Abstract
Iodothyronines influence lipid metabolism and energy homeostasis. Previous studies demonstrated that 3,5-l-diiodothyronine (T2), as well as 3,3′,5-l-triiodothyronine (T3), was able to both prevent and reverse hepatic steatosis in rats fed a high-fat diet, and this effect depends on a direct action of iodothyronines on the hepatocyte. However, the involvement of thyroid hormone receptors (TRs) in mediating the lipid-lowering effect of iodothyronines was not elucidated. In this study, we investigated the ability of T2 and T3 to reduce the lipid overloading using the rat hepatoma FaO cells defective for functional TRs. The absence of constitutive mRNA expression of both TRα1 and TRβ1 in FaO cells was verified by RT-qPCR. To mimic the fatty liver condition, FaO cells were treated with a fatty acid mixture and then exposed to pharmacological doses of T2 or T3 for 24 h. Lipid accumulation, mRNA expression of the peroxisome proliferator-activated receptors (PPAR-α, -γ, -δ) the acyl-CoA oxidase (AOX), and the stearoyl CoA desaturase (SCD1), as well as fuel-stimulated O2 consumption in intact cells, were evaluated. Lipid accumulation was associated with an increase in triacylglycerol content, PPARγ mRNA expression, and a decrease in PPARδ and SCD1 mRNA expression. The addition of T2 or T3 to lipid-overloaded cells resulted in i) reduction in lipid content; ii) downregulation of PPARα, PPARγ, and AOX expression; iii) increase in PPARδ expression; and iv) stimulation of mitochondrial uncoupling. These data demonstrate, for the first time, that in the hepatocyte, the lipid-lowering actions of both T2 and T3 are not mediated by TRs.
Introduction
Thyroid hormones (THs) play a major role in lipid metabolism, with the liver representing one of their main target tissues. Other iodothyronines display some thyromimetic activities; among them, 3,5-l-diiodothyronine (T2) mimics several effects of 3,3′,5-l-triiodothyronine (T3) on energy metabolism without inducing thyrotoxic effects (Cimmino et al. 1996, Lanni et al. 2005). Also T2, as T3, is able to stimulate both resting metabolic rate and mitochondrial activity in hypothyroid rats (Moreno et al. 1997). Moreover, when administered to rats receiving a high-fat diet, T2 was able to both prevent (Lanni et al. 2005, Grasselli et al. 2008) and reduce (Mollica et al. 2009) the development of liver steatosis. Once entering the cell, THs mostly bind to specific nuclear receptors (TRs) acting as ligand-dependent transcription factors (‘receptor-mediated’ effects). In humans and rodents, TRs are encoded by two genes, Thra and Thrb, each encoding different isoforms (Izumo & Mahdavi 1988, Lazar 1993). Actions of iodothyronines that are not initiated by binding to TRs are termed ‘non-receptor-mediated’ mechanisms (Cheng et al. 2010), and could involve specific membrane-associated binding sites coupled with activation of rapid signaling pathways, involving MAP kinases, phosphoinositol-3-kinase (PI3K), or Ca2+ mobilization (Bergh et al. 2005).
Similar to THs, the peroxisome proliferator-activated receptors (PPARs) play important roles in lipid homeostasis. In humans and rodents, PPARs are encoded under three isoforms α, γ, and δ that bind to free fatty acids (FFAs; Viswakarma et al. 2010), but only PPARα binds to saturated FFAs (Xu et al. 1999). In the liver, PPARα is the master regulator of FFA oxidation, regulates the expression of acyl-CoA oxidase (AOX), and decreases FFA efflux (Martin et al. 1997). Also PPARδ is highly expressed in the liver, where it enhances FFA catabolism (Barish et al. 2006) and reduces steatosis (Shan et al. 2008). PPARγ is mainly expressed in adipose tissue (Schoonjans et al. 1996) but promotes lipid accumulation also in hepatocytes (Yu et al. 2003). Overall, PPARα and PPARδ function as catabolic regulators of energy, while PPARγ plays anabolic functions on lipid metabolism, even though an overlapping in their expression has been reported (Moreno et al. 1997).
