Experience with lentivirus-mediated CD40 gene silencing in a mouse model of Graves' disease

in Journal of Endocrinology

CD40 plays an important role in the pathogenesis of Graves' disease (GD). Inhibition of CD40 expression may be a promising treatment for GD. In this study, we used an animal model to investigate whether lentivirus expressing siRNA for CD40 (LV-CD40-siRNA) could be useful for the therapy of GD. BALB/c mice were injected with PBS alone (PBS group), negative lentivirus (control siRNA group), or LV-CD40-siRNA (CD40 siRNA group), 3 days before being treated with adenovirus expressing human TSHR A subunit (Ad-TSHR289) three times at 3-week intervals to induce GD model. Sera thyroxine (T4) levels were assayed by RIA. The expression of CD40 was detected at the mRNA level by real-time PCR and protein level by flow cytometry. The expression of CD40, CD80, and CD86 was significantly decreased in the CD40 siRNA group (P<0.05), while FOXP3 expression was increased compared to the control siRNA group (P=0.05). Mean T4 levels were decreased 14% in the CD40 siRNA group compared to the control siRNA group. The rate of disease induction was similar among the three groups injected with Ad-TSHR289. LV-CD40-siRNA is a useful tool to inhibit the expression of CD40 in vivo, but it cannot decrease the incidence of hyperthyroidism in a limited period of time.

Abstract

CD40 plays an important role in the pathogenesis of Graves' disease (GD). Inhibition of CD40 expression may be a promising treatment for GD. In this study, we used an animal model to investigate whether lentivirus expressing siRNA for CD40 (LV-CD40-siRNA) could be useful for the therapy of GD. BALB/c mice were injected with PBS alone (PBS group), negative lentivirus (control siRNA group), or LV-CD40-siRNA (CD40 siRNA group), 3 days before being treated with adenovirus expressing human TSHR A subunit (Ad-TSHR289) three times at 3-week intervals to induce GD model. Sera thyroxine (T4) levels were assayed by RIA. The expression of CD40 was detected at the mRNA level by real-time PCR and protein level by flow cytometry. The expression of CD40, CD80, and CD86 was significantly decreased in the CD40 siRNA group (P<0.05), while FOXP3 expression was increased compared to the control siRNA group (P=0.05). Mean T4 levels were decreased 14% in the CD40 siRNA group compared to the control siRNA group. The rate of disease induction was similar among the three groups injected with Ad-TSHR289. LV-CD40-siRNA is a useful tool to inhibit the expression of CD40 in vivo, but it cannot decrease the incidence of hyperthyroidism in a limited period of time.

Keywords:

Introduction

In general population, the prevalence of Graves' disease (GD) is ∼0.5%, and is the underlying cause of 60–80% of hyperthyroidism (Weetman 2000, Brent 2008). It is an organ-specific autoimmune disease in which thyroid-stimulating antibody stimulates the TSH receptor (TSHR) leading to overproduction of thyroid hormones and diffuse hyperplasia of the thyroid gland. The mechanisms for breakdown of immune tolerance to the TSHR remain obscure as described in Saitoh et al. (2007). The present treatment modalities include antithyroid drugs, radioactive iodine, and thyroidectomy. Although these are useful, they have limitations and have remained essentially unchanged for 50 years as described by Gilbert et al. (2006). These authors showed reduced hyperthyroidism in mice with on-going GD using decoy molecules of tumor necrosis factor (TNF) family ligand inhibitors to target B lymphocyte proliferation or survival factors. These studies indicate the importance of investigating additional novel therapeutic approaches.

RNA interference is a posttranscriptional mechanism of gene silencing, in which 19–23 nucleotide double-stranded RNA duplexes promote specific endonucleolytic cleavage of mRNA targets called small interfering RNA (siRNA) as described in Raoul et al. (2005) and Suzuki et al. (2008). Gene silencing using siRNA is an extremely efficient, specific, long-lasting, and simple method for blocking the expression of target genes as described by Hill et al. (2003). It has been successfully used in animal models of various diseases and is currently in clinical trials (de Fougerolles et al. 2007). However, the utility of gene silencing as a treatment for hyperthyroidism has not yet been reported.

CD40 is a member of the TNF receptor superfamily. It is expressed by a wide variety of cell types, including B cells, dendritic cells (DCs), fibroblasts, endothelial cells, macrophages, and thyrocytes (Smith et al. 1999). The interaction between CD40 and its cognate ligand CD40L (CD154) provides a costimulatory signal that mediates T-cell maturation, B-cell proliferation, immunoglobulin production, isotype class switching, and generation of memory cells and provides an additional maturation signal to antigen presenting cells (APCs; Sempowski et al. 1998). Blocking the interaction between CD40 and CD154 is beneficial in animal models of autoimmune diseases (Durie et al. 1993, Gerritse et al. 1996, Carayanniotis et al. 1997). It is also reported that the CD40/CD154 interaction may represent an important mechanism in the regulation of the autoimmune humoral response in GD (Mysliwiec et al. 2007). Thus, inhibition of CD40 expression may be a promising treatment for GD.

A previous study has shown that blocking CD40/CD154 interaction by adenovirus expressing CD40-Lg could reduce the incidence of hyperthyroidism (Chen et al. 2006). However, the exact mechanism was not clarified and neither was the mechanism for the inhibition of hyperthyroidism in the Ad-TSHR289-induced GD animal model by the adenovirus vector. The effect of CD40 inhibition on GD thus needs further investigation. Hence, in this study, we have used lentivirus as a gene delivery vector to investigate whether LV-CD40-siRNA-induced posttranscriptional CD40 gene silencing could reduce the incidence of hyperthyroidism in Ad-TSHR289-induced GD animal model and the possible mechanisms.

