAAGATCAG
CAMK2B7p14.3CaMKII β subunitForwardGAGAGAGAGGCTCGGATCTG39556
ReverseTGTCCACAGGCTTGCCATAC
CAMK2G10q22CaMKII γ subunitForwardGACTTCTGAAACATCCAAAC43155
ReverseCACCAGGAGGATATACAGGA
CAMK2D4q26CaMKII δ subunitForwardTAGCAAATCCAAGGGAGCAG37755
ReverseATGGGTGCTTCAGTGCCTC

Western blot analysis

Twenty previously published parathyroid chief cell adenomas and one normal parathyroid biopsy specimen (Lu et al. 2008) were used for western blot analysis (No. 1–20, Table 2), using previously described methodology (Lu et al. 2008). Total proteins were extracted using 1% NP-40 lysis buffer supplied with protease inhibitors, and then quantified with a Bio-Rad protein assay. Following separation by SDS–PAGE, proteins were blotted onto nitrocellulose membranes and incubated overnight at 4 °C with primary antibodies, followed by appropriate secondary antibodies. The following primary antibodies and dilutions were applied: monoclonal rabbit anti-calmodulin that targets the single calmodulin protein commonly encoded by the CALM1, CALM2, and CALM3 genes (EP799Y, Abcam, Cambridge, UK, Cat. no. ab45689) at dilution 1:1000; polyclonal anti-endogenous CaMKII antibody that detects total CaMKII α and β subunits levels (Acris, Herford, Germany, Cat. No. AP02774PU-S) at 1:500; polyclonal anti-CaMKIIp-Thr286 antibody specific for the phosphorylated form of CaMKII α and β subunits (pCaMKII, Acris, Cat. no. AP2526PU-S) at 1:800; monoclonal anti-synaptotagmin 1 antibody (SYSY, Goettingen, Germany, Cat. no. 105011) at 1: 1000; and anti-β-actin (Sigma, Cat. no. A5441) used as a protein loading control. The results were visualized using enhanced chemiluminescence and by exposing to hyperfilm. The band density was measured by ImageJ software (NIH, Bethesda, Maryland, USA), and the levels of pCaMKII and calmodulin were determined by normalization against the density of β-actin.

Table 2

Clinical characteristics and protein expression levels

Protein expression (ratio)
Case numberAge at operationSex (M/F)Serum Ca2+ total (mM)Serum PTH (ng/l)Weight (g)pCaMKII/β-actinCalmodulin/β-actin
161M2.721560.842.402.32
259F2.662411.921.472.02
350F2.902113.070.432.46
467F2.781043.070.512.20
557F2.861851.520.482.94
652F2.60680.560.212.11
759F2.791141.061.281.57
822M2.671041.800.961.32
963F3.193517.600.621.60
1054F2.882.101.971.42
1161M831.781.681.29
1266F2.982341.700.761.36
1358F2.973588.500.371.26
1474M2.808791.101.061.33
1575M2.421253.151.221.40
1662F2.862441.541.461.24
1742M2.821494.280.781.82
1862F3.074245.070.341.57
1984F2.965961.920.781.39
2090F3.264856.280.161.58

Reference values: serum Ca2+ (2.20–2.60 mM), PTH (10–65 ng/l). Clinical characteristics have been published in Lu et al. (2008).

Preparation of parathyroid adenoma cells

Fresh parathyroid adenoma tissues were collected at operation, quickly transferred to the laboratory in ice-cold MEM medium, and digested into cells with 1.5 mg/ml type II collagenase and 0.1 mg/ml DNase. The cells were cultured in DMEM/F-12 (GlutaMAX, Gibco) supplied with 10% FCS and 1% penicillin–streptomycin for either [Ca2+]i measurement or PTH secretion studies. All experiments were performed within 72 h after isolation. Calmidazolium was purchased from Sigma, and KN-62 was obtained from Calbiochem (San Diego, CA, USA). Stock solutions were prepared in DMSO, and the final concentration of DMSO was <1%.

Measurement of [Ca2+]i by Fura-2

After isolation, parathyroid adenoma cells were grown on glass cover slides overnight until they attached. Cells were loaded with 2.5 μM Fura-2 AM (Invitrogen) at 37 °C for 30 min in extracellular solution (EC) containing (in mM): 125 NaCl, 4 KCl, 1 MgCl2, 0.8 NaH2PO4, 20 HEPES, and 5.6 d-glucose with 1.0 CaCl2. Slides were mounted into a 37 °C perfusion chamber and exposed to an inverted fluorescence microscope (Axiovert 135 TV, Zeiss, Oberkochen, Germany) with a ×40 oil objective. Fluorescence was provided by a SPEX fluorolog-2 CM1T11I spectrofluorimeter (SPEX Industries, Edison, NJ, USA) with the excitation wavelengths at 340 and 380 nm, and emission was monitored at 505 nm. Fluorescence imaging was detected by a cooled charge-coupled device camera (CCD, CH250 with KAF 1400, Photometrics, Tucson, AZ, USA) connected to an imaging system (Inovision, Durham, NC, USA). Fluorescence intensity was analyzed by ISEE software for UNIX (Inovision). The ratio of 340/380 nm emitted fluorescence was calculated to represent the [Ca2+]i level.