Recent findings provide evidence for a cross talk between TH and PPAR signaling (Lu & Cheng 2010) that occurs mainly via genomic actions (Chu et al. 1995). However, since PPAR transcription is affected by kinase/phosphatase pathways (Burns & Vanden Heuvel 2007, Moreno et al. 2010), the cross talk may also involve ‘non-receptor-mediated’ actions. Moreover, PPARγ (Yao-Borengasser et al. 2008) and PPARδ (Qin et al. 2008) as well as T3 (Waters et al. 1997) regulate transcription of the lipogenic enzyme stearoyl CoA desaturase (SCD1) that controls FFA composition of lipid droplets (LDs).
The anti-steatosic effects of iodothyronines observed in vivo (Lanni et al. 2005, Grasselli et al. 2008) could not distinguish between their direct effects on the liver and the secondary effects due to upstream changes in endocrine or metabolic pathways. Subsequent in vitro experiments using primary rat hepatocytes overloaded with lipids demonstrated that T2 and T3 were able to directly reduce the excess fat (Grasselli et al. 2011). However, whether these effects were mediated by receptor-dependent or independent mechanisms has not been clarified yet.
In this study, we extended our in vitro model of steatosis to the rat hepatoma FaO cell line that is defective for functional TRs (Munoz et al. 1990). FaO cells have been widely employed for studies on FFA effects and PPAR activation (Konig & Eder 2006, Konig et al. 2008). In this study, FaO cells were used to verify whether the lipid-lowering effects of THs are mediated by TRs. In an attempt to investigate the possible molecular targets for the lipid-lowering effect of T2 and T3, the transcription of the different PPAR isoforms, as well as of the lipogenic (SCD1) and the lipolytic (AOX) enzymes, was assessed. Moreover, for both iodothyronines, the whole-cell respiration was evaluated in intact FaO cells.
Materials and Methods
Chemicals
All chemicals, unless otherwise indicated, were of analytical grade and were obtained from Sigma–Aldrich Corp.
Cell culture
Rat hepatoma cells (FaO) were supplied by European Collection of Cell Cultures (Sigma–Aldrich Corp.). FaO cell line is a well-differentiated liver cell line maintaining a number of hepatocyte-specific markers (Clayton et al. 1985, Lauris et al. 1986). Cells were grown in Coon's modified Ham's F12 medium supplemented with 10% FBS (Euroclone, Milan, Italy), 100 U/ml penicillin, and 0.1 mg/ml streptomycin. Cells were maintained at 37 °C in a humidified atmosphere of 95% air and 5% CO2. For experiments, FaO cells were seeded on collagenated Petri dishes (Grasselli et al. 2010) and used at 70–80% confluence. For treatments, cells were incubated in starvation medium supplemented with 0.25% BSA without FBS. Briefly, cells were treated with a mixture of oleate/palmitate (2:1 molar ratio, final concentration 0.75 mM, FFAs) for different periods of time (1, 3, and 6 h). After choosing the optimal conditions of exposure to FFAs, FFA-treated hepatocytes were incubated in the absence (FFAs) or in the presence of T2 or T3 at different concentrations (nominal concentrations ranging from 10−7 to 10−5 M) for 24 h (Demori et al. 1997). Both iodothyronines were added from stock solutions (10−3 M in 50 mM NaOH). As a negative control, hepatoma cells were cultured for the same time period with addition of the vehicle alone. At the end of treatment, hepatocytes were collected and stored at −80 °C until use. Cell viability, as assessed by trypan blue exclusion test, was not affected by exposure to FFAs or iodothyronines. For microscopical analyses, cells were grown and treated directly on collagen-coated glass slides (Falcon, BD, Milano, Italy).
To investigate whether the lipid-lowering effects of T3 on FaO cells might depend on local, intracellular T3-to-T2 conversion, experiments with T3 were repeated in the presence of 6-propylthiouracil (PTU), an inhibitor of type I deiodinase. PTU was prepared from stock solution (10−2 M in 50 mM NaOH) and was added to the medium (at the dose of 10−4 M) contemporarily to T3 (Demori et al. 2004).
Lipid quantification
In intact cells, neutral lipids were visualized using the soluble selective oil-red-O (ORO) dye according to Koopman et al. (2001). After staining, slides were examined by Nikon Eclipse E80i light microscope (Nikon, Japan). Densitometric analysis was performed with a custom-made routine on the Optimas 6.5 image analysis system (Optimas, Washington, DC, USA).
