Abstract
We identified and investigated the changes in expression of two gill Na+, K+-ATPase α-subunit isoforms (α-1a and α-1b) in relationship with salinity acclimation in a cichlid fish, Mozambique tilapia. Transfer of freshwater (FW)-acclimated fish to seawater (SW) resulted in a marked reduction in α-1a expression within 24 h and a significant increase in α-1b expression with maximum levels attained 7 days after the transfer. In contrast, transfer of SW-acclimated fish to FW induced a marked increase in α-1a expression within 2 days, while α-1b expression decreased significantly after 14 days. Hypophysectomy resulted in a virtual shutdown of α-1a mRNA expression in both FW- and SW-acclimated fish, whereas no significant effect was observed in α-1b expression. Replacement therapy by ovine prolactin (oPrl) fully restored α-1a expression in FW-acclimated fish, while cortisol had a modest, but significant, stimulatory effect on α-1a expression. In hypophysectomized fish in SW, replacement therapy with oPrl alone or in combination with cortisol resulted in a marked increase in α-1a mRNA to levels far exceeding those observed in sham-operated fish. Expression of α-1b mRNA was unaffected by hormone treatment either in FW-acclimated fish or in SW-acclimated fish. The mRNA expression of fxyd-11, a regulatory Na+, K+-ATPase subunit, was transiently enhanced during both FW and SW acclimation. In hypophysectomized fish in FW, oPrl and cortisol stimulated fxyd-11 expression in a synergistic manner. The clear Prl dependence of gill α-1a expression may partially explain the importance of this hormone to hyperosmoregulation in this species.
Introduction
The gill epithelium of euryhaline teleosts has an unusual functional flexibility inasmuch as it shifts between ion uptake in freshwater (FW) and ion excretion in seawater (SW). In both environments, mitochondrion-rich cells (MRCs) and adjacent accessory and pavement cells are fundamental to compensatory ion transport, for which the driving force is delivered by the activity of the Na+, K+-ATPase ion pump, possibly complemented by an apical V-type H+-ATPase in FW (Evans et al. 2005, Hwang & Lee 2007). The discovery of two Na+, K+-ATPase α-1 isoforms in the gill of salmonids, α-1a, expressed mainly in FW, and α-1b, expressed mainly in SW, provided important insight into transepithelial ion transport in the gill. In every salmonid species examined to date, salinity acclimation induces a reciprocal switch between α-1a and α-1b isoforms, α-1a being prominent in FW and α-1b in SW (Richards et al. 2003, Mackie et al. 2005, Bystriansky et al. 2006, Madsen et al. 2009, McCormick et al. 2009), suggesting that α-1a is an FW isoform involved specifically in ion uptake, whereas α-1b is an SW isoform associated with ion excretion. Whether this phenomenon is restricted to the early salmonid branch of the teleost clade or is a more general prerequisite for euryhalinity is unknown.
In fish, a suite of endocrine factors coordinate the physiological changes necessary to respond to changes in environmental salinity, and among these, the pituitary hormones prolactin (Prl) and GH along with cortisol are of critical importance (Sakamoto & McCormick 2006). The importance of Prl in osmoregulation was first demonstrated by the finding that hypophysectomized killifish require replacement therapy with ovine prolactin (oPrl) to survive in FW (Pickford & Phillips 1959). Prl treatment is associated with a marked reduction in extrarenal ion loss (Potts & Evans 1967). The effects of Prl on active ion uptake are somewhat unclear since both inhibition (e.g. killifish: Pickford et al. 1970; rainbow trout: Madsen & Bern 1992; tilapia: Sakamoto et al. 1997; seabream: Mancera et al. 2002) and the lack of an effect (tilapia: Herndon et al. 1991; brown trout: Madsen et al. 1995) on gill Na+, K+-ATPase activity have been reported.
Independent of its effect on somatic growth, GH has the ability to facilitate osmoregulation in SW. This ability is supported by increased gill Na+, K+-ATPase activity along with increased MRC size and quantity following GH treatment, an effect observed in several species (e.g. brown trout: Madsen 1990; Atlantic salmon: McCormick 1996; tilapia: Sakamoto et al. 1997; killifish: Mancera & McCormick 1998). The corticosteroid, cortisol, is involved in both FW and SW osmoregulation (Sakamoto & McCormick 2006). The role of cortisol in SW acclimation has been documented in a variety of fish species, in which the steroid simultaneously stimulates gill Na+, K+-ATPase activity and SW tolerance (e.g. Sakamoto et al. 2001). In the hypophysectomized FW eel, cortisol treatment restores normal plasma osmolality (Chan et al. 1968), indicating a role for the steroid in FW osmoregulation. Moreover, following hypophysectomy, catfish require both Prl and cortisol to osmoregulate in FW (Fortner & Pickford 1982, Eckert et al. 2001).
This study investigated the presence of gill Na+, K+-ATPase isoforms in a euryhaline cichlid, the Mozambique tilapia which belongs to the more recently radiated group of perciform fish. Key regulators of Na+, K+-ATPase activity include regulatory subunits, termed Fxyd proteins (Garty & Karlish 2006), that were recently described in Atlantic salmon (Tipsmark 2008, Tipsmark et al. 2010b) and green pufferfish (Wang et al. 2008). We identified Na+, K+-ATPase catalytic (α subunits) and regulatory (Fxyd proteins) isoforms in the expressed sequence tag (EST) database for tilapia using the NCBI web resource. We first examined changes in these isoforms following the transfer from FW to SW and vice versa. Then, hypophysectomy and replacement therapy trials were conducted to assess the relative contribution of environmental salinity and endocrine signaling to the expression of Na+, K+-ATPase and Fxyd isoforms.