Measurement of PTH secretion

Parathyroid adenoma cells were suspended in the medium overnight, allowing them to recover from collagenase digestion. Cell viability, assessed using Trypan blue, was >98%. Cells (1×104–1×105) were loaded into a column on the top of a 3/5 volume of P-4 gel. The column was carefully closed and kept in a cabinet with a constant temperature of 37 °C. A peristaltic pump at a speed of 500 μl/3 min effectuated perfusion of the column. A 30 min preperfusion with EC containing 1.5 mM Ca2+ and basal amino acid, as previously described (Conigrave et al. 2004), was run before every experiment. Samples were collected every 3 min, quickly put on ice, and stored at −20 °C until use for PTH quantifications. Intact PTH was measured using an electrochemiluminescense immunoassay (Roche, Cat. no.11972219) at the routine clinical chemistry laboratory of Karolinska University Hospital. Each protocol was performed at least three times from at least two different adenoma glands. To allow comparison, the initial PTH level in each experiment was set to the arbitrary value of 1, and the PTH levels were normalized correspondingly.

Short-term treatment of parathyroid adenoma cells with calcium

To investigate the effect of [Ca2+]e on calmodulin and active pCaMKII, parathyroid adenoma cells were incubated with EC supplied with 0.5, 1.2, or 2.5 mM Ca2+ for 20 or 60 min respectively. After treatment, cells were washed twice with cold PBS, and then extracted for proteins. Untreated cells were used as negative control. The levels of calmodulin and pCaMKII were determined using western blot analysis.

Statistical analysis

All data are given as the mean±s.d. If not indicated otherwise, experiments were repeated at least three times. Statistical significance was analyzed using paired and unpaired t-tests between the two groups or ANOVA and post hoc test for multiple groups. Nonparametric tests were used to compare protein expression levels with clinical parameters. A P value of <0.05 was considered significant.

Results

Expression of calmodulin and CaMKII in human parathyroid

Expression of the three calmodulin-encoding genes, CALM1, CALM2, and CALM3, and CAMK2 genes was demonstrated by RT-PCR. As illustrated in Fig. 1A, single products of expected sizes were successfully amplified for CALM1, CALM2, CALM3, CAMK2A, CAMK2B, CAMK2G, and CAMK2D from human brain cDNA (positive control) and verified as correct by DNA sequencing. Products of the same sizes as the positive control were also amplified in parathyroid normal and adenoma samples. For all genes, except CAMK2A, the products were subsequently verified as correct by sequencing. Products amplified from parathyroid adenoma and normal tissue with CAMK2A primers were found to have the sequence of CAMK2B, suggesting that CAMK2A is not expressed in human parathyroid. Western blot analysis confirmed the expression of calmodulin and CaMKII on the protein level in normal and adenoma parathyroid samples (Fig. 1B).

Figure 1
Figure 1

Expression of calmodulin and CaMKII in human parathyroid. (A) RT-PCR analysis for agarose gel electrophoresis showing products of CALM13, CAMK2A, CAMK2B, CAMK2G, and CAMK2D genes in normal (N) and adenoma parathyroids, and human brain (P) used as control. Products were verified by sequencing expected for CAMK2A in parathyroid adenoma and normal. (B) Autoradiograms of western blots demonstrate protein expression of calmodulin and total CaMKII at expected product sizes in both normal and adenoma parathyroid.

Citation: Journal of Endocrinology 208, 1; 10.1677/JOE-10-0123

Association of calmodulin and CaMKII with PTH secretion

The calmodulin antagonist calmidazolium was used to inhibit the calmodulin-regulated activity, and KN-62 was used to inhibit CaMKII activity. Parathyroid adenoma cells were loaded into a perfusion column and preperifused for 30 min with EC containing 1.5 mM Ca2+ before starting the experimental protocol. Thereafter, all experiments started with a 9 min perfusion of 1.5 mM Ca2+, followed by an addition of drugs for 18 min. After washout, 0.5 mM Ca2+ was administered to verify parathyroid cell viability. Calmidazolium was tested at concentrations of 1 and 10 μM, and KN-62 was tested at 10 and 20 μM. Results are presented individually in Fig. 2A–D. In summary (Fig. 2E), 1 μM calmidazolium caused a 30±9.4% increase in PTH secretion, whereas 10 μM calmidazolium led to a 260±130% rise in PTH secretion. An addition of 10 μM KN-62 resulted in a 34±4% increase in PTH secretion, and 20 μM KN-62 caused a 100±7.9% increase in PTH secretion (Fig. 2E).

Figure 2
Figure 2

Effect of calmidazolium and KN-62 on PTH secretion. (A–D) Addition of 1 and 10 μM calmidazolium and 10 and 20 μM KN-62 at 1.5 mM Ca2+ caused an increase in PTH secretion. As summarized in (E), calmidazolium and KN-62 increased PTH secretion in a dose-dependent manner (*P<0.05; **P<0.01). The bars refer to time points of maximal observed effect.