Intracellular triacylglycerol (TAG) content was quantified using the commercial GPO–PAP kit (Roche), as described previously (Grasselli et al. 2010). After lysis of cells and lipid extraction according to the manufacturer's instructions, TAG content was assessed by spectrophotometric analysis. Values were normalized for the protein content determined by the bicinchoninic acid method using BSA as a standard (Wiechelman et al. 1988). Data are expressed as percent TAG content relative to controls.
Neutral lipids were also visualized by fluorescence microscopy using the selective Nile red (NR) dye (Koopman et al. 2001). Under non-saturating conditions, NR fluorescence is directly proportional to the amount of intracellular lipids. Cells grown on glass cover slips were rinsed twice with PBS and fixed with PBS containing 4% paraformaldehyde for 60 min at room temperature. After rinsing with PBS, cells were incubated with 1 μM NR in PBS for 15 min at room temperature. Then, cells were washed with PBS and mounted with 4′,6-diamidino-2-phenylindole (DAPI). Slides were examined by Nikon Eclipse E80i light microscope (Nikon) equipped with the standard epifluorescence filter set up for DAPI and Texas Red. Images were acquired with an exposure time of 100 ms.
RNA extraction and real-time RT-PCR
Total RNA was isolated from different hepatoma samples by the acid phenol:chloroform procedure using the TRIzol reagent according to the manufacturer's instructions (Chomczynski & Sacchi 1987). First-strand cDNA was synthesized from 1 μg total RNA (Grasselli et al. 2010). To differentiate between amplification of cDNA and that of contaminating genomic DNA, we performed a preliminary DNase I digestion of RNA samples. Quantitative RT-PCR was performed in quadruplicate in a final volume of 25 μl containing 0.3 μM of each primer, 10 ng cDNA, 1× SYBR Green PCR Master Mix and was analyzed in 96-well optical reaction by Chromo4 System PCR apparatus using the thermal protocol described elsewhere (Grasselli et al. 2008, 2011). The primer pairs employed in this study are listed in Table 1. The quantification cycle (Cq) represents the cycle number at which the amount of amplified target reaches the fixed threshold (Bustin et al. 2009). The relative quantity of target mRNA was calculated by using the comparative Cq method and was normalized for the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The normalized expression was expressed as relative quantity of mRNA (fold induction) with respect to controls (Pfaffl 2001).
Characteristics of the primer pairs used for RT-qPCR analysis
| Primer name | Primer sequence (5′→3′) | Annealing temperature (°C) | Product length (bp) | Accession ID | References |
|---|---|---|---|---|---|
| GAPDH | F: GACCCCTTCATTGACCTCAAC | 60 | 136 | DQ403053 | Grasselli et al. (2008) |
| GAPDH | R: CGCTCCTGGAAGATGGTGATGGG | ||||
| PPARγ | F: CGGAGTCCTCCCAGCTGTTCGCC | 60 | 116 | Y12882 | Grasselli et al. (2010) |
| PPARγ | R: GGCTCATATCTGTCTCCGTCTTC | ||||
| PPARα | F: CCCCACTTGAAGCAGATGACC | 60 | 139 | NM_013196 | Grasselli et al. (2011) |
| PPARα | R: CCCTAAGTACTGGTAGTCCGC | ||||
| PPARδ | F: AATGCCTACCTGAAAAACTTCAAC | 60 | 96 | AJ306400.1 | Grasselli et al. (2011) |
| PPARδ | R: TGCCTGCCACAGCGTCTCAAT | ||||
| TRα1 | F: TGCTGTGTGTGGACAAGATC | 66 | 174 | NM_001017960.1 | This work |
| TRα1 | R: ACTTTCATGTGGAGGAAGCGGCT | ||||
| TRβ1 | F: GCCCCATCCAGACCGAGGCC | 64 | 82 | AAA40916 | This work |
| TRβ1 | R: CCTCTCCACATGGCTCTTCCTG | ||||
| AOX | F: GCGCAAGGAGCGGGCCTCC | 64 | 89 | AAA40666 | This work |
| AOX | R: CTCGACGGCGCCGGGTATTC | ||||
| SCD-1 | F: CACACGCCGACCCTCACAACT | 60 | 97 | AF509569 | This work |
| SCD-1 | R: TCCGCCCTTCTCTTTGACAGCC |
Expression of TRα1 and TRβ1 was also evaluated in RNA samples isolated from six male Wistar rats (aged 8 weeks) purchased by Harlan Italy (S. Pietro al Natisone, Italy). Animal maintenance and treatment were carried out as described elsewhere (Grasselli et al. 2008) according to the guidelines of the European Community Council for animal care and use.