Materials and Methods

Construction of TSHR adenoviruses

Construction of Ad-TSHR289 was performed as previously described (Chen et al. 2003, Saitoh & Nagayama 2006). Briefly, adenoviruses (Ad-TSHR289) were propagated in HEK293 cells and purified by ion-exchange column chromatography. The concentration of viral particles was determined by measuring the absorbance at 260 nm, and they were stored at −80 °C.

Construction of LV-CD40-siRNA

The lentivector used in this study was designed to coexpress green fluorescent protein (GFP). The sequence of the siRNA-targeting murine CD40 was gaTGGTAAAGAGAGTCGCATC. Pairs of complementary oligonucleotides containing these sequences were synthesized and cloned into the PGCL-GFP Lentivector; 293T cells were cotransfected with plasmid pHelper1.0, pHelper2.0, and the PGCL-GFP Lentivector containing the shRNA sequences using Lipofectamine 2000 (Invitrogen). Viral supernatants were harvested after 48 h, and the titers were determined with serial dilutions of concentrated lentivirus.

Immunization and treatment

Thirty-two 6–8-week-old female BALB/c mice were purchased and housed in a specific pathogen-free facility at the Experimental Animal Center of the Fourth Military Medical University (Xi'an, P R China). Room temperature (23±1 °C), humidity (50±10%), and a 12 h light:12 h darkness cycle were strictly controlled. Mice were randomly divided into four groups and provided with food pellets and water ad libitum. One group of mice was injected with 50 μl PBS as the PBS-treated mice and the other three groups of mice were injected i.v. with PBS alone (PBS group), negative lentivirus (control siRNA group), or LV-CD40-siRNA (CD40 siRNA group) 3 days before being treated with Ad-TSHR289, which was injected i.m. three times at 3-week interval to induce hyperthyroidism. Blood, spleen, and thyroid tissues were obtained 4 weeks after the third immunization. All experiments were conducted in accordance with the principles and procedures outlined in the Guideline for the Care and Use of Laboratory Animals at Xi'an Jiaotong University.

Thyroxine and TRAb measurements

Total serum thyroxine (T4) was measured with an RIA kit (Beijing Atom High Tech Co., Ltd, Beijing, China). The normal range was defined as mean±3 s.d. of the PBS-treated mice. TRAb values were determined using human recombinant TSHR protein (a TRAb kit, BRAHMS Diagnostica GmbH, Berlin, Germany).

Histology

Thyroid tissues were removed and fixed in 4% formalin. Sections were examined at 3–5 μm intervals and were stained with hematoxylin and eosin. Analysis was performed using an Olympus Cue-2 image analysis system connected to an Olympus compound microscope.

Flow cytometry analysis

To analyze surface expression of CD40, CD80, and CD86, 1×106 splenocytes were stained with PE, FITC, or APC-conjugated Ab or the appropriate isotype-controlled Ab respectively, in a final volume of 100 μl for 60 min in dark (eBioscience, San Diego, CA, USA), followed by washing twice in 1 ml of cold flow cytometry wash buffer (PBS with 1% BSA). The cells were then resuspended in 300 μl PBS, and protein expression was analyzed using a FACScan apparatus (BD Biosciences, San Jose, CA, USA). To analyze FOXP3 expression, 1×106 splenocytes were stained with anti-CD4-PerCP-cy5.5 and anti-CD25-APC antibodies (eBioscience) for 30 min and incubated with fixation/permeabilization solution. After 30 min incubation, cells were washed twice with permeabilization buffer and incubated with anti-FOXP3-PE for 30 min.

Real-time PCR

Total RNA was isolated from the spleens using RNAfast200 purification kit (Fastagen Biotech, Shanghai, China) according to the manufacturer's protocol. The RNA was subsequently reverse transcribed using a RevertAid First Strand cDNA Synthesis kit (Fermentas, Vilnius, Lithuania). The primer sequences were designed using Primer Express (Applied Biosystems, Foster City, CA, USA) (shown in Table 1). Quantitative PCR assay was performed in triplicate for each sample in a final reaction mixture of 20 μl containing SYBR Premix Ex TaqTM II PCR Master Mix (TakaRa, Dalian, China) and 0.25 μM of each primer. After an initial denaturation step at 95 °C for 10 s, 40 cycles of 5 s at 95 °C, 15 s at 55 °C, and 15 s at 72 °C were run on an IQ5 Real-Time PCR Detection System (Bio-Rad). Mouse β-actin mRNA was used for normalization to ensure equal amounts of starting RNA. The specificity of real-time quantitative PCR for all these genes was confirmed by running the PCR products on a 2% agarose gel to show single specific bands at the expected sizes (data not shown).

Table 1

Primer sequences used in this study for real-time quantitative RT-PCR analysis

GeneForwardReverseProduct size (bp)
CD40GCCATCGTGGAGGTACTGTTCTGCGATGGTGTCTTTGCCT110
CD80GGCAAGGCAGCAATACCTTACTCTTTGTGCTGCTGATTCG94
CD86TCTCCACGGAAACAGCATCTCTTACGGAAGCACCCATGAT100
FOXP3CTCGTCTGAAGGCAGAGTCATGGCAGAGAGGTATTGAGGG106
β-actinCCAGGCATTGCTGACAGGGCTGGAAGGTGGACAGTG142

FOXP3, the forkhead family transcription factor.

Statistical analysis

All comparisons between the groups were performed using either Student's t-test or ANOVA, and P values <0.05 were considered statistically significant.