Citation: Journal of Endocrinology 208, 1; 10.1677/JOE-10-0123

The effect of calmidazolium and KN-62 on [Ca2+]i

To investigate whether calmodulin and CaMKII are involved in the regulation of [Ca2+]i signaling, we used the Ca2+ indicator Fura-2 to examine [Ca2+]i. Calmidazolium or KN-62 was added to parathyroid adenoma cells through a perfusion system after step stimulation by 0.5 and 1.5 mM Ca2+. As shown in Fig. 3A, no significant change in [Ca2+]i was observed after adding 1 μM calmidazolium. An elevation of [Ca2+]i was observed after giving 10 μM calmidazolium. In the absence of Ca2+, 10 μM calmidazolium only caused a small transient increase in [Ca2+]i, but the addition of 1.5 mM Ca2+ resulted in a higher rise of [Ca2+]i than without the drug (Fig. 3B). Administration of 10 and 20 μM KN-62 did not show any effect on [Ca2+]i (Fig. 3C).

Figure 3
Figure 3

Measurement of [Ca2+]i using Fura-2 and determination of ratios for 340/380 nm emitted fluorescence (F340/380). (A) Application of 1 μM calmidazolium did not cause a significant change of [Ca2+]i, however, 10 μM calmidazolium induced an increase in [Ca2+]i. (B) In the absence of Ca2+, 10 μM calmidazolium only induced a small transient increase in [Ca2+]i, however, addition of 1.5 mM Ca2+ caused a higher constant increase in [Ca2+]i; (C) 10 and 20 μM KN-62 had no effect on [Ca2+]i.

Citation: Journal of Endocrinology 208, 1; 10.1677/JOE-10-0123

Negative correlation between pCaMKII and serum calcium levels

To investigate the possible correlation between calmodulin and CaMKII levels and clinical pathological data, we analyzed the protein expression of calmodulin and the active form of CaMKII (pCaMKII) in 20 parathyroid chief cell adenomas. Calmodulin and pCaMKII were quantified by normalization to β-actin levels (Table 2). Clinical data for the 20 patients with primary hyperparathyroidism were: age at diagnosis 61.5±14.7 years, total serum Ca2+ 2.85±0.20 mM, serum PTH level 269±208 ng/l, and tumor weight 2.8±2.3 g (for details, see Table 2). Calmodulin was clearly expressed at comparable levels in all parathyroid adenomas, whereas the amount of pCaMKII showed a larger variation between the samples (Fig. 4A; Table 2). In our material, calmodulin protein levels were not found to correlate with serum Ca2+, PTH, or tumor weight. In 8 out of 20 parathyroid adenomas, the pCaMKII signal was weak (Fig. 4A; Table 2). There was a negative correlation between the patients' total serum Ca2+ levels and the pCaMKII levels in the parathyroid adenomas (Spearman's ρ, r=−0.470, P<0.05; Fig. 4B). No correlation was observed between pCaMKII levels and serum PTH, tumor weight, or calmodulin protein levels. After treating parathyroid adenoma cells with EC containing 0.5, 1.2, and 2.5 mM Ca2+ for 60 min, no difference was observed in the expression of calmodulin protein, but a clear reduction in pCaMKII was detected at 2.5 mM Ca2+ (Fig. 4C and D). The effect could already be demonstrated after 20 min of incubation (Fig. 4E).

Figure 4
Figure 4

Demonstration of phospharylated CaMKII (pCaMKII) expression in parathyroid adenoma. (A) Western blot analysis of calmodulin and pCaMKII (pT286) protein in 20 parathyroid adenomas (No. 1–20). β-Actin served as loading control. (B) There was a negative correlation between total serum Ca2+ and pCaMKII in the tumors. (C) The amount of pCaMKII in human parathyroid adenoma cells was reduced when extracellular Ca2+ was increased during 1 h incubation whereas no change on calmodulin was seen with the same treatment. The effect on pCaMKII level at different extracellular Ca2+ concentrations is summarized in (D) (*P<0.05, NS P>0.05). (E) The amount of pCaMKII at 2.5 mM Ca2+ was reduced at 20 min.

Citation: Journal of Endocrinology 208, 1; 10.1677/JOE-10-0123

Absence of synaptotagmin 1 in human parathyroid adenomas

The expression of synaptotagmin 1 was investigated using western blot analysis. A product at the expected molecular size (∼60 kDa) was clearly detected in the rat insulinoma INS-1 cell line (Lang et al. 1997) used as positive control. However, the same products were undetectable in all of the human parathyroid adenoma samples investigated (Fig. 5), suggesting that synaptotagmin 1 is rarely expressed in parathyroid adenoma.

Figure 5
Figure 5

Absence of synaptotagmin 1 expression in human parathyroid adenomas. Western blot analysis demonstrated a product of expected size for synaptotagmin 1 in INS-1 cells (P), but not in human parathyroid adenomas. Subsequent incubation with anti-β-actin demonstrated equal loading between the lanes.

Citation: Journal of Endocrinology 208, 1; 10.1677/JOE-10-0123

Discussion

[Ca2+]i is the central player for hormone secretion in endocrine cells. Parathyroid cells are not exclusive even though the parathyroid cell distinguishes itself because of the negative regulation by calcium. In the same way as in other endocrine cells, activation of receptors evokes a rise in [Ca2+]i by mobilization of cellular [Ca2+]i and calcium influx. [Ca2+]i of 100–200 nM, which is close to the resting [Ca2+]i in other cell types, results in a maximal release of PTH (Shoback et al. 1984). A typical rise of [Ca2+]i induced by increased [Ca2+]e in parathyroid cells is biphasic, including a transient increase followed by a steady-state increase probably via store-operated calcium channels (Lu et al. 2010). Some compounds, such as dopamine, potentiate PTH secretion without changing [Ca2+]i (Nemeth et al. 1986). Therefore, it is likely that additional signaling pathways are involved in PTH secretion. [Ca2+]i signaling involves many Ca2+-binding proteins acting as calcium sensors or adaptors, which transduce signaling to cell processes via enzymatic reactions and protein–protein interaction.