Oxygraphic measurements
O2 consumption was assayed in intact native FaO cells permeabilized with 30 μg/ml digitonin by a thermostatically controlled oxygraph apparatus equipped with an amperometric electrode (Unisense-Microrespiration, Unisense A/S, Denmark) that determines the μM of O2 of any solution. Oxymeter was connected to a PC running dedicated proprietary data logger software (MicOx, Unisense). An electromagnetic stirrer bar was used to mix the contents of the chamber. Additions were done by Hamilton syringes, through a rubber cup in a volume of no more than 0.05 ml. Electrode was equilibrated with the appropriate medium before each experiment, until the O2 consumption remained constant.
In experiments with control FaO cells, samples were incubated, at 25 °C, in the following respiration solution: 120 mM NaCl, 2 mM MgCl2, 1 mM KH2PO4, 50 mM Tris–HCl, pH 7.4, and 25 μg/ml ampicillin (final volume 1.7 ml; Ravera et al. 2009). After 2 min, the respiratory substrates and inhibitors were added in the following order: 10 mM pyruvate and 5 mM malate, 0.19 mM ADP, 40 μM rotenone, 20 mM succinate, 0.08 mM ADP, and 50 μM antimycin A. Pyruvate and malate were used as respiratory substrates to stimulate the pathway I+III+IV, while succinate was used for the pathway II+III+IV. To observe the ADP-stimulated respiration rates, ADP was added after pyruvate and malate or succinate addition. Rotenone (inhibitor of complex I) and antimycin A (inhibitor of complex III) were used as respiratory chain inhibitors. The respiratory rates were expressed in μM O2/min per mg.
The oxidative phosphorylation efficiency (P/O ratio), measured as coupling O2 consumption with ATP production, was calculated as the ratio between the amount of consumed ADP (nmoles) and the amount of O2 (nmoles) consumed during the ADP-induced respiration.
In experiments with iodothyronines, T2 or T3 (10−6 or 10−5 M) was added to control FaO cells directly in the chamber before the respiratory substrates. Experiments with T3 were repeated in the presence of the deiodinase inhibitor PTU (10−4 M) that was added before addition of iodothyronines and respiratory substrate. The same analyses were also carried out on lipid-loaded FaO cells.
Statistical analysis
Data on RT-qPCR are means±s.d. of at least three independent experiments, and each measurement was performed in quadruplicate. Data on TAG are means±s.d. of five independent experiments. The significance of the difference between groups was evaluated by using ANOVA followed by Bonferroni's post hoc test. Significant differences were reported: C versus FFAs *P≤0.05, **P≤0.01, and ***P≤0.001; and FFAs versus THs #P≤0.05, ##P≤0.01, and ###P≤0.001.
Results
Basal expression of TRα1 and TRβ1 in FaO cells
FaO cells have been reported to be deficient in functional TRα1 and TRβ1, and the absence of TRβ1 mRNA was shown by northern blot analysis (Munoz et al. 1990). In this study, we verified the lack of constitutive expression of both TRα1 and TRβ1 in control FaO cells by RT-qPCR. Figure 1 shows the amplification curves of TRα1 and TRβ1 transcripts for both rat liver and FaO samples in comparison with the amplification curves of the reference gene GAPDH. The Cq value for TRα1 in the rat liver was about 20, and in FaO cells, it was about 24, with a ΔCq over four cycles (Fig. 1A). Even larger difference was observed for TRβ1, the most abundant TR isoform in the hepatic cell. The Cq value for TRβ1 in the rat liver was about 19, while in FaO cells, it was about 28 with a ΔCq of about nine cycles (Fig. 1B). Exposure to different iodothyronines did not affect the level of TRα1 and TRβ1 transcripts in FaO cells (data not shown).