Results

Silencing CD40 in vivo using LV-CD40-siRNA

During in vitro experiments, we observed that mature DCs (mDCs) expressed high levels of CD40 and these were significantly decreased by LV-CD40-siRNA (data not shown). We subsequently investigated the ability of LV-CD40-siRNA to suppress CD40 expression of splenocytes in vivo. Mice were killed 4 weeks after the third immunization with Ad-TSHR289. The silencing effects of LV-CD40-siRNA were detected at the mRNA level by real-time PCR and protein level by flow cytometry as compared with negative lentivirus. As shown in Fig. 1, CD40 expression was significantly lower in the CD40 siRNA group than the control siRNA group (P<0.05), at both RNA and protein levels. CD40 expression did not differ significantly between the PBS group and the control siRNA groups (Fig. 1). Our data thus showed the feasibility and efficacy of LV-CD40-siRNA on downregulating the expression of CD40 in splenocytes in vivo. Lenivirus did not influence the expression of CD40 in vivo.

Figure 1
Figure 1

LV-CD40-siRNA inhibits the expression of CD40 in vivo. Three days prior to immunization with Ad-TSHR289, three groups of mice were treated with either PBS alone, LV, or LV-CD40-siRNA respectively. Splenic tissues were obtained 4 weeks after the third immunization. Eight tissues in each group were studied. The error bars represent standard error in each group. (A) CD40 expression was determined by real-time PCR in Ad-TSHR289 immunized mice. (B) CD40 expression was determined by flow cytometry and the mean count in each group is shown. Splenocytes were stained with PE-labeled anti-CD40 Ab and analyzed by flow cytometry. Details are described in section ‘Materials and Methods’. *P<0.05 versus control siRNA group.

Citation: Journal of Endocrinology 208, 3; 10.1677/JOE-10-0224

Thyroid function after virus immunizations

Serum T4 levels were measured 4 weeks after the third injection of Ad-TSHR289. Mice with serum T4 levels higher than mean±3 s.d. of PBS-treated mice were considered hyperthyroid. In this study, compared with the PBS-treated mice, 75% (6/8) of mice immunized with Ad-TSHR289 and treated with PBS (PBS group) became hyperthyroid. Sixty-three percent (5/8) of mice immunized with Ad-TSHR289 and treated with negative lentivirus (control siRNA group) or LV-CD40-siRNA (CD40 siRNA group) became hyperthyroid. Although there was no significant difference in the rate of disease induction among these three groups, mean T4 levels in the CD40 siRNA group were much lower than the other two (Fig. 2A). Mean T4 levels were similar between the PBS group and the control siRNA group (Fig. 2A) and there was a 14% decrease in the CD40 siRNA group compared to the control siRNA group, although this difference was not statistically significant. We subsequently measured TRAb in all of the mice and found that mice injected with Ad-TSHR289, no matter hyperthyroid or euthyroid, had significantly higher TRAb compared with the PBS-treated mice (Fig. 2B). Next, we investigated whether the hyperthyroid BALB/c mice as judged by T4 levels displayed histological changes. Unlike euthyroid or control mice, all the hyperthyroid BALB/c mice had diffuse goiters and hyperplastic follicles with cuboidal or columnar thyroid epithelial cells, but no lymphocytic infiltration as previously reported (Saitoh & Nagayama 2006).

Figure 2
Figure 2

The effect of LV-CD40-siRNA on hyperthyroidism. (A) Mean serum T4 levels in each group. Mice were immunized with 1×109 particles Ad-TSHR289 per injection on three occasions at 3-week intervals. Serum T4 levels were measured 4 weeks after the third injection. (B) Serum TRAb levels in BALB/c mice immunized with adenovirus expressing the TSHR extracellular A subunit (Ad-TSHR289). The shaded area represents the mean±3 s.d. for serum TRAB levels in mice immunized with PBS (PBS-treated mice).

Citation: Journal of Endocrinology 208, 3; 10.1677/JOE-10-0224

Alterations of other costimulatory molecules by CD40 silencing

DCs play an essential role in immune homeostasis. mDCs act as potent APCs, stimulating T-cell activation, whereas immature DCs (iDCs) characterized as low expression of costimulatory molecules (CD40, CD80, and CD86) induce peripheral T-cell tolerance (Chorny et al. 2006). In vitro experiments showed that mDCs expressed high levels of CD80 and CD86, and they were significantly decreased by CD40 downregulation (data not shown). In this study, we used an siRNA approach to explore the effect of CD40 downregulation on the expression of CD80 and CD86 in splenocytes in vivo. As shown in Fig. 3, the expressions of CD80 and CD86 were significantly decreased in the CD40 siRNA group compared to the control siRNA group (P<0.05). There was no significant difference in the expression of CD80 between the control siRNA group and the PBS group (Fig. 3A). However, a significant difference was found in the expression of CD86 between the control siRNA group and the PBS group (Fig. 3B), suggesting that lentivirus can affect the expression of some costimulatory molecules through certain unknown molecular mechanisms. Moreover, we also analyzed the expression of CD80 and CD86 on the surface of splenocytes by flow cytometry. Fewer CD80 and CD86 positive cells were found in the CD40 siRNA group compared with the other two groups, which was consistent with the results of mRNA, although no significant difference was noted (data not shown).

Figure 3
Figure 3

The effect of LV-CD40-siRNA on the expression of other costimulatory molecules. Three days prior to immunization with Ad-TSHR289, three groups of mice were treated with either PBS alone, LV, or LV-CD40-siRNA respectively. Splenic tissues were obtained 4 weeks after the third immunization. Eight tissues in each group were studied. The error bars represent standard error in each group. Total RNA was extracted from splenic tissues and real-time PCR was performed to investigate the expression of CD80 (A) and CD86 (B) as described in section ‘Materials and Methods’. *P<0.05 when compared to control siRNA group; P<0.05 when compared to PBS group.