Materials and Methods
Fish
Male tilapia (Oreochromis mossambicus) were selected from an FW population maintained at the Hawaii Institute of Marine Biology, University of Hawaii. Fish were maintained outdoors with a continuous flow of FW (tap water: 0.98 mM Na+, 0.25 mM Ca2+, 0.01 mM Mg2+, and 0.04 mM K+) under natural photoperiod and fed a commercial diet (Silver Cup Trout Chow, Nelson & Sons, Murray, UT, USA) at ∼5% of their body weight per day. Some fish were acclimated to SW (Kaneohe Bay, Hawaii; 34 ppt) for 4 weeks before the start of the FW transfer experiment. In all experiments, water temperature was maintained at 24–26 °C. The Institutional Animal Care and Use Committee of the University of Hawaii approved all surgical and experimental protocols.
Experiments
Experiment 1: SW challenge
Fish (160–170 g) were held in 700 l tanks, and salinity was changed from FW to 70% SW (23 ppt) by opening a SW valve and adjusting the flow of incoming FW; 70% SW was reached after about 15 min. After 24 h, the FW valve was turned off to gradually raise the salinity to full-strength SW. This mode of SW acclimation was adopted to reduce handling stress and allow adaptive processes to be activated (Breves et al. 2010a). Control groups were maintained in FW for the entire experiment. Fish were fasted for the duration of the experiment. Fish were sampled (n=8) at 0, 1, 7, and 14 d after transition to SW. At the time of sampling, fish were netted and anesthetized with a lethal dose of 2-phenoxyethanol (2 ml/l). They were rapidly decapitated, and 15–20 filaments from the first gill arch were frozen in liquid nitrogen and stored at −80 °C until RNA isolation and analyses of gene expression.
Experiment 2: FW challenge
Fish (75–180 g) were held in 700 l tanks and acclimated to SW under natural photoperiod for more than 4 weeks. At the start of the experiment, tank water was changed to FW with minimal disturbance by switching inflow from an SW valve to an FW valve as described previously (Breves et al. 2011). FW conditions were reached after 60 min. Control groups were maintained continuously in SW. Fish were fasted for the duration of the experiment. Fish were sampled at 0, 0.25, 1, 2, and 14 d after transition to FW (n=8).
Experiment 3: hypophysectomy and FW or SW transfer
Hypophysectomy and sham operation of FW-acclimated fish were performed by the transorbital technique (Nishioka 1994). Following the operation, hypophysectomized, sham-operated, and intact fish were transferred to recirculating aquaria containing brackish water (12 ppt). Following a postoperative recovery period in brackish water for 5–7 days, hypophysectomized, sham-operated, and intact fish (n=6–8) were exposed to FW or SW for 3 days by adding FW or SW directly to the recirculating aquaria. Tank water reached FW conditions within 90 min. Fish were transferred to SW by gradually adding SW to the aquaria to raise the salinity to 23 ppt after 90 min. After 24 h, SW was added again to raise the salinity to full-strength SW. Completeness of hypophysectomy was confirmed by postmortem inspection of the hypothalamic region.
Experiment 4: hypophysectomy and replacement therapy in FW or SW
Hypophysectomized fish, held in brackish water for 5–7 days (n=6–8), were injected i.p. with oPrl (5 μg/g body weight; Sigma), oGH (5 μg/g; National Hormone and Peptide Program, Torrance, CA, USA) or cortisol (1 μg/g; Sigma), either alone or in combination, and were exposed to FW or SW as in Experiment 3. Hormones were delivered in saline vehicle (0.9% NaCl; 1.0 μl/g body weight). The first injection was administered just prior to transfer to either FW or SW. After 24 h, fish were given a second injection. Fish were then left undisturbed for 48 h, after which time they were sampled as described previously. Sham-operated fish were injected with saline vehicle only.
Analytical techniques
Extraction of RNA and cDNA synthesis
Total RNA was extracted by the TRI Reagent procedure (MRC, Cincinnati, OH, USA) according to the manufacturer's recommendation. Total RNA concentrations were determined by measuring A260 in duplicate with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Complementary DNA was synthesized by reverse transcription carried out on 0.6 μg total RNA using qScript cDNA SuperMix (Quanta, Gaithersburg, MD, USA) according to the manufacturer's instructions.