Calmodulin, the most universal Ca2+-binding protein in eukaryotic cells, has been demonstrated in human parathyroid (Brown et al. 1981, Oldham et al. 1982). These authors found that the amount of calmodulin does not differ between normal parathyroid and parathyroid adenomas (Oldham et al. 1982), but it is increased in secondary hyperparathyroidism (Brown et al. 1981). It is known that the single calmodulin protein is encoded by three genes CALM1, CALM2, and CALM3 (Fischer et al. 1988). By using RT-PCR, we showed expression of all three calmodulin genes in human normal and adenomatous parathyroid tissue. Western blot confirmed its expression at the protein level. By analyzing 20 adenomas, we found that the calmodulin protein level did not correlate with serum Ca2+, PTH, or tumor weight. Incubation for 60 min with 0.5, 1.2, and 2.5 mM Ca2+ did not alter the expression of calmodulin. These findings suggest that the amount of calmodulin is not associated with calcium-regulated PTH secretion, which is in accordance with previous studies (Brown et al. 1981, Oldham et al. 1982). Calmidazolium, a powerful and frequently used calmodulin blocker, was found to cause a significant dose-dependent increase in PTH secretion. Notably, the effect of 10 μM calmidazolium was 8.6-fold higher than 1 μM calmidazolium. The strong pharmacological action of 10 μM calmidazolium may cause emptying of the secretory vesicle pool and result in reduced response to the subsequent stimulation of 0.5 mM Ca2+. These results imply that a calmodulin-regulated pathway is involved in PTH secretion.

Among numerous calmodulin-regulated enzymes, Ca2+/CaMKII is the best-established calmodulin-regulated kinase participating in exocytosis. CaMKII has four subunits: α, β, γ, and δ. It regulates neurotransmitter release (Stefani et al. 1997), insulin secretion (Bhatt et al. 2000, Yamamoto et al. 2003), and catecholamine secretion (Schweitzer et al. 1995) via phosphorylation of synapsin I. By using calmodulin affinity chromatography, CaMKII (only α subunit) has been purified from human parathyroid cells (Kinder et al. 1987, Kato et al. 1991). The function of CaMKII in parathyroid cells has never been investigated. In this paper, we have demonstrated expression of the genes CAMK2B, CAMK2G, and CAMK2D encoding the CaMKII subunits β, γ and δ but not CAMK2A, which encodes the CaMKII subunit α in human parathyroid using RT-PCR. Inhibition of CaMKII activity by the specific blocker KN-62 resulted in a dose-dependent increase in PTH secretion. This finding indicates that CaMKII is involved in the regulation of PTH release. The weaker effect of KN-62 compared with calmidazolium suggests that the CaMKII pathway is only partially involved in calmodulin-regulated PTH secretion.

In order to investigate the mechanism of calmodulin and CaMKII-regulated PTH secretion, [Ca2+]i measurements were performed. Our results showed that 1 μM calmidazolium caused no significant change in [Ca2+]i, whereas, surprisingly, 10 μM calmidazolium induced an increase in [Ca2+]i. No obvious change in [Ca2+]i by 10 or 20 μM KN-62 was demonstrated. Together with the PTH secretion data, this shows that the stimulation of PTH secretion by calmidazolium and KN-62 is dissociated from the [Ca2+]i level. It is therefore possible that calmodulin directly influences the final step of hormone secretion, i.e. exocytosis. Calmodulin has been shown to interact with several exocytotic proteins, such as VAMP-2, Munc-13, and rab-3. Several of these exocytotic proteins are expressed in human parathyroid (Lu et al. 2008). Giovanni et al. showed that calmodulin itself has an inhibitory effect on exocytosis, because the binding of calmodulin to VAMP-2 impairs SNARE-mediated membrane fusion. However, when calmodulin is combined with synaptotagmin 1, the calmodulin–synaptotagmin 1 complex will overcome the inhibitory effect of calmodulin and accelerate the membrane fusion (Di Giovanni et al. 2010). These observations suggest that the existence of synaptotagmin 1 has an important role in Ca2+-mediated membrane fusion. Interestingly, we could not detect synaptotagmin 1 in parathyroid adenomas. The absence of synaptotagmin 1 can at least partially give an explanation for the unusual Ca2+/calmodulin-inhibited hormone secretion in human parathyroid adenoma cells.