Relative abundance of TRα1 and TRβ1 in FaO cells. Basal expression of the thyroid hormone receptors quantified in FaO cells by RT-qPCR with respect to the rat liver. (A) Amplification curves of TRα1 and of the reference gene GAPDH in the rat liver and FaO cells. (B) Amplification curves of TRβ1 and of GAPDH in the rat liver and FaO cells. X-axis, amplification cycle number. Y-axis, normalized fluorescence signal.
Citation: Journal of Endocrinology 210, 1; 10.1530/JOE-11-0074
Effects of exogenous FFA-induced lipid accumulation in FaO cells
We first verified the time course of lipid accumulation in rat hepatoma FaO cells exposed to a FFA mixture (oleate/palmitate 2:1 molar ratio), according to the model of ‘cellular steatosis’ described in human hepatoma HepG2 cells (Feldstein et al. 2004) and in primary rat hepatocytes (Feldstein et al. 2004, Grasselli et al. 2011). FFA exposure induced a rapid time-dependent increase in lipid accumulation, evaluated by densitometric analysis of ORO staining, reaching a plateau at 3–6 h (about threefold with respect to controls; P≤0.001; Fig. 2A). FFA treatment did not result in lipotoxicity at any time point, as observed by trypan blue exclusion test (data not shown).
Lipid accumulation in FaO cells exposed to FFAs. (A) Neutral lipids were visualized by ORO staining in FaO cells incubated in the absence (C) or in the presence (FFAs) of the FFA mixture for 1, 3, and 6 h. Neutral lipid content was quantified by densitometric analysis of the optical microscopic images. Significant differences are denoted by symbols on bars (C versus FFAs, ***P≤0.001). (B) Representative images of NR-stained FaO cells incubated for 3 h in the absence (C) or in the presence (FFAs) of the FFA mixture demonstrating the lipid accumulation under the form of cytosolic LDs. (magnification 10×; Bar, 100 μm).
Citation: Journal of Endocrinology 210, 1; 10.1530/JOE-11-0074
Figure 2B shows representative images of Nile red (NR)-stained FaO cells incubated for 3 h in the absence (C) or the presence of the FFA mixture (FFAs); NR fluorescence allowed us to appreciate the marked accumulation of neutral lipids under form of cytosolic LDs.
Effects of iodothyronines on lipid accumulation
Lipid-loaded FaO cells were then treated for 24 h with two different concentrations of T2 or T3 (10−6 and 10−5 M), as described previously for primary rat hepatocytes (Grasselli et al. 2011). As a preliminary experiment, the dose–response curves were assessed for both iodothyronines in the range of 10−7–10−5 M, and no significant effect on the TAG content was observed at the lowest dose (10−7 M) of both T2 and T3 (data not shown). The incubation time and doses of iodothyronines were in the range of those typically employed for in vitro experiments on gene expression (Ball et al. 1997, Grasselli et al. 2011) or lipid metabolism (Giudetti et al. 2005). Moreover, several studies reported that a concentration of 10−6 M T3 was required to trigger non-genomic effects (Cheng et al. 2010) such as to increase IP3 and Ca2+ levels in BDL cholangiocytes (Fava et al. 2007).
Exposure of FaO cells to FFAs for 3 h resulted in a significant increase in TAG content with respect to controls (+104%; P≤0.001) as evaluated by spectrophotometric assay (Fig. 3). In lipid-loaded FaO cells, treatment with both T2 and T3 resulted in a significant (P≤0.001) reduction in TAG content (around −35% with respect to FFA cells) with similar effects of different concentrations of both THs.
Lipid-lowering effects of iodothyronines in FaO cells. TAG content was quantified by spectrophotometric assay in control (C) and lipid loaded-FaO cells incubated in the absence (FFAs) or the presence of T2 or T3 at two different doses (10−6 and 10−5 M). The effects of PTU on the FaO cells treated with T3 at both doses are also shown. Results are expressed as mean±s.d. from five independent experiments. Significant differences are denoted by symbols on bars (C versus FFAs, ***P≤0.001; FFAs versus THs, ###P≤0.001).
Citation: Journal of Endocrinology 210, 1; 10.1530/JOE-11-0074
In order to investigate whether the lipid-lowering effects of T3 on FaO cells might depend on local, intracellular T3-to-T2 conversion via deiodinase activities, the experiments with T3 were repeated in the presence of PTU, an inhibitor of type I deiodinase, that is known to be expressed in rat liver hepatocytes (Rooda et al. 1987). The effects of T3 were unchanged by PTU (Fig. 3).