Sequences
Non-redundant sequences of β-actin (actb Acc. No. AB037865), acidic ribosomal phosphoprotein p0 (rplp0; Acc. No. EF452495), and Na+, K+-ATPase α-1b (atp1a1b; Acc. No. TMU82549) were used. Na+, K+-ATPase α-1b has previously been characterized and annotated as an α-1 isoform in tilapia (Hwang et al. 1998). However, since it is similar to α-1b of the salmonid isoform, having all the specific conserved amino acid sequence (Jorgensen 2008), we used this nomenclature. Na+, K+-ATPase α-1a sequences (atp1a1a; Acc. No. GR645170 and GR644771) were identified in the Nile tilapia (Oreochromis niloticus) transcriptome (Lee et al. 2010) based on a specific amino acid substitution in the fifth transmembrane domain (lysine instead of asparagine) in the cation binding site. This substitution is observed in previously examined α-1a isoforms and distinguishes them from the α-1b isoforms (Jorgensen 2008). fxyd-9 (Acc. No. GR611225, GR682782, GR684667, GR652932, GR654431, GR646538, GR629763, GR622096, GR618400, GR623531, GR614978, GR605558, GR604084, and GR644771) and fxyd-11 (Acc. No. GR648095, GR628272, and GR624008) were both identified in the O. niloticus transcriptome by searching with tBLASTn at the NCBI web resource using the relevant sequences known from Atlantic salmon (Tipsmark 2008; fxyd-9: NP001117201; fxyd-11: NP001117198).
Primers
Primers were designed using Primer3 software (Rozen & Skaletsky 2000) and checked using NetPrimer software (Premier Biosoft International, Palo Alto, CA, USA). All primers were purchased from Applied Biosystems (Foster City, CA, USA). Primer sequences were tested for non-specific product amplification and primer–dimer formation by melting curve analysis; amplicon size was verified by agarose gel electrophoresis. Elongation factor 1a (ef-1a) primers have previously been reported (Breves et al. 2010b). Additional primers used were (5′–3′): β-actin (forward, CTCTTCCAGCCTTCCTTCCT; reverse, ACAGGTCCTTACGGATGTCG; amplicon size=100 nt), acidic ribosomal phosphoprotein p0 (rplp0; forward, CCCCTTGTGATGTGACAGTG; reverse, GTGATACCCAGAGCCTGGAA; amplicon size=82 nt), Na+, K+-ATPase α-1a (forward, AACTGATTTGGTCCCTGCAA; reverse, ATGCATTTCTGGGCTGTCTC; amplicon size=80 nt), Na+, K+-ATPase α-1b (forward, GGAGCGTGTGCTTCATCACT; reverse, ATCCATGCTTTGTGGGGTTA; amplicon size=90 nt), fxyd-9 (forward, TCTTCGTCATTTGCTTGTCG; reverse, TGTTCTTCTGCGAACACCAG; amplicon size=97 nt), and fxyd-11 (forward, TGCTGTTCAGCCTTTTTGTG; reverse, GACCAGTCCTCCAATCCGTA; amplicon size=80 nt).
Quantitative PCR
Quantitative PCR (QPCR) assays were run on a StepOnePlus real-time PCR system (Applied Biosystems). Reactions were carried out with a cDNA amount equivalent to 15 ng total RNA, 200 nM forward and reverse primers, using Power SYBR Green PCR Master Mix (Applied Biosystems) in a total volume of 15 μl. Cycling conditions were 95 °C for 15 s and 60 °C for 60 s in 40 cycles. The geNorm (version 3.5) tool was applied to determine a normalization factor from the examined reference genes (β-actin, ef-1a and rplp0) and used to normalize the expression for the target genes (Vandesompele et al. 2002). geNorm establishes the individual stability of genes within a cluster and computes a geometric mean as a normalizing factor. Relative copy numbers of the target genes were calculated as 
Statistical analysis
The salinity transfer experiments were analyzed by a two-factorial ANOVA followed by the Bonferroni-adjusted Fisher's LSD test. The tissue distribution and hypophysectomy experiments were analyzed with one-way ANOVA, and differences between group means were assessed by Tukey's HSD test. When required, transformation of data was done to meet the ANOVA assumption of homogeneity of variances. All statistical analyses were performed using GraphPad Prism 4.0 software (San Diego, CA, USA), and significant differences were accepted when P<0.05.
Results
Tissue distribution
The tissue distribution of Na+, K+-ATPase catalytic α-1a and α-1b isoforms and the putative regulatory subunit isoforms, fxyd-9 and fxyd-11, was examined in FW-acclimated tilapia. The α-1a isoform was expressed in 2–4 orders of magnitude higher in the gill than in the other examined tissues (Fig. 1A). The levels of α-1b isoform were highest in the intestine and kidney (Fig. 1B). fxyd-9 was expressed at similar levels in most tissues, with higher levels found in the brain and stomach (Fig. 1C). fxyd-11 exhibited 3–4 orders of magnitude higher expression in the gill than in the other tissues (Fig. 1D).
Expression of Na+, K+-ATPase α-1a subunit (A), α-1b subunit (B), fxyd-9 (C), and fxyd-11 (D) mRNA in the brain, gill, skin, esophagus, stomach, anterior intestine (ant. int.), middle intestine (mid. int.), posterior intestine (post. int.), kidney, skeletal muscle (muscle), liver, and urinary bladder (urin. bladder) in FW-acclimated tilapia. ND, no detection. Groups with no shared letters are statistically different. Means±s.e.m. (n=4–5).
Citation: Journal of Endocrinology 209, 2; 10.1530/JOE-10-0495
Transfer from FW to SW
When FW-acclimated tilapia were exposed to SW, α-1a levels rapidly declined after 1 day and remained low during the remainder of the experiment (Fig. 2A). Transfer to SW produced a doubling of the α-1b expression by day 1 and a tenfold rise after a week (Fig. 2B). fxyd-9 expression doubled after 1 day in SW, but was not significantly different from FW controls at days 7 and 14 (Fig. 2C). fxyd-11 was elevated threefold after 1 and 7 days, but no significant difference was observed at day 14 (Fig. 2D).