Calmidazolium induced an increase in [Ca2+]i, which is in agreement with previous findings reported in other cell types and species, such as endothelial cells (Watanabe et al. 1999) and hepatoma cells (Schlatterer & Schaloske 1996, Liao et al. 2009). As shown in Fig. 3B, addition of calmidazolium caused a dramatic increase in [Ca2+]i in the presence, but not in the absence, of [Ca2+]e. These findings suggest that the mechanism of increased [Ca2+]i by calmidazolium could be due to calcium influx, i.e. induction of Ca2+ leakage from intracellular stores followed by calcium influx. This action has been argued to be unrelated to calmodulin. However, calmodulin was reported to inhibit thapsigargin-induced Ca2+ current (Vaca 1996), interrupt activation of calcium influx through TRPC1 channels (Vaca & Sampieri 2002), and inhibit Ca2+ release from the endoplasmic reticulum in skeletal muscle (Buratti et al. 1995). These observations suggest that an increased [Ca2+]i induced by calmidazolium, as shown here in human parathyroid adenoma cells, may at least partially be calmodulin dependent.

The pCaMKII is active, whereas the dephosphorylated CaMKII is not. Autophosphorylation at threonine 286 residue increases the Ca/CaM affinity to CaMKII and prolongs the activated state of CaMKII. Since antibodies against pCaMKII γ and δ are not available, we verified the level of T-286 pCaMKII α and β. By analyzing 20 chief cell adenomas, we found that the levels of pCaMKII in the tumors were negatively correlated with the patients' total serum Ca2+ levels. In cellular studies, a remarkable reduction in CaMKII activity was seen after incubation of cells with 2.5 mM Ca2+, compared with 0.5 and 1.2 mM Ca2+. Taken together, our results clearly show that high calcium suppresses the CaMKII activity in human parathyroid cells. The pathophysiological role of CaMKII in human parathyroid is still, however, unclear.

In conclusion, our results show that calmodulin and CaMKII are involved in the regulation of PTH secretion. In addition, we show that the amount of active CaMKII, namely pCaMKII, is reduced by increased calcium. Further studies are needed to understand the function of calmodulin/CaMKII in parathyroid cells.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by grants from the Swedish Research Council, the Novo Nordisk Foundation, Funds of Karolinska Institutet, the Tore Nilsson Foundation, the Thuring Foundation, the Jeansson Foundations, the Åke Wiberg Foundation, the Göran Gustavsson Foundation for Research in Natural Sciences and Medicine, Magn. Bergvall Foundations, Cancer Research Funds of Radiumhemmet, the Stockholm County Council, the Swedish Cancer Foundation, and the Knut and Alice Wallenberg Foundation.

Acknowledgements

We thank Elisabet Ånfalk for excellent assistance in sample collection.

References

  • Almaden Y, Canalejo A, Ballesteros E, Anon G, Canadillas S & Rodriguez M 2002 Regulation of arachidonic acid production by intracellular calcium in parathyroid cells: effect of extracellular phosphate. Journal of the American Society of Nephrology 13 693698.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bhatt HS, Conner BP, Prasanna G, Yorio T & Easom RA 2000 Dependence of insulin secretion from permeabilized pancreatic β-cells on the activation of Ca(2+)/calmodulin-dependent protein kinase II. A re-evaluation of inhibitor studies. Biochemical Pharmacology 60 16551663 doi:10.1016/S0006-2952(00)00483-4.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brown EM, Dawson-Hughes BF, Wilson RE & Adragna N 1981 Calmodulin in dispersed human parathyroid cells. Journal of Clinical Endocrinology and Metabolism 53 10641071 doi:10.1210/jcem-53-5-1064.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Buratti R, Prestipino G, Menegazzi P, Treves S & Zorzato F 1995 Calcium dependent activation of skeletal muscle Ca2+ release channel (ryanodine receptor) by calmodulin. Biochemical and Biophysical Research Communications 213 10821090 doi:10.1006/bbrc.1995.2238.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Conigrave AD, Mun HC, Delbridge L, Quinn SJ, Wilkinson M & Brown EM 2004 l-amino acids regulate parathyroid hormone secretion. Journal of Biological Chemistry 279 3815138159 doi:10.1074/jbc.M406373200.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Grimelius L, Auerstrom G, Franssila KO, Eng C, DeLellis RA, Arnold A, Hendy GN, Bondeson L & Dupuy D 2004 Parathyroid Adenoma. In: DeLellis RA, Lloyd RV, Heitz PU & Eng C (eds) World Health Organization Classification of Tumours: Pathology and Genetics of Tumours of Endocrine Organs. Lyon: IARC Press, pp 128–133..