Effects of FFAs and iodothyronines on PPAR expression
The relative abundance of mRNA transcripts for PPARα, PPARγ, and PPARδ was assessed by RT-qPCR in control cells (Fig. 4A). The Cq values were about 22.3 for PPARα, 25.2 for PPARδ, and 27.7 for PPARγ, thus pointing at the following relative abundance of PPAR isoform mRNA in FaO cells: PPARα>PPARδ>PPARγ.
Effects of excess lipids and THs on PPAR mRNA expression. (A) Relative abundance of the three PPAR isoforms (PPAR-α, -γ, -δ) quantified in FaO control cells by RT-qPCR. X-axis, amplification cycle number. Y-axis, normalized fluorescence signal. Relative mRNA expression of PPARα (B), PPARγ (C) and PPARδ (D) quantified by RT-qPCR in control (C) and lipid-loaded FaO cells incubated in the absence (FFAs) or in the presence of T2 or T3 (10−6 and 10−5 M) for 24 h. Significant differences are denoted by symbols on bars (C versus FFAs, *P≤0.05 and ***P≤0.001; FFAs versus THs, #P≤0.05 and ##P≤0.01).
Citation: Journal of Endocrinology 210, 1; 10.1530/JOE-11-0074
Lipid-loaded FaO cells did not show significant changes in PPARα mRNA expression (Fig. 4B). Treatment of lipid-loaded cells with the lowest dose of T2 significantly reduced mRNA expression of PPARα (about 0.4-fold induction with respect to control, −74% with respect to FFA samples; P≤0.01), whereas the decrease was not significant at the higher dose of T2. A similar decrease was observed with both doses of T3 (about 0.3-fold induction with respect to control at 10−6 M dose, −75% with respect to FFA samples; P≤0.01 and about 0.6-fold with respect to control at 10−5 M dose, −59% with respect to FFA samples; P≤0.05).
Different from PPARα, a significant increase in PPARγ mRNA expression was observed in FaO cells upon lipid loading (1.7-fold induction with respect to control; P≤0.05; Fig. 4C). The FFA-induced upregulation of PPARγ was abolished upon treatment of lipid-loaded cells with both T2 (about 0.6-fold induction at 10−6 M and about 0.8-fold at 10−5 M dose with respect to control; −64%, P≤0.01, and −55%, P≤0.05 respectively, with respect to FFA sample) or T3 (about 0.5-fold induction with respect to control at both doses, −70% with respect to FFA samples; P≤0.01; Fig. 4C).
An opposite trend was observed in the expression of PPARδ, whose mRNA level decreased upon exposure to FFAs (about 0.4-fold induction with respect to control; P≤0.001). Treatment of lipid-loaded cells with the highest dose of both T2 and T3 significantly increased PPARδ expression (about 0.9-fold induction for T2 and about 0.8-fold induction for T3 with respect to control; +122%, P≤0.01, and +103%, P≤0.01 respectively, with respect to FFA samples; Fig. 4D).
When the same treatments with iodothyronines were performed in control FaO cells, no significant effects could be appreciated in PPAR gene expression (data not shown).
Effects of FFAs and iodothyronines on mRNA expression of lipid metabolizing enzymes
The effects of different experimental conditions on the mRNA expression of AOX, the main enzyme in the peroxisomal β-oxidation, and of SCD1, a lipogenic enzyme converting saturated to monounsaturated FFAs, were also assessed.
Lipid-loaded FaO cells did not show significant changes in AOX mRNA expression with respect to controls (Fig. 5A), but a significant reduction was observed in lipid-loaded cells exposed to the highest dose of T2 or T3 (about 0.8-fold induction with respect to control; −45% with respect to FFA samples; P≤0.05). No significant changes in the expression of AOX mRNA were observed with the lowest doses of both iodothyronines.
Effects of excess lipids and iodothyronines on AOX and SCD1 mRNA expression. Relative mRNA expression of AOX (A) and SCD1 (B) quantified by RT-qPCR in control (C) and lipid-loaded FaO cells incubated in the absence (FFAs) or in the presence of T2 or T3 (10−6 and 10−5 M) for 24 h. Significant differences are denoted by symbols on bars (C versus FFAs, *P≤0.05; FFAs versus THs, #P≤0.05).