Effects of transfer from FW to SW on branchial mRNA expression of Na+, K+-ATPase α-1a subunit (A), α-1b subunit (B), fxyd-9 (C), and fxyd-11 (D). FW-acclimated tilapia were transferred to SW (filled circle), while control fish were maintained in FW (open circle). Asterisks indicate significant effects compared with controls (***P<0.001). Values are means±s.e.m. (n=7–8).
Citation: Journal of Endocrinology 209, 2; 10.1530/JOE-10-0495
Transfer from SW to FW
When SW-acclimated tilapia were exposed to FW, α-1a mRNA increased by tenfold after 1 day and by 60-fold after 2 days, and remained high during the remainder of the experiment (Fig. 3A). There was no significant change in α-1b expression during the first 2 days; a significant reduction was observed only after 14 days (Fig. 3B). A significant increase in fxyd-9 expression was observed in FW-challenged fish at day 14, while fxyd-11 expression was elevated after 2 days (Fig. 3C and D).
Effects of transfer from SW to FW on branchial mRNA expression of Na+, K+-ATPase α-1a subunit (A), α-1b subunit (B), fxyd-9 (C), and fxyd-11 (D). SW-acclimated tilapia were transferred to FW (filled circle), while control fish were maintained in SW (open circle). Asterisks indicate significant effects compared with controls (*P<0.05, **P<0.01, and ***P<0.001). Values are means±s.e.m. (n=7–8).
Citation: Journal of Endocrinology 209, 2; 10.1530/JOE-10-0495
Hypophysectomy and FW or SW transfer
In both FW- and SW-exposed fish, gill α-1a mRNA expression was markedly reduced in hypophysectomized fish compared with levels observed in intact and sham-operated controls (Fig. 4A). The expression of α-1b, fxyd-9 and fxyd-11 was not significantly altered by hypophysectomy in FW- or SW-acclimated fish (Fig. 4B–D).
Effects of hypophysectomy (Hx) on branchial mRNA expression of Na+, K+-ATPase α-1a subunit (A), α-1b subunit (B), fxyd-9 (C), and fxyd-11 (D). At 5 days after the operation, sham-operated (lightly gray bars), hypophysectomized (dark gray bars), and intact (open bars) tilapia were transferred from brackish water (12 ppt) to FW or SW and sampled after 3 days. Within a given ambient salinity, groups with different letters are significantly different (P<0.05). Values are means±s.e.m. (n=6–8).
Citation: Journal of Endocrinology 209, 2; 10.1530/JOE-10-0495
Hypophysectomy and replacement therapy
In saline-injected, hypophysectomized tilapia, transfer from brackish water to FW for 3 days (controls) produced a virtual shutdown of gill α-1a mRNA expression compared with levels in sham-operated fish (Fig. 5A). Replacement therapy by oPrl alone or in combination with cortisol restored this drop-off in expression. Cortisol had a slight but significant stimulatory effect on α-1a expression. Gill α-1b and fxyd-9 mRNA were unaffected by hypophysectomy and hormone treatment (Fig. 5B and C). On the other hand, pituitary removal depressed fxyd-11 expression significantly. Both oPrl and cortisol restored fxyd-11 expression in hypophysectomized fish (Fig. 5D). The effects of oPrl and cortisol on fxyd-11 were synergistic and were not observed for α-1a.
Effects of hypophysectomy (Hx) and hormone replacement therapy with oPrl, oGH and cortisol on branchial mRNA expression of Na+, K+-ATPase α-1a subunit (A), α-1b subunit (B), fxyd-9 (C), and fxyd-11 (D) in tilapia transferred to FW. Fish received two i.p. injections of saline (Sham and Hx only), oPrl (5 μg/g), or oGH (5 μg/g) alone or in combination with cortisol (1 μg/g). The first injection occurred immediately prior to transfer from brackish water (12 ppt) to FW, and the second occurred after 24 h. Fish were sampled 3 days after the initial transfer to FW. Groups with different letters are significantly different (P<0.05). Values are means±s.e.m. (n=6–8).
Citation: Journal of Endocrinology 209, 2; 10.1530/JOE-10-0495
Hypophysectomized tilapia transferred to SW also experienced an inhibitory effect of pituitary removal on gill α-1a mRNA expression. As in the FW-exposed fish, treatment with oPrl alone or in combination with cortisol induced significant increases in α-1a expression to levels significantly higher than those in the sham-operated fish (Fig. 6A). No significant change was observed in α-1b and fxyd-9 expression following hormone injections (Fig. 6B and C). fxyd-11 expression patterns were variable following hormone injections. Compared with sham-operated fish, hypophysectomized fish treated with either oPrl or oGH showed significantly higher expression of fxyd-11, although the levels were not significantly different from saline-injected hypophysectomized controls (Fig. 6D). Treatment with cortisol alone or in combination with oPrl or oGH had no significant effect compared with levels in sham-operated or saline-injected, hypophysectomized fish.