    • PubMed
    • Export Citation
  • Di Giovanni J, Iborra C, Maulet Y, Leveque C, El Far O & Seagar M 2010 Calcium-dependent regulation of SNARE-mediated membrane fusion by calmodulin. Journal of Biological Chemistry 285 2366523675 doi:10.1074/jbc.M109.096073.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Fischer R, Koller M, Flura M, Mathews S, Strehler-Page MA, Krebs J, Penniston JT, Carafoli E & Strehler EE 1988 Multiple divergent mRNAs code for a single human calmodulin. Journal of Biological Chemistry 263 1705517062.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Juhlin CC, Kiss NB, Villablanca A, Haglund F, Nordenstrom J, Hoog A & Larsson C 2010 Frequent promoter hypermethylation of the APC and RASSF1A tumour suppressors in parathyroid tumours. PLoS ONE 5 e9472 doi:10.1371/journal.pone.0009472.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kato M, Hagiwara M, Nimura Y, Shionoya S & Hidaka H 1991 Purification and characterization of calcium-calmodulin kinase II from human parathyroid glands. Journal of Endocrinology 131 155162 doi:10.1677/joe.0.1310155.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kifor O, MacLeod RJ, Diaz R, Bai M, Yamaguchi T, Yao T, Kifor I & Brown EM 2001 Regulation of MAP kinase by calcium-sensing receptor in bovine parathyroid and CaR-transfected HEK293 cells. American Journal of Physiology. Renal Physiology 280 F291F302.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kinder BK, Delahunt NG, Jamieson JD & Gorelick FS 1987 Calcium-calmodulin-dependent protein kinase in hyperplastic human parathyroid glands. Endocrinology 120 170177 doi:10.1210/endo-120-1-170.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lang J, Fukuda M, Zhang H, Mikoshiba K & Wollheim CB 1997 The first C2 domain of synaptotagmin is required for exocytosis of insulin from pancreatic β-cells: action of synaptotagmin at low micromolar calcium. EMBO Journal 16 58375846 doi:10.1093/emboj/16.19.5837.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liao WC, Huang CC, Cheng HH, Wang JL, Lin KL, Cheng JS, Chai KL, Hsu PT, Tsai JY & Fang YC et al. 2009 Effect of calmidazolium on [Ca2+]i and viability in human hepatoma cells. Archives of Toxicology 83 6168 doi:10.1007/s00204-008-0328-4.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lu M, Forsberg L, Hoog A, Juhlin CC, Vukojevic V, Larsson C, Conigrave AD, Delbridge LW, Gill A & Bark C et al. 2008 Heterogeneous expression of SNARE proteins SNAP-23, SNAP-25, Syntaxin1 and VAMP in human parathyroid tissue. Molecular and Cellular Endocrinology 287 7280 doi:10.1016/j.mce.2008.01.028.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lu M, Bränström R, Berglund E, Hoog A, Bjorklund P, Westin G, Larsson C, Farnebo LO & Forsberg L 2010 Expression and association of TRPC subtypes with Orai1 and STIM1 in human parathyroid. Journal of Molecular Endocrinology 44 285294 doi:10.1677/JME-09-0138.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nemeth EF, Wallace J & Scarpa A 1986 Stimulus-secretion coupling in bovine parathyroid cells. Dissociation between secretion and net changes in cytosolic Ca2+. Journal of Biological Chemistry 261 26682674.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Oldham SB, Lipson LG & Tietjen GE 1982 Presence of calmodulin in parathyroid adenomas. Mineral and Electrolyte Metabolism 7 273280.

  • Schlatterer C & Schaloske R 1996 Calmidazolium leads to an increase in the cytosolic Ca2+ concentration in Dictyostelium discoideum by induction of Ca2+ release from intracellular stores and influx of extracellular Ca2+. Biochemical Journal 313 661667.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schweitzer ES, Sanderson MJ & Wasterlain CG 1995 Inhibition of regulated catecholamine secretion from PC12 cells by the Ca2+/calmodulin kinase II inhibitor KN-62. Journal of Cell Science 108 26192628.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Shoback D, Thatcher J, Leombruno R & Brown E 1983 Effects of extracellular Ca++ and Mg++ on cytosolic Ca++ and PTH release in dispersed bovine parathyroid cells. Endocrinology 113 424426 doi:10.1210/endo-113-1-424.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Shoback DM, Thatcher J, Leombruno R & Brown EM 1984 Relationship between parathyroid hormone secretion and cytosolic calcium concentration in dispersed bovine parathyroid cells. PNAS 81 31133117 doi:10.1073/pnas.81.10.3113.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Stefani G, Onofri F, Valtorta F, Vaccaro P, Greengard P & Benfenati F 1997 Kinetic analysis of the phosphorylation-dependent interactions of synapsin I with rat brain synaptic vesicles. Journal of Physiology 504 501515 doi:10.1111/j.1469-7793.1997.501bd.x.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vaca L 1996 Calmodulin inhibits calcium influx current in vascular endothelium. FEBS Letters 390 289293 doi:10.1016/0014-5793(96)00675-8.

  • Vaca L & Sampieri A 2002 Calmodulin modulates the delay period between release of calcium from internal stores and activation of calcium influx via endogenous TRP1 channels. Journal of Biological Chemistry 277 4217842187 doi:10.1074/jbc.M204531200.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang ZW 2008 Regulation of synaptic transmission by presynaptic CaMKII and BK channels. Molecular Neurobiology 38 153166 doi:10.1007/s12035-008-8039-7.

  • Watanabe H, Takahashi R, Tran QK, Takeuchi K, Kosuge K, Satoh H, Uehara A, Terada H, Hayashi H & Ohno R et al. 1999 Increased cytosolic Ca(2+) concentration in endothelial cells by calmodulin antagonists. Biochemical and Biophysical Research Communications 265 697702 doi:10.1006/bbrc.1999.1755.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yamamoto H, Matsumoto K, Araki E & Miyamoto E 2003 New aspects of neurotransmitter release and exocytosis: involvement of Ca2+/calmodulin-dependent phosphorylation of synapsin I in insulin exocytosis. Journal of Pharmacological Sciences 93 3034 doi:10.1254/jphs.93.30.