Citation: Journal of Endocrinology 210, 1; 10.1530/JOE-11-0074
An opposite trend was observed in the expression of SCD1, whose mRNA level decreased upon exposure to FFAs (about 0.6-fold induction with respect to control; P≤0.05). Treatment of lipid-loaded cells with T2 or T3 did not modify significantly SCD1 expression with respect to FFA samples or controls (Fig. 5B).
The same treatments with iodothyronines were performed in control cells, but no significant effects could be appreciated (data not shown).
Influence of iodothyronines on hepatocyte O2 consumption
Oxygen consumption in intact cells is mainly a reflection of mitochondrial respiration from glucose and FFAs to drive ATP production. To assess basal respiration of FaO cells, fuel-stimulated O2 consumption in intact cells was evaluated. Figure 6 reports a typical amperographic tracing of ADP-stimulated respiration rate in permeabilized FaO cells (panel A). Resting respiration rate was assessed in the presence of complex I (malate/pyruvate) or complex II (succinate/rotenone) substrates, and maximal ADP-stimulated respiration was measured by adding saturating ADP concentration. As expected, in control hepatocytes, respiration rates decreased after addition of rotenone and antimycin A respectively. After ADP addition, the P/O ratio for pyruvate/malate showed a value of 2.54±0.21 and for succinate of 1.54±0.14 that are within the range of values reported for other cell types (Cocco et al. 2009).
Influence of iodothyronines on hepatocyte O2 consumption. Measurements of respiration rates in whole FaO hepatoma cells. O2 consumption of fuel-stimulated FaO cells was evaluated in different experimental conditions. Each amperographic tracing is representative of at least four experiments. (Panel A) Amperographic tracing of basal respiration rates of control FaO cells upon the addition of different respiratory substrates. (Panels B and C) Amperographic tracings of respiration rates of FaO cells incubated in the presence of T2 or T3 (10−6 M). (Panel D) Amperographic tracing of respiration rates of lipid-loaded FaO cells (FFAs) upon the addition of different respiratory substrates. (Panel E) Changes in the angular coefficient values during the addition of several substrates in the different FaO samples. Values are representative of at least four experiments, and data are represented as mean±s.d.
Citation: Journal of Endocrinology 210, 1; 10.1530/JOE-11-0074
Addition of T2 or T3 (at both 10−6 and 10−5 M doses) to control cells before the respiratory substrates prevented the ADP-induced transient stimulation of O2 consumption (panels B and C), indicating that both iodothyronines effectively uncoupled previously well-coupled hepatocyte mitochondria. Oxygen consumption rates induced by the different respiratory substrates (panel E) confirm this apparent uncoupling.
Addition of PTU before the T3 incubations did not modify the amperographic tracing of ADP-stimulated respiration rate (Table 2), thus demonstrating that the effect of T3 on mitochondrial respiration does not depend on the conversion of T3 into T2.
Effect of treatment with 6-propylthiouracil on O2 consumption by whole FaO hepatoma cells incubated with 10−5 M T3. The values shown are from a representative experiment of at least three performed
| Oxygen consumption (μM O2/min per mg protein) | ||
|---|---|---|
| T3 10−5 M | T3 10−5 M+PTU | |
| Sample | 205.43 | 215.54 |
| Hormone | 216.78 | 224.84 |
| Pyruvate/malate | 228.95 | 240.35 |
| ADP | 229.86 | 241.02 |
| Rotenone | 8.6 | 9.1 |
| Succinate | 132.58 | 148.71 |
| ADP | 131.29 | 149.52 |
| Antimycin A | 2.3 | 3.6 |
The amperographic tracing of ADP-stimulated respiration rate in lipid-loaded FaO cells (panel D) showed that addition of ADP did not result in a significant increase in O2 consumption. The lack of the ADP effect may reflect uncoupled mitochondrial respiration in lipid-loaded hepatocytes or a difficult access of ADP into the mitochondria of whole cells filled with LDs. With regard to this, a difficult access of all substrates into the mitochondria in the presence of TAG in excess was observed (not shown). Addition of T2 or T3 to lipid-loaded FaO cells resulted in a very high noise in the amperographic tracing that did not allow for the measurement of mitochondrial respiration (data not shown).
Discussion
In this study, a well-differentiated rat hepatoma cell line (FaO), previously reported to be deficient of functional TRs (Munoz et al. 1990), was used to investigate whether the direct effects of iodothyronines in reducing the excess lipid accumulation, previously observed in primary rat hepatocytes (Grasselli et al. 2011), can depend on ‘non-receptor-mediated’ mechanisms. This ‘minimum deviation’ hepatoma cell line has been shown to secrete albumin, to maintain a number of other hepatocyte-specific differentiation markers, and to respond to hormonal stimulation as adult primary hepatocytes (Clayton et al. 1985, Lauris et al. 1986).
In humans and rodents, TRs are encoded by two genes. The Thra gene encodes three isoforms, but only TRα1 binds T3 (Izumo & Mahdavi 1988, Lazar 1993). The Thrb gene encodes two variants, TRβ1 and TRβ2 (Weiss et al. 1998, Ye et al. 2003). A previous study using the cDNA microarray analysis of TRβ knockout mice treated with T3 demonstrated that the expression of a large number of genes was induced by THs also in the absence of TRβ1 (Flores-Morales et al. 2002). In the liver, the TRα1 levels are much lower than those of TRβ1, and most actions of THs are mediated by the TRβ1 isoform. Therefore, as a first step of this study, we verified the absence of constitutive mRNA expression of both TRα1 and TRβ1 in FaO cells by comparing their mRNA levels with those recorded in the rat liver. The primer pair for TRα utilized in this study recognizes also the two truncated forms p43 and p28 that are synthesized by alternative translational initiation (Wrutniak-Cabello et al. 2001). While p43 acts as a mitochondrial transcription factor (Casas et al. 2009), p28 seems to be involved in the early mitochondrial T3 influence (Wrutniak-Cabello et al. 2001). Our results confirm that in FaO cells, the level of mRNA transcripts for TRs is negligible when compared with that of the rat liver.
According to the model of ‘in vitro steatosis’ that we developed on primary rat hepatocytes, the lipid-loading protocol was extended with some modifications to FaO cells that were exposed for 3 h to an oleate/palmitate mixture (0.75 mM final concentration) that well mimics the plasmatic FFA levels of patients with the metabolic syndrome (Ferrannini et al. 1983, Vock et al. 2008). FFAs entering the hepatic cell are assembled in the cytosol into TAGs, representing the major component of neutral lipids (57% of total) that are stored under the form of LDs. When lipid-loaded FaO cells were treated with T2 or T3 for 24 h, the TAG content was reduced to values comparable with those observed in control cells. These results demonstrate that the lipid-lowering effect exerted by both T2 and T3 directly on the hepatic cell can occur also in the absence of TRs.
Many ‘non-receptor-mediated’ actions of THs have been described in a variety of cells involving different signal transduction systems and novel membrane-associated receptors (Davis et al. 2008, Davis 2010). A feature of ‘non-receptor-mediated’ mechanisms of iodothyronines is the plurality of TH derivatives, including T2, or of functional analogs that may initiate specific actions and might have higher potency than T3 (Cioffi et al. 2010b). The ability of THs to regulate energy utilization as well as their role in promoting mitochondrial uncoupling of substrate oxidation from ATP synthesis have been long recognized. T2, as T3, was shown to rapidly stimulate hepatic O2 uptake when injected in perfused livers (Horst et al. 1989), or added to mitochondria isolated from hypothyroid rats (Moreno et al. 2002). Similar effects of T3 have been observed in hepatocytes isolated from hypothyroid animals (Nobes et al. 1990).
In this study, the effects of T2 and T3 on the O2 consumption in hepatic cells that do not express TRs were evaluated. The results clearly indicate that addition of both iodothyronines to whole hepatocytes rapidly induced uncoupling of previously well-coupled mitochondria. To our knowledge, these data represent the first report of the uncoupling effect of T2 and T3 in whole hepatocytes in the presence of adequate fuel and O2 that confirm previous reports, demonstrating the uncoupling effects of THs on isolated mitochondria (Goglia et al. 1999). The short-term effects of T3, and particularly of T2, on mitochondrial respiration could be due to allosteric interaction with