Effects of hypophysectomy (Hx) and replacement therapy with oPrl, oGH, and cortisol on branchial mRNA expression of Na+, K+-ATPase α-1a subunit (A), α-1b subunit (B), fxyd-9 (C), and fxyd-11 (D) in tilapia transferred to SW. Fish received two i.p. injections of saline (Sham and Hx only), oPrl (5 μg/g), or oGH (5 μg/g) alone or in combination with cortisol (1 μg/g). The first injection occurred immediately prior to transfer from brackish water (12 ppt) to SW, and the second occurred after 24 h. Fish were sampled 3 days after the initial transfer to SW. Groups with different letters are significantly different (P<0.05). Values are means±s.e.m. (n=6–8).
Citation: Journal of Endocrinology 209, 2; 10.1530/JOE-10-0495
Discussion
This study identified two branchial Na+, K+-ATPase α isoforms in a cichlid fish and verified a strong relationship with environmental salinity in their expression, suggesting that α-1a is exclusively associated with branchial ion uptake in FW, while α-1b is involved in ion extrusion in SW. Hypophysectomy and hormone replacement studies showed that mRNA expression of the FW isoform (α-1a) is dependent on pituitary Prl. Conversely, the mRNA expression of the SW isoform (α-1b) showed no dependence on pituitary hormones. Concerning the regulatory Fxyd proteins, fxyd-9 was not impacted by hormonal factors, while fxyd-11 expression was stimulated by both oPrl and cortisol. The transient stimulation of fxyd-11 during both FW and SW acclimation suggests a key role for this regulatory subunit in net ion transport transitions in gill.
Recently, a series of studies has elucidated the sub-cellular components of FW-type MRCs in Mozambique tilapia (Hiroi et al. 2008, Inokuchi et al. 2008, Watanabe et al. 2008). These studies described the expression of either a sodium proton exchanger type 3 (nhe3) or a sodium chloride cotransporter (ncc) in two distinct FW-type MRCs. In accordance with their activity to support Cl− uptake in hypoosmotic environments (Horng et al. 2009), Ncc-expressing MRCs are stimulated by oPrl injection (Breves et al. 2010b). The drop in Na+, K+-ATPase α-1a mRNA during SW acclimation observed in this study correlates well with decreased ncc and nhe3 mRNA expression reported for larval and adult tilapia transferred to SW (Hiroi et al. 2008, Breves et al. 2010a). Our results showed that Na+, K+-ATPase α-1a expression is stimulated by both FW and Prl. Accordingly, future efforts should employ in situ hybridization and immunohistochemical methods to fully describe the gene and protein expression patterns of Na+, K+-ATPase α-subunits in the four distinct MRC subtypes described in tilapia by Hiroi et al. (2008).
The tissue distributions of Na+, K+-ATPase α subunits established in this study are largely in accordance with those reported in salmonids. In tilapia, the α-1a isoform appears to be gill specific, as in rainbow trout (Richards et al. 2003) and Atlantic salmon (Tipsmark et al. 2010a). The tilapia α-1b isoform was highly expressed in the intestinal sections of FW specimens, with comparatively lower expression in the gill. While keeping in mind that branchial expression of α-1b in SW is more than tenfold higher than that in FW, this still contrasts somewhat with findings in salmonids. In rainbow trout and Atlantic salmon, the α-1b isoform is not expressed substantially in the intestine (Richards et al. 2003, Tipsmark et al. 2010a). The distribution of Fxyd proteins is in accordance with previous studies. Thus, fxyd-9 is expressed in a wide variety of tissues in tilapia (this study), salmon (Tipsmark 2008) and pufferfish (Wang et al. 2008). On the other hand, fxyd-11 is robustly expressed in the tilapia gill, as observed in Atlantic salmon (Tipsmark 2008) and zebrafish (Saito et al. 2010). This would suggest that fxyd-11 is expressed in a gill-specific cell type, such as the MRC. It has been shown that Fxyd-11 is co-localized with the Na+, K+-ATPase α subunits in zebrafish (Saito et al. 2010) and in both FW and SW salmon (Tipsmark et al. 2010b). This does not preclude involvement of the more generally expressed fxyd-9 in the control of MRCs, at least in some species, since this isoform co-localized with Na+, K+-ATPase in pufferfish gill (Wang et al. 2008). It is to be noted that the exact functions of the Fxyd proteins, e.g. involvement in endocrine–paracrine regulation or a general modulation of kinetics, are still unknown. Future work should assess whether one or more Fxyd isoforms are co-localized with Na+, K+-ATPase α subunits in tilapia gill.
The changes in α-1a and α-1b isoforms observed in tilapia after FW and SW transition in this study largely mirror previous reports in rainbow trout (Richards et al. 2003), Arctic char (Bystriansky et al. 2006) and Atlantic salmon (Madsen et al. 2009, McCormick et al. 2009). The marked elevation in α-1a expression after FW transition (60-fold) and α-1b expression after SW transition (tenfold) observed in this study is of a greater magnitude than that reported in the salmonid fishes described earlier. The increase in α-1b mRNA after SW transition is similar to the previous reports by Hwang et al. (1998) and Lin et al. (2004) in tilapia, regarding the gill α-1. They classified their isoform as α-1; however, our sequence analyses indicate that it is a homolog to the salmonid α-1b. As described earlier in the Materials and Methods section, the classification of tilapia α-1a and α-1b is based on the criteria outlined by Jorgensen (2008), an interpretation that is also clearly supported by the regulatory patterns observed in this study. While the functional significance of isoform switching in teleost gill is an open question, Jorgensen (2008) suggested the α-1a subunit may operate with different Na+ stoichiometry from the α-1b subunit, thereby making ion extrusion in FW thermodynamically favorable.