    • PubMed
    • Search Google Scholar
    • Export Citation

 

  • Collapse
  • Expand
  • Expression of calmodulin and CaMKII in human parathyroid. (A) RT-PCR analysis for agarose gel electrophoresis showing products of CALM13, CAMK2A, CAMK2B, CAMK2G, and CAMK2D genes in normal (N) and adenoma parathyroids, and human brain (P) used as control. Products were verified by sequencing expected for CAMK2A in parathyroid adenoma and normal. (B) Autoradiograms of western blots demonstrate protein expression of calmodulin and total CaMKII at expected product sizes in both normal and adenoma parathyroid.

  • Effect of calmidazolium and KN-62 on PTH secretion. (A–D) Addition of 1 and 10 μM calmidazolium and 10 and 20 μM KN-62 at 1.5 mM Ca2+ caused an increase in PTH secretion. As summarized in (E), calmidazolium and KN-62 increased PTH secretion in a dose-dependent manner (*P<0.05; **P<0.01). The bars refer to time points of maximal observed effect.

  • Measurement of [Ca2+]i using Fura-2 and determination of ratios for 340/380 nm emitted fluorescence (F340/380). (A) Application of 1 μM calmidazolium did not cause a significant change of [Ca2+]i, however, 10 μM calmidazolium induced an increase in [Ca2+]i. (B) In the absence of Ca2+, 10 μM calmidazolium only induced a small transient increase in [Ca2+]i, however, addition of 1.5 mM Ca2+ caused a higher constant increase in [Ca2+]i; (C) 10 and 20 μM KN-62 had no effect on [Ca2+]i.

  • Demonstration of phospharylated CaMKII (pCaMKII) expression in parathyroid adenoma. (A) Western blot analysis of calmodulin and pCaMKII (pT286) protein in 20 parathyroid adenomas (No. 1–20). β-Actin served as loading control. (B) There was a negative correlation between total serum Ca2+ and pCaMKII in the tumors. (C) The amount of pCaMKII in human parathyroid adenoma cells was reduced when extracellular Ca2+ was increased during 1 h incubation whereas no change on calmodulin was seen with the same treatment. The effect on pCaMKII level at different extracellular Ca2+ concentrations is summarized in (D) (*P<0.05, NS P>0.05). (E) The amount of pCaMKII at 2.5 mM Ca2+ was reduced at 20 min.

  • Absence of synaptotagmin 1 expression in human parathyroid adenomas. Western blot analysis demonstrated a product of expected size for synaptotagmin 1 in INS-1 cells (P), but not in human parathyroid adenomas. Subsequent incubation with anti-β-actin demonstrated equal loading between the lanes.

  • Almaden Y, Canalejo A, Ballesteros E, Anon G, Canadillas S & Rodriguez M 2002 Regulation of arachidonic acid production by intracellular calcium in parathyroid cells: effect of extracellular phosphate. Journal of the American Society of Nephrology 13 693698.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Bhatt HS, Conner BP, Prasanna G, Yorio T & Easom RA 2000 Dependence of insulin secretion from permeabilized pancreatic β-cells on the activation of Ca(2+)/calmodulin-dependent protein kinase II. A re-evaluation of inhibitor studies. Biochemical Pharmacology 60 16551663 doi:10.1016/S0006-2952(00)00483-4.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Brown EM, Dawson-Hughes BF, Wilson RE & Adragna N 1981 Calmodulin in dispersed human parathyroid cells. Journal of Clinical Endocrinology and Metabolism 53 10641071 doi:10.1210/jcem-53-5-1064.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Buratti R, Prestipino G, Menegazzi P, Treves S & Zorzato F 1995 Calcium dependent activation of skeletal muscle Ca2+ release channel (ryanodine receptor) by calmodulin. Biochemical and Biophysical Research Communications 213 10821090 doi:10.1006/bbrc.1995.2238.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Conigrave AD, Mun HC, Delbridge L, Quinn SJ, Wilkinson M & Brown EM 2004 l-amino acids regulate parathyroid hormone secretion. Journal of Biological Chemistry 279 3815138159 doi:10.1074/jbc.M406373200.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Grimelius L, Auerstrom G, Franssila KO, Eng C, DeLellis RA, Arnold A, Hendy GN, Bondeson L & Dupuy D 2004 Parathyroid Adenoma. In: DeLellis RA, Lloyd RV, Heitz PU & Eng C (eds) World Health Organization Classification of Tumours: Pathology and Genetics of Tumours of Endocrine Organs. Lyon: IARC Press, pp 128–133..