Citation: Journal of Endocrinology 208, 3; 10.1677/JOE-10-0224

Alteration of immune response by CD40 silencing

T regulatory cells (Tregs) are essential for maintaining immunological self-tolerance and immune homeostasis (Wing et al. 2008), which play an important role in autoimmune diseases. It has been reported that a blockade of the CD40/CD40L interaction actively generates Treg cells (Suzuki et al. 2009). We thus used our own mouse model to explore the effect of CD40 siRNA on the expression of FOXP3 in splenocytes in vivo using real-time PCR. As shown in Fig. 4, the treatment of CD40 siRNA dramatically increased FOXP3 gene expression compared with the control siRNA (P=0.05) or PBS group (P<0.05). We also used flow cytometry to determine whether treatment of CD40 siRNA can increase the number of Treg cells in vivo. The proportion of Treg cells in CD40 siRNA group were also increased compared with the other two groups although there were no significant differences (data not shown).

Figure 4
Figure 4

Immune modulation by LV-CD40-siRNA in vivo. Three days prior to immunization with Ad-TSHR289, three groups of mice were treated with either PBS alone, LV, or LV-CD40-siRNA respectively. Splenic tissues were obtained at 4 weeks after the third immunization. Eight tissues in each group were studied. The error bars represent standard error in each group. Total RNA was extracted from splenic tissues and real-time PCR was performed using specific primers of FOXP3 as described in section ‘Materials and Methods’. P<0.05 when compared to PBS group.

Citation: Journal of Endocrinology 208, 3; 10.1677/JOE-10-0224

Discussion

The GD animal model, induced by immunization with adenovirus expressing the TSHR, is the most widely used model to study the pathogenesis and therapy of GD. In this study, six of eight BALB/c mice (75%) immunized with Ad-TSHR289 became hyperthyroid, which is consistent with the previous study (Chen et al. 2004).

CD40/CD40L signaling plays an important role in humoral and cellular immunity. Deregulation of this signaling pathway was found to be associated with human autoimmune and inflammatory diseases (Law & Grewal 2009). Some success in treatment of various diseases has been achieved in animal models by inhibition of CD40 expression (Durie et al. 1993, Carayanniotis et al. 1997, Suzuki et al. 2009, Zheng et al. 2009). Lentiviral vectors have become a promising tool in gene therapy including transgenesis and functional knockdown due to highly efficient transduction, rare preexisting immunity, and persistent expression (Dullaers et al. 2006, Park 2007). In this study, we successfully used LV-CD40-siRNA to inhibit the expression of CD40 in vivo both at RNA and protein levels. This may be a new method for exploring the feasibility of gene therapy by CD40 gene silencing.

CD40 over expression plays a role in the pathogenesis of GD through stimulation of T-cell maturation, activating B cells, and inhibiting thyrocyte apoptosis (Faure et al. 1997, Kie et al. 2001, Tomer et al. 2002, Jacobson & Tomer 2007). Inhibition of CD40 expression may be a prospective treatment for GD. In this study, we found that LV-CD40-siRNA attenuated disease severity in a GD animal model, as reflected by T4 level.

The following reasons might explain the observations of this study. First, GD is an organ-specific autoimmune disease and the main organ involved is the thyroid gland. Although we have effectively used LV-CD40-siRNA to inhibit the CD40 expression in spleen, this does not mean that it had an appreciable effect on the thyroid. If we can directly inject LV-CD40-siRNA into the thyroid locally, perhaps it will play a greater role. Secondly, CD80 and CD86 are also required for effective activation of T lymphocytes. In this study, real-time PCR (a very sensitive technique) data demonstrated decreased amounts of CD80 and CD86 mRNA in splenic tissue from mice pretreated with LV-CD40-siRNA compared with PBS or control siRNA, however, no significant differences were obtained by flow cytometry, indicating that the protein levels may not have been significantly reduced due to unknown complicated mechanisms in vivo. It is not sufficient to affect the occurrence of hyperthyroidism. Thirdly, the lack of uniform effect of CD40 silencing on the incidence of hyperthyroidism does not rule out the possibility of a link between these two events. Fourth, it remains to be investigated whether the effect of CD40 silencing on hyperthyroidism may be a long-term consequence. Finally, the current results may be a result of the relatively small number of study animals. Further study with more animals is thus needed.

CD4+CD25+FOXP3+ Treg cells develop in the thymus and peripheral lymphatic or immune organs, and represent 5–10% of the peripheral CD4+T-cell compartment (Sakaguchi 2005, Saitoh & Nagayama 2006). These cells suppress the expression of CD80 and CD86, and hamper the proliferation of effector CD4+T cells as well as the maturation of DCs (Saitoh & Nagayama 2006, Wing et al. 2008). Recently, Treg cells have been demonstrated to efficiently influence autoimmune disease (Cheng et al. 2008). A previous study showed that regulatory T cells play an important role in the mechanism involved in both susceptibility and severity of GD (Saitoh & Nagayama 2006). In this study, we found that mRNA levels of FOXP3 were dramatically increased and the number of Treg cells was mildly increased in the mice treated with LV-CD40-siRNA. We speculate that increased Treg cells partially dampen the severity of hyperthyroidism in the CD40 siRNA group.

A previous study showed that coimmunization with a second adenovirus, regardless of the nature of its insert, markedly reduced TSHR antibody level and the incidence of hyperthyroidism induced by Ad-TSHR289 (Chen et al. 2006), which seriously limits the use of Ad vectors in such animal models of GD. In this study, our findings showed that re-administration of lentivirus vectors to the GD model did not affect the incidence of hyperthyroidism. Recently, a number of studies showed that Ad-specific effector and memory T cells can be quickly activated following Ad vector administration concomitant with production of proinflammatory cytokines and chemokines, which may be responsible for reduced therapeutic efficacies of this vector (Thacker et al. 2009). However, lentivirus vectors are less likely to stimulate systemic immune responses (Sinn et al. 2008), suggesting that lentivirus is a suitable vector to study the pathogenesis and therapy of GD in animal model induced by Ad-TSHR289, although molecular mechanisms remain unclear.

In summary, we tried a novel immune blocker for preventing the occurrence of GD through lentivirus-mediated CD40 gene silencing in an animal model. We demonstrated that LV-CD40-siRNA is a powerful tool for inhibiting the expression of CD40 in vivo, which can partially lighten the severity of GD in animal model, although it did not decrease the incidence of hyperthyroidism in a limited period of time. It might be a potential future clinical adjunctive therapy in the prevention and intervention of hyperthyroidism.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by the National Natural Science Foundation of China (30500250.) and the Fundamental Research Funds for the Central Universities.

Acknowledgements

We thank Drs Basil Rapoport, Sandra M McLachlan, and Chunrong Chen (University of California, Los Angeles, CA, USA) for providing us the plasmid expressing human TSHR289 (psv2-neo-ECE).

References

  • BrentGA2008Clinical practice. Graves' disease. New England Journal of Medicine35825942605doi:10.1056/NEJMcp0801880.

  • CarayanniotisGMastersSRNoelleRJ1997Suppression of murine thyroiditis via blockade of the CD40–CD40L interaction. Immunology90421426doi:10.1111/j.1365-2567.1997.00421.x.

    • Search Google Scholar
    • Export Citation
  • ChenCRPichurinPNagayamaYLatrofaFRapoportBMcLachlanSM2003The thyrotropin receptor autoantigen in Graves disease is the culprit as well as the victim. Journal of Clinical Investigation11118971904doi:10.1172/JCI17069.

    • Search Google Scholar
    • Export Citation
  • ChenCRPichurinPChazenbalkGDAlieskyHNagayamaYMcLachlanSMRapoportB2004Low-dose immunization with adenovirus expressing the thyroid-stimulating hormone receptor A-subunit deviates the antibody response toward that of autoantibodies in human Graves' disease. Endocrinology145228233doi:10.1210/en.2003-1134.

    • Search Google Scholar
    • Export Citation
  • ChenCRAlieskyHAGuoJRapoportBMcLachlanSM2006Blockade of costimulation between T cells and antigen-presenting cells: an approach to suppress murine Graves' disease induced using thyrotropin receptor-expressing adenovirus. Thyroid16427434doi:10.1089/thy.2006.16.427.

    • Search Google Scholar
    • Export Citation
  • ChengXYuXDingYJFuQQXieJJTangTTYaoRChenYLiaoYH2008The Th17/Treg imbalance in patients with acute coronary syndrome. Clinical Immunology1278997doi:10.1016/j.clim.2008.01.009.

    • Search Google Scholar
    • Export Citation
  • ChornyAGonzalezREDelgadoM2006Regulation of dendritic cell differentiation by vasoactive intestinal peptide: therapeutic applications on autoimmunity and transplantation. Annals of the New York Academy of Sciences1088187194doi:10.1196/annals.1366.004.

    • Search Google Scholar
    • Export Citation
  • DullaersMVan MeirvenneSHeirmanCStraetmanLBonehillAAertsJLThielemansKBreckpotK2006Induction of effective therapeutic antitumor immunity by direct in vivo administration of lentiviral vectors. Gene Therapy13630640doi:10.1038/sj.gt.3302697.

    • Search Google Scholar
    • Export Citation
  • DurieFHFavaRAFoyTMAruffoALedbetterJANoelleRJ1993Prevention of collagen-induced arthritis with an antibody to gp39, the ligand for CD40. Science26113281330doi:10.1126/science.7689748.

    • Search Google Scholar
    • Export Citation
  • FaureGCBensoussanLDBeneMCAubertVLeclereJ1997Coexpression of CD40 and class II antigen HLA-DR in Graves' disease thyroid epithelial cells. Clinical Immunology and Immunopathology84212215doi:10.1006/clin.1997.4391.

    • Search Google Scholar
    • Export Citation
  • de FougerollesAVornlocherHPMaraganoreJLiebermanJ2007Interfering with disease: a progress report on siRNA-based therapeutics. Nature Reviews. Drug Discovery6443453doi:10.1038/nrd2310.

    • Search Google Scholar
    • Export Citation
  • GerritseKLamanJDNoelleRJAruffoALedbetterJABoersmaWJClaassenE1996CD40–CD40 ligand interactions in experimental allergic encephalomyelitis and multiple sclerosis. PNAS9324992504doi:10.1073/pnas.93.6.2499.

    • Search Google Scholar
    • Export Citation
  • GilbertJAKalledSLMoorheadJHessDMRennertPLiZKhanMZBangaJP2006Treatment of autoimmune hyperthyroidism in a murine model of Graves' disease with tumor necrosis factor-family ligand inhibitors suggests a key role for B cell activating factor in disease pathology. Endocrinology14745614568doi:10.1210/en.2006-0507.

    • Search Google Scholar
    • Export Citation
  • HillJAIchimTEKusznierukKPLiMHuangXYanXZhongRCairnsEBellDAMinWP2003Immune modulation by silencing IL-12 production in dendritic cells using small interfering RNA. Journal of Immunology171691696.

    • Search Google Scholar
    • Export Citation
  • JacobsonEMTomerY2007The CD40, CTLA-4, thyroglobulin, TSH receptor, and PTPN22 gene quintet and its contribution to thyroid autoimmunity: back to the future. Journal of Autoimmunity288598doi:10.1016/j.jaut.2007.02.006.

    • Search Google Scholar
    • Export Citation
  • KieJHChoMSYangWI2001Expression of CD40 and apoptosis related molecules in autoimmune thyroid diseases. Yonsei Medical Journal42488496.

    • Search Google Scholar
    • Export Citation
  • LawCLGrewalIS2009Therapeutic interventions targeting CD40L (CD154) and CD40: the opportunities and challenges. Advances in Experimental Medicine and Biology647836doi:10.1007/978-0-387-89520-8_2.

    • Search Google Scholar
    • Export Citation
  • MysliwiecJOklotaMNikolajukAWaligorskiDGorskaM2007Serum CD40/CD40L system in Graves' disease and Hashimoto's thyroiditis related to soluble Fas, FasL and humoral markers of autoimmune response. Immunological Investigations36247257doi:10.1080/08820130601069715.

    • Search Google Scholar
    • Export Citation
  • ParkF2007Lentiviral vectors: are they the future of animal transgenesis?Physiological Genomics31159173doi:10.1152/physiolgenomics.00069.2007.

    • Search Google Scholar
    • Export Citation
  • RaoulCAbbas-TerkiTBensadounJ-CGuillotSHaaseGSzulcJHendersonCEAebischerP2005Lentiviral-mediated silencing of SOD1 through RNA interference retards disease onset and progression in a mouse model of ALS. Nature Medicine11423428doi:10.1038/nm1207.

    • Search Google Scholar
    • Export Citation
  • SaitohONagayamaY2006Regulation of Graves' hyperthyroidism with naturally occurring CD4(+)CD25(+) regulatory T cells in a mouse model. Endocrinology14724172422doi:10.1210/en.2005-1024.

    • Search Google Scholar
    • Export Citation
  • SaitohOAbiruNNakaharaMNagayamaY2007CD8+CD122+T cells, a newly identified regulatory T subset, negatively regulate Graves' hyperthyroidism in a murine model. Endocrinology14860406046doi:10.1210/en.2007-0300.

    • Search Google Scholar
    • Export Citation
  • SakaguchiS2005Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self. Nature Immunology6345352doi:10.1038/ni1178.

    • Search Google Scholar
    • Export Citation
  • SempowskiGDRozenblitJSmithTJPhippsRP1998Human orbital fibroblasts are activated through CD40 to induce proinflammatory cytokine production. American Journal of Physiology274C707C714.

    • Search Google Scholar
    • Export Citation
  • SinnPLAriasACBrogdenKAMcCrayPBJr2008Lentivirus vector can be readministered to nasal epithelia without blocking immune responses. Journal of Virology821068410692doi:10.1128/JVI.00227-08.

    • Search Google Scholar
    • Export Citation
  • SmithTJSciakyDPhippsRPJenningsTA1999CD40 expression in human thyroid tissue: evidence for involvement of multiple cell types in autoimmune and neoplastic diseases. Thyroid9749755doi:10.1089/thy.1999.9.749.

    • Search Google Scholar
    • Export Citation
  • SuzukiMZhengXZhangXLiMVladauCIchimTESunHMinLRGarciaBMinW-P2008Novel vaccination for allergy through gene silencing of CD40 using small interfering RNA. Journal of Immunology18084618469.

    • Search Google Scholar
    • Export Citation
  • SuzukiMZhengXZhangXIchimTESunHKuboNBeduhnMShunnarAGarciaBMinWP2009Inhibition of allergic responses by CD40 gene silencing. Allergy64387397doi:10.1111/j.1398-9995.2008.01839.x.

    • Search Google Scholar
    • Export Citation
  • ThackerEETimaresLMatthewsQL2009Strategies to overcome host immunity to adenovirus vectors in vaccine development. Expert Review of Vaccines8761777doi:10.1586/erv.09.29.

    • Search Google Scholar
    • Export Citation
  • TomerYConcepcionEGreenbergDA2002A C/T single-nucleotide polymorphism in the region of the CD40 gene is associated with Graves' disease. Thyroid1211291135doi:10.1089/105072502321085234.

    • Search Google Scholar
    • Export Citation
  • WeetmanAP2000Graves' disease. New England Journal of Medicine34312361248doi:10.1056/NEJM200010263431707.

  • WingKOnishiYPrieto-MartinPYamaguchiTMiyaraMFehervariZNomuraTSakaguchiS2008CTLA-4 control over Foxp3(+) regulatory T cell function. Science322271275doi:10.1126/science.1160062.

    • Search Google Scholar
    • Export Citation
  • ZhengXVladauCZhangXSuzukiMIchimTEZhangZ-XLiMCarrierEGarciaBJevnikarAM2009A novel in vivo siRNA delivery system specifically targeting dendritic cells and silencing CD40 genes for immunomodulation. Blood11326462654doi:10.1182/blood-2008-04-151191.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 656 76 4
PDF Downloads 397 89 6
  • View in gallery

    LV-CD40-siRNA inhibits the expression of CD40 in vivo. Three days prior to immunization with Ad-TSHR289, three groups of mice were treated with either PBS alone, LV, or LV-CD40-siRNA respectively. Splenic tissues were obtained 4 weeks after the third immunization. Eight tissues in each group were studied. The error bars represent standard error in each group. (A) CD40 expression was determined by real-time PCR in Ad-TSHR289 immunized mice. (B) CD40 expression was determined by flow cytometry and the mean count in each group is shown. Splenocytes were stained with PE-labeled anti-CD40 Ab and analyzed by flow cytometry. Details are described in section ‘Materials and Methods’. *P<0.05 versus control siRNA group.

  • View in gallery

    The effect of LV-CD40-siRNA on hyperthyroidism. (A) Mean serum T4 levels in each group. Mice were immunized with 1×109 particles Ad-TSHR289 per injection on three occasions at 3-week intervals. Serum T4 levels were measured 4 weeks after the third injection. (B) Serum TRAb levels in BALB/c mice immunized with adenovirus expressing the TSHR extracellular A subunit (Ad-TSHR289). The shaded area represents the mean±3 s.d. for serum TRAB levels in mice immunized with PBS (PBS-treated mice).

  • View in gallery

    The effect of LV-CD40-siRNA on the expression of other costimulatory molecules. Three days prior to immunization with Ad-TSHR289, three groups of mice were treated with either PBS alone, LV, or LV-CD40-siRNA respectively. Splenic tissues were obtained 4 weeks after the third immunization. Eight tissues in each group were studied. The error bars represent standard error in each group. Total RNA was extracted from splenic tissues and real-time PCR was performed to investigate the expression of CD80 (A) and CD86 (B) as described in section ‘Materials and Methods’. *P<0.05 when compared to control siRNA group; P<0.05 when compared to PBS group.

  • View in gallery

    Immune modulation by LV-CD40-siRNA in vivo. Three days prior to immunization with Ad-TSHR289, three groups of mice were treated with either PBS alone, LV, or LV-CD40-siRNA respectively. Splenic tissues were obtained at 4 weeks after the third immunization. Eight tissues in each group were studied. The error bars represent standard error in each group. Total RNA was extracted from splenic tissues and real-time PCR was performed using specific primers of FOXP3 as described in section ‘Materials and Methods’. P<0.05 when compared to PBS group.

  • BrentGA2008Clinical practice. Graves' disease. New England Journal of Medicine35825942605doi:10.1056/NEJMcp0801880.

  • CarayanniotisGMastersSRNoelleRJ1997Suppression of murine thyroiditis via blockade of the CD40–CD40L interaction. Immunology90421426doi:10.1111/j.1365-2567.1997.00421.x.

    • Search Google Scholar
    • Export Citation
  • ChenCRPichurinPNagayamaYLatrofaFRapoportBMcLachlanSM2003The thyrotropin receptor autoantigen in Graves disease is the culprit as well as the victim. Journal of Clinical Investigation11118971904doi:10.1172/JCI17069.

    • Search Google Scholar
    • Export Citation
  • ChenCRPichurinPChazenbalkGDAlieskyHNagayamaYMcLachlanSMRapoportB2004Low-dose immunization with adenovirus expressing the thyroid-stimulating hormone receptor A-subunit deviates the antibody response toward that of autoantibodies in human Graves' disease. Endocrinology145228233doi:10.1210/en.2003-1134.

    • Search Google Scholar
    • Export Citation
  • ChenCRAlieskyHAGuoJRapoportBMcLachlanSM2006Blockade of costimulation between T cells and antigen-presenting cells: an approach to suppress murine Graves' disease induced using thyrotropin receptor-expressing adenovirus. Thyroid16427434doi:10.1089/thy.2006.16.427.

    • Search Google Scholar
    • Export Citation
  • ChengXYuXDingYJFuQQXieJJTangTTYaoRChenYLiaoYH2008The Th17/Treg imbalance in patients with acute coronary syndrome. Clinical Immunology1278997doi:10.1016/j.clim.2008.01.009.

    • Search Google Scholar
    • Export Citation
  • ChornyAGonzalezREDelgadoM2006Regulation of dendritic cell differentiation by vasoactive intestinal peptide: therapeutic applications on autoimmunity and transplantation. Annals of the New York Academy of Sciences1088187194doi:10.1196/annals.1366.004.

    • Search Google Scholar
    • Export Citation
  • DullaersMVan MeirvenneSHeirmanCStraetmanLBonehillAAertsJLThielemansKBreckpotK2006Induction of effective therapeutic antitumor immunity by direct in vivo administration of lentiviral vectors. Gene Therapy13630640doi:10.1038/sj.gt.3302697.

    • Search Google Scholar
    • Export Citation
  • DurieFHFavaRAFoyTMAruffoALedbetterJANoelleRJ1993Prevention of collagen-induced arthritis with an antibody to gp39, the ligand for CD40. Science26113281330doi:10.1126/science.7689748.

    • Search Google Scholar
    • Export Citation
  • FaureGCBensoussanLDBeneMCAubertVLeclereJ1997Coexpression of CD40 and class II antigen HLA-DR in Graves' disease thyroid epithelial cells. Clinical Immunology and Immunopathology84212215doi:10.1006/clin.1997.4391.

    • Search Google Scholar
    • Export Citation
  • de FougerollesAVornlocherHPMaraganoreJLiebermanJ2007Interfering with disease: a progress report on siRNA-based therapeutics. Nature Reviews. Drug Discovery6443453doi:10.1038/nrd2310.

    • Search Google Scholar
    • Export Citation
  • GerritseKLamanJDNoelleRJAruffoALedbetterJABoersmaWJClaassenE1996CD40–CD40 ligand interactions in experimental allergic encephalomyelitis and multiple sclerosis. PNAS9324992504doi:10.1073/pnas.93.6.2499.