An interesting pattern observed in this study is that gene expression for α-1a, but not for α-1b, is under pituitary control in tilapia. The lack of effect of hypophysectomy on the SW-type Na+, K+-ATPase isoform (α-1b) may at first seem puzzling. Nonetheless, this pattern is in accordance with our previous finding that a Na+, K+, 2Cl− cotransporter (NKCC), a hallmark of SW-type MRCs, is insensitive to hypophysectomy (Breves et al. 2010b). It has been shown that branchial Na+, K+-ATPase activity in Mozambique tilapia is stimulated by oGH and diminished by oPrl treatment (Sakamoto et al. 1997). It seems likely that these effects were mediated by the SW-type Na+, K+-ATPase (α-1b), probably accompanied by Fxyd-11, since oGH or oPrl were injected into hypophysectomized fish kept in a hyperosmotic environment (25 ppt). The results by Sakamoto et al. (1997) are in agreement with findings in Atlantic salmon, showing a synergistic effect of cortisol and homologous GH on branchial SW-type Na+, K+-ATPase (α-1b) gene expression (Tipsmark & Madsen 2009). Since we used a single dose of hormones and one time point for sampling, we cannot rule out that we may have missed actions of GH on factors that support hypoosmoregulatory strategies. Another explanation worth investigating is that O. mossambicus is a marine species, and that FW adaptability is a derived characteristic. Under this scenario, it would not be surprising that α-1b might be expressed constitutively upon exposure to a hyperosmotic environment.
On the other hand, FW-type MRCs that express Ncc show a complete dependence on pituitary Prl (Breves et al. 2010b). This may underlie, at least in part, the inhibitory effect of Prl on SW acclimation (Pisam et al. 1993), since oPrl stimulates plasma Na+ through the recruitment of FW-type MRCs (Breves et al. 2010b). This interpretation is in agreement with the present findings that oPrl treatment in hypophysectomized tilapia in SW induced a higher level of α-1a expression, even above the level of sham-operated fish (see Fig. 6A). On the other hand, in SW-acclimated Atlantic salmon, treatment with salmon Prl inhibited SW-type MRC abundance as shown by an overall reduction in gill α-1b and nkcc1a mRNA levels (Tipsmark & Madsen 2009).
In summary, this study provides the first evidence for a switch in the catalytic isoform of the branchial Na+, K+-ATPase during acclimation to FW- and SW-environments in a non-salmonid teleost. Moreover, this study demonstrates complete dependence on pituitary-derived Prl for expression of the Na+, K+-ATPase α-1a (FW-type) catalytic subunit. Our data suggest that Fxyd-11 may be an essential component of both FW- and SW-type MRCs, and that Prl is involved in regulating the gene in FW. When the patterns that we observed in tilapia are considered with previous reports in salmonids regarding isoform switching, we propose that Na+, K+-ATPase α-1 isoform switching is an essential and general prerequisite in euryhaline fish for adaptation to changes in salinity.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the National Research Initiative Competitive Grants (2008-35206-18785 and 2008-35206-18787) from the USDA National Institute of Food and Agriculture, and by the National Science Foundation (IOB05-17769 and OISE08-52518).
References
Breves JP, Fox BK, Pierce AL, Hirano T & Grau EG 2010a Gene expression of growth hormone family and glucocorticoid receptors, osmosensors, and ion transporters in the gill during seawater acclimation of Mozambique tilapia, Oreochromis mossambicus. Journal of Experimental Zoology 313A 432–441 doi:10.1002/jez.613.
Breves JP, Watanabe S, Kaneko T, Hirano T & Grau EG 2010b Prolactin restores branchial mitochondrion-rich cells expressing Na+/Cl− cotransporter in hypophysectomized Mozambique tilapia. American Journal of Physiology 299 R702–R710 doi:10.1152/ajprenal.00432.2010.
Breves JP, Seale AP, Helms RE, Tipsmark CK, Hirano T & Grau EG 2011 Dynamic gene expression of GH/PRL-family hormone receptors in gill and kidney during freshwater-acclimation of Mozambique tilapia. Comparative Biochemistry and Physiology A 158 194–200 doi:10.1016/j.cbpa.2010.10.030.
Bystriansky JS, Richards JG, Schulte PM & Ballantyne JS 2006 Reciprocal expression of gill Na+/K+-ATPase α-subunit isoforms α1a and α1b during seawater acclimation of three salmonid fishes that vary in their salinity tolerance. Journal of Experimental Biology 209 1848–1858 doi:10.1242/jeb.02188.
Chan DKO, Rankin JC & Chester Jones I 1968 Pituitary and adrenocortical factors in the control of water and electrolyte composition of the freshwater European eel (Anguilla anguilla L.). Journal of Endocrinology 42 91–98 doi:10.1677/joe.0.0420091.
Eckert SM, Yada T, Shepherd BS, Stetson MH, Hirano T & Grau EG 2001 Hormonal control of osmoregulation in the channel catfish Ictalurus punctatus. General and Comparative Endocrinology 122 270–286 doi:10.1006/gcen.2001.7633.
Evans DH, Piermarini PM & Choe KP 2005 The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid–base regulation, and excretion of nitrogenous waste. Physiological Reviews 85 97–177 doi:10.1152/physrev.00050.2003.