    • PubMed
    • Export Citation
  • Di Giovanni J, Iborra C, Maulet Y, Leveque C, El Far O & Seagar M 2010 Calcium-dependent regulation of SNARE-mediated membrane fusion by calmodulin. Journal of Biological Chemistry 285 2366523675 doi:10.1074/jbc.M109.096073.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Fischer R, Koller M, Flura M, Mathews S, Strehler-Page MA, Krebs J, Penniston JT, Carafoli E & Strehler EE 1988 Multiple divergent mRNAs code for a single human calmodulin. Journal of Biological Chemistry 263 1705517062.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Juhlin CC, Kiss NB, Villablanca A, Haglund F, Nordenstrom J, Hoog A & Larsson C 2010 Frequent promoter hypermethylation of the APC and RASSF1A tumour suppressors in parathyroid tumours. PLoS ONE 5 e9472 doi:10.1371/journal.pone.0009472.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kato M, Hagiwara M, Nimura Y, Shionoya S & Hidaka H 1991 Purification and characterization of calcium-calmodulin kinase II from human parathyroid glands. Journal of Endocrinology 131 155162 doi:10.1677/joe.0.1310155.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kifor O, MacLeod RJ, Diaz R, Bai M, Yamaguchi T, Yao T, Kifor I & Brown EM 2001 Regulation of MAP kinase by calcium-sensing receptor in bovine parathyroid and CaR-transfected HEK293 cells. American Journal of Physiology. Renal Physiology 280 F291F302.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Kinder BK, Delahunt NG, Jamieson JD & Gorelick FS 1987 Calcium-calmodulin-dependent protein kinase in hyperplastic human parathyroid glands. Endocrinology 120 170177 doi:10.1210/endo-120-1-170.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lang J, Fukuda M, Zhang H, Mikoshiba K & Wollheim CB 1997 The first C2 domain of synaptotagmin is required for exocytosis of insulin from pancreatic β-cells: action of synaptotagmin at low micromolar calcium. EMBO Journal 16 58375846 doi:10.1093/emboj/16.19.5837.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Liao WC, Huang CC, Cheng HH, Wang JL, Lin KL, Cheng JS, Chai KL, Hsu PT, Tsai JY & Fang YC et al. 2009 Effect of calmidazolium on [Ca2+]i and viability in human hepatoma cells. Archives of Toxicology 83 6168 doi:10.1007/s00204-008-0328-4.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lu M, Forsberg L, Hoog A, Juhlin CC, Vukojevic V, Larsson C, Conigrave AD, Delbridge LW, Gill A & Bark C et al. 2008 Heterogeneous expression of SNARE proteins SNAP-23, SNAP-25, Syntaxin1 and VAMP in human parathyroid tissue. Molecular and Cellular Endocrinology 287 7280 doi:10.1016/j.mce.2008.01.028.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Lu M, Bränström R, Berglund E, Hoog A, Bjorklund P, Westin G, Larsson C, Farnebo LO & Forsberg L 2010 Expression and association of TRPC subtypes with Orai1 and STIM1 in human parathyroid. Journal of Molecular Endocrinology 44 285294 doi:10.1677/JME-09-0138.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Nemeth EF, Wallace J & Scarpa A 1986 Stimulus-secretion coupling in bovine parathyroid cells. Dissociation between secretion and net changes in cytosolic Ca2+. Journal of Biological Chemistry 261 26682674.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Oldham SB, Lipson LG & Tietjen GE 1982 Presence of calmodulin in parathyroid adenomas. Mineral and Electrolyte Metabolism 7 273280.

  • Schlatterer C & Schaloske R 1996 Calmidazolium leads to an increase in the cytosolic Ca2+ concentration in Dictyostelium discoideum by induction of Ca2+ release from intracellular stores and influx of extracellular Ca2+. Biochemical Journal 313 661667.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Schweitzer ES, Sanderson MJ & Wasterlain CG 1995 Inhibition of regulated catecholamine secretion from PC12 cells by the Ca2+/calmodulin kinase II inhibitor KN-62. Journal of Cell Science 108 26192628.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Shoback D, Thatcher J, Leombruno R & Brown E 1983 Effects of extracellular Ca++ and Mg++ on cytosolic Ca++ and PTH release in dispersed bovine parathyroid cells. Endocrinology 113 424426 doi:10.1210/endo-113-1-424.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Shoback DM, Thatcher J, Leombruno R & Brown EM 1984 Relationship between parathyroid hormone secretion and cytosolic calcium concentration in dispersed bovine parathyroid cells. PNAS 81 31133117 doi:10.1073/pnas.81.10.3113.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Stefani G, Onofri F, Valtorta F, Vaccaro P, Greengard P & Benfenati F 1997 Kinetic analysis of the phosphorylation-dependent interactions of synapsin I with rat brain synaptic vesicles. Journal of Physiology 504 501515 doi:10.1111/j.1469-7793.1997.501bd.x.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Vaca L 1996 Calmodulin inhibits calcium influx current in vascular endothelium. FEBS Letters 390 289293 doi:10.1016/0014-5793(96)00675-8.

  • Vaca L & Sampieri A 2002 Calmodulin modulates the delay period between release of calcium from internal stores and activation of calcium influx via endogenous TRP1 channels. Journal of Biological Chemistry 277 4217842187 doi:10.1074/jbc.M204531200.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Wang ZW 2008 Regulation of synaptic transmission by presynaptic CaMKII and BK channels. Molecular Neurobiology 38 153166 doi:10.1007/s12035-008-8039-7.

  • Watanabe H, Takahashi R, Tran QK, Takeuchi K, Kosuge K, Satoh H, Uehara A, Terada H, Hayashi H & Ohno R et al. 1999 Increased cytosolic Ca(2+) concentration in endothelial cells by calmodulin antagonists. Biochemical and Biophysical Research Communications 265 697702 doi:10.1006/bbrc.1999.1755.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • Yamamoto H, Matsumoto K, Araki E & Miyamoto E 2003 New aspects of neurotransmitter release and exocytosis: involvement of Ca2+/calmodulin-dependent phosphorylation of synapsin I in insulin exocytosis. Journal of Pharmacological Sciences 93 3034 doi:10.1254/jphs.93.30.

    • PubMed
    • Search Google Scholar
    • Export Citation