    • Search Google Scholar
    • Export Citation
  • GilbertJAKalledSLMoorheadJHessDMRennertPLiZKhanMZBangaJP2006Treatment of autoimmune hyperthyroidism in a murine model of Graves' disease with tumor necrosis factor-family ligand inhibitors suggests a key role for B cell activating factor in disease pathology. Endocrinology14745614568doi:10.1210/en.2006-0507.

    • Search Google Scholar
    • Export Citation
  • HillJAIchimTEKusznierukKPLiMHuangXYanXZhongRCairnsEBellDAMinWP2003Immune modulation by silencing IL-12 production in dendritic cells using small interfering RNA. Journal of Immunology171691696.

    • Search Google Scholar
    • Export Citation
  • JacobsonEMTomerY2007The CD40, CTLA-4, thyroglobulin, TSH receptor, and PTPN22 gene quintet and its contribution to thyroid autoimmunity: back to the future. Journal of Autoimmunity288598doi:10.1016/j.jaut.2007.02.006.

    • Search Google Scholar
    • Export Citation
  • KieJHChoMSYangWI2001Expression of CD40 and apoptosis related molecules in autoimmune thyroid diseases. Yonsei Medical Journal42488496.

    • Search Google Scholar
    • Export Citation
  • LawCLGrewalIS2009Therapeutic interventions targeting CD40L (CD154) and CD40: the opportunities and challenges. Advances in Experimental Medicine and Biology647836doi:10.1007/978-0-387-89520-8_2.

    • Search Google Scholar
    • Export Citation
  • MysliwiecJOklotaMNikolajukAWaligorskiDGorskaM2007Serum CD40/CD40L system in Graves' disease and Hashimoto's thyroiditis related to soluble Fas, FasL and humoral markers of autoimmune response. Immunological Investigations36247257doi:10.1080/08820130601069715.

    • Search Google Scholar
    • Export Citation
  • ParkF2007Lentiviral vectors: are they the future of animal transgenesis?Physiological Genomics31159173doi:10.1152/physiolgenomics.00069.2007.

    • Search Google Scholar
    • Export Citation
  • RaoulCAbbas-TerkiTBensadounJ-CGuillotSHaaseGSzulcJHendersonCEAebischerP2005Lentiviral-mediated silencing of SOD1 through RNA interference retards disease onset and progression in a mouse model of ALS. Nature Medicine11423428doi:10.1038/nm1207.

    • Search Google Scholar
    • Export Citation
  • SaitohONagayamaY2006Regulation of Graves' hyperthyroidism with naturally occurring CD4(+)CD25(+) regulatory T cells in a mouse model. Endocrinology14724172422doi:10.1210/en.2005-1024.

    • Search Google Scholar
    • Export Citation
  • SaitohOAbiruNNakaharaMNagayamaY2007CD8+CD122+T cells, a newly identified regulatory T subset, negatively regulate Graves' hyperthyroidism in a murine model. Endocrinology14860406046doi:10.1210/en.2007-0300.

    • Search Google Scholar
    • Export Citation
  • SakaguchiS2005Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self. Nature Immunology6345352doi:10.1038/ni1178.

    • Search Google Scholar
    • Export Citation
  • SempowskiGDRozenblitJSmithTJPhippsRP1998Human orbital fibroblasts are activated through CD40 to induce proinflammatory cytokine production. American Journal of Physiology274C707C714.

    • Search Google Scholar
    • Export Citation
  • SinnPLAriasACBrogdenKAMcCrayPBJr2008Lentivirus vector can be readministered to nasal epithelia without blocking immune responses. Journal of Virology821068410692doi:10.1128/JVI.00227-08.

    • Search Google Scholar
    • Export Citation
  • SmithTJSciakyDPhippsRPJenningsTA1999CD40 expression in human thyroid tissue: evidence for involvement of multiple cell types in autoimmune and neoplastic diseases. Thyroid9749755doi:10.1089/thy.1999.9.749.

    • Search Google Scholar
    • Export Citation
  • SuzukiMZhengXZhangXLiMVladauCIchimTESunHMinLRGarciaBMinW-P2008Novel vaccination for allergy through gene silencing of CD40 using small interfering RNA. Journal of Immunology18084618469.

    • Search Google Scholar
    • Export Citation
  • SuzukiMZhengXZhangXIchimTESunHKuboNBeduhnMShunnarAGarciaBMinWP2009Inhibition of allergic responses by CD40 gene silencing. Allergy64387397doi:10.1111/j.1398-9995.2008.01839.x.

    • Search Google Scholar
    • Export Citation
  • ThackerEETimaresLMatthewsQL2009Strategies to overcome host immunity to adenovirus vectors in vaccine development. Expert Review of Vaccines8761777doi:10.1586/erv.09.29.

    • Search Google Scholar
    • Export Citation
  • TomerYConcepcionEGreenbergDA2002A C/T single-nucleotide polymorphism in the region of the CD40 gene is associated with Graves' disease. Thyroid1211291135doi:10.1089/105072502321085234.

    • Search Google Scholar
    • Export Citation
  • WeetmanAP2000Graves' disease. New England Journal of Medicine34312361248doi:10.1056/NEJM200010263431707.

  • WingKOnishiYPrieto-MartinPYamaguchiTMiyaraMFehervariZNomuraTSakaguchiS2008CTLA-4 control over Foxp3(+) regulatory T cell function. Science322271275doi:10.1126/science.1160062.

    • Search Google Scholar
    • Export Citation
  • ZhengXVladauCZhangXSuzukiMIchimTEZhangZ-XLiMCarrierEGarciaBJevnikarAM2009A novel in vivo siRNA delivery system specifically targeting dendritic cells and silencing CD40 genes for immunomodulation. Blood11326462654doi:10.1182/blood-2008-04-151191.

    • Search Google Scholar
    • Export Citation