Fortner NA & Pickford GE 1982 The effects of hypophysectomy and replacement therapy with prolactin, cortisone, or their combination on the blood of the black bullhead (Ictalurus melas). General and Comparative Endocrinology 47 111–119 doi:10.1016/0016-6480(82)90092-2.
Garty H & Karlish SJD 2006 Role of FXYD proteins in ion transport. Annual Review of Physiology 68 431–459 doi:10.1146/annurev.physiol.68.040104.131852.
Herndon TM, McCormick SD & Bern HA 1991 Effects of prolactin on chloride cells in opercular membrane from seawater-adapted tilapia. General and Comparative Endocrinology 83 283–289 doi:10.1016/0016-6480(91)90032-2.
Hiroi J, Yasumasu S, McCormick SD, Hwang PP & Kaneko T 2008 Evidence for an apical Na–Cl cotransporter involved in ion uptake in a teleost fish. Journal of Experimental Biology 211 2584–2599 doi:10.1242/jeb.018663.
Horng JL, Hwang PP, Shih TH, Wen ZH, Lin CS & Lin LY 2009 Chloride transport in mitochondrion-rich cells of euryhaline tilapia (Oreochromis mossambicus) larvae. American Journal of Physiology 297 C845–C854 doi:10.1152/ajpcell.00218.2009.
Hwang PP & Lee TH 2007 New insights into fish ion regulation and mitochondrion-rich cells. Comparative Biochemistry and Physiology 148A 479–497 doi:10.1016/j.cbpa.2007.06.416.
Hwang PP, Fang MJ, Tsai JC, Huang CJ & Chen ST 1998 Expression of mRNA and protein of Na1, K1-ATPase α subunit in gills of tilapia (Oreochromis mossambicus). Fish Physiology and Biochemistry 18 363–373 doi:10.1023/A:1007711606064.
Inokuchi M, Hiroi J, Watanabe S, Lee KM & Kaneko T 2008 Gene expression and morphological localization of NHE3, NCC and NKCC1a in branchial mitochondria-rich cells of Mozambique tilapia (Oreochromis mossambicus) acclimated to a wide range of salinities. Comparative Biochemistry and Physiology 151A 151–158 doi:10.1016/j.cbpa.2008.06.012.
Jorgensen PL 2008 Importance for absorption of Na+ from freshwater of lysine, valine and serine substitutions in the α-1a-isoform of Na, K-ATPase in the gills of rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Journal of Membrane Biology 223 37–47 doi:10.1007/s00232-008-9111-y.
Lee BY, Howe AE, Conte MA, D'Cotta H, Pepey E, Baroiller JF, di Palma F, Carleton KL & Kocher TD 2010 An EST resource for tilapia based on 17 normalized libraries and assembly of 116,899 sequence tags. BMC Genomics 11 278 doi:10.1186/1471-2164-11-278.
Lin CH, Huang CL, Yang CH, Lee TH & Hwang PP 2004 Time-course changes in the expression of Na, K-ATPase and the morphometry of mitochondrion-rich cells in gills of euryhaline tilapia (Oreochromis mossambicus) during freshwater acclimation. Journal of Experimental Zoology 301A 85–89 doi:10.1002/jez.a.20007.
Mackie PM, Wright PA, Glebe BD & Ballantyne JS 2005 Osmoregulation and gene expression of Na+/K+-ATPase in families of Atlantic salmon (Salmo salar) smolts. Canadian Journal of Fisheries and Aquatic Sciences 62 2661–2672 doi:10.1139/f05-168.
Madsen SS 1990 The role of cortisol and growth hormone in seawater adaptation and development of hypoosmoregulatory mechanisms in sea trout parr (Salmo trutta trutta). General and Comparative Endocrinology 79 1–11 doi:10.1016/0016-6480(90)90082-W.
Madsen SS & Bern HA 1992 Antagonism of prolactin and growth hormone: impact on seawater adaptation in two salmonids, Salmo trutta and Oncorhynchus mykiss. Zoological Science 9 775–784.
Madsen SS, Jensen MK, Nohr J & Kristiansen K 1995 Expression of Na+, K+-ATPase in the brown trout Salmo trutta: in vivo modulation by hormones and seawater. American Journal of Physiology 269 R1339–R1345.
Madsen SS, Kiilerich P & Tipsmark CK 2009 Multiplicity of expression of Na+, K+-ATPase α-subunit isoforms in the gill of Atlantic salmon (Salmo salar): cellular localisation and absolute quantification in response to salinity change. Journal of Experimental Biology 212 78–88 doi:10.1242/jeb.024612.
Mancera JM & McCormick SD 1998 Osmoregulatory actions of the GH/IGF axis in non-salmonid teleosts. Comparative Biochemistry and Physiology 121B 43–48 doi:10.1016/S0305-0491(98)10112-8.
Mancera JM, Laiz-Carrión R & Martin del Rio MP 2002 Osmoregulatory action of PRL, GH, and cortisol in the gilthead seabream (Sparus aurata L.). General and Comparative Endocrinology 129 95–103 doi:10.1016/S0016-6480(02)00522-1.
McCormick SD 1996 Effects of growth hormone and insulin-like growth factor I on salinity tolerance and gill Na+, K+-ATPase in Atlantic salmon (Salmo salar): interaction with cortisol. General and Comparative Endocrinology 101 3–11 doi:10.1006/gcen.1996.0002.
McCormick SD, Regish AM & Christensen AK 2009 Distinct freshwater and seawater isoforms of Na+/K+-ATPase in gill chloride cells of Atlantic salmon. Journal of Experimental Biology 212 3994–4001 doi:10.1242/jeb.037275.
Nishioka RS 1994 Hypophysectomy of fish. In Biochemistry and Molecular Biology of Fishes: Analytical Techniques, pp 49–58. Eds Hochachka PW, Mommsen TP. New York: Elsevier.
Pickford GE & Phillips JG 1959 Prolactin, a factor in promoting survival of hypophysectomised killifish in fresh water. Science 130 454–455 doi:10.1126/science.130.3373.454.
Pickford GE, Pang PK, Weinstein E, Torretti J, Hendler E & Epstein FH 1970 The response of the hypophysectomized cyprinodont, Fundulus heteroclitus, to replacement therapy with cortisol: effects on blood serum and sodium–potassium activated adenosine triphosphatase in the gills, kidney, and intestinal mucosa. General and Comparative Endocrinology 14 524–534 doi:10.1016/0016-6480(70)90036-5.
Pisam M, Auperin B, Prunet P, Rentier-Delrue F, Martial J & Rambourg A 1993 Effects of prolactin on a and b chloride cells in the gill epithelium of the saltwater adapted tilapia Oreochromis niloticus. Anatomical Record 235 275–284 doi:10.1002/ar.1092350211.
Potts WTW & Evans DH 1967 The effects of hypophysectomy and bovine prolactin on salt fluxes in fresh-water-adapted Fundulus heteroclitus. Biological Bulletin 131 362–368 doi:10.2307/1539762.
Richards JG, Semple JW, Bystriansky JS & Schulte PM 2003 Na+/K+-ATPase α-isoform switching in gills of rainbow trout (Oncorhynchus mykiss) during salinity transfer. Journal of Experimental Biology 206 4475–4486 doi:10.1242/jeb.00701.
Rozen S & Skaletsky H 2000 Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols in the Series Methods in Molecular Biology, pp 365–386. Eds S Krawetz & S Misener. Totowa, NJ: Humana Press (see http://fokker.wi.mit.edu/primer3/; verified 20 September 2005)..
Saito K, Nakamura N, Ito Y, Hoshijima K, Esaki M, Zhao B & Hirose S 2010 Identification of zebrafish Fxyd11a protein that is highly expressed in ion-transporting epithelium of the gill and skin and its possible role in ion homeostasis. Frontiers in Aquatic Physiology 1 Article 129 doi:10.3389/fphys.2010.00129.
Sakamoto T & McCormick SD 2006 Prolactin and growth hormone in fish osmoregulation. General and Comparative Endocrinology 147 24–30 doi:10.1016/j.ygcen.2005.10.008.
Sakamoto T, Shepherd BS, Madsen SS, Nishioka RS, Siharath K, Richman NH III, Bern HA & Grau EG 1997 Osmoregulatory actions of growth hormone and prolactin in an advanced teleost. General and Comparative Endocrinology 106 95–101 doi:10.1006/gcen.1996.6854.
Sakamoto T, Kozaka T, Takahashi A, Kawauchi H & Ando M 2001 Medaka (Oryzias latipes) as a model for hypoosmoregulation of euryhaline fishes. Aquaculture 193 347–354 doi:10.1016/S0044-8486(00)00471-3.
Tipsmark CK 2008 Identification of FXYD protein genes in a teleost: tissue specific expression and response to salinity change. American Journal of Physiology 294 R1367–R1378 doi:10.1152/ajpregu.00454.2007.
Tipsmark CK & Madsen SS 2009 Distinct hormonal regulation of Na+, K+-ATPase genes in the Atlantic salmon gill (Salmo salar L.). Journal of Endocrinology 203 301–310 doi:10.1677/JOE-09-0281.
Tipsmark CK, Sorensen KJ, Hulgard K & Madsen SS 2010a Claudin-15 and -25b expression in the intestinal tract of Atlantic salmon in response to seawater acclimation, smoltification and hormone treatment. Comparative Biochemistry and Physiology 155A 361–370 doi:10.1016/j.cbpa.2009.11.025.
Tipsmark CK, Mahmmoud YA, Borski RJ & Madsen SS 2010b FXYD-11 associates with Na+-K+-ATPase in the gill of Atlantic salmon: regulation and localization in relation to changed ion-regulatory status. American Journal of Physiology 299 R1212–R1223 doi:10.1152/ajpregu.00015.2010.
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A & Speleman F 2002 Accurate normalization of real-time quantitative RT-PCR by geometric averaging of multiple internal control genes. Genome Biology 3 34 doi:10.1186/gb-2002-3-7-research0034.
Wang PJ, Lin CH, Hwang HH & Lee TH 2008 Branchial FXYD protein expression in response to salinity change and its interaction with Na+/K+-ATPase of the euryhaline teleost, Tetraodon nigroviridis. Journal of Experimental Biology 211 3750–3758 doi:10.1242/jeb.018440.
Watanabe S, Niida M, Maruyama T & Kaneko T 2008 Na+/H+ exchanger isoform 3 expressed in apical membrane of gill mitochondrion-rich cells in Mozambique tilapia Oreochromis mossambicus. Fisheries Science 74 813–821 doi:10.1111/j.1444-2906.2008.01593.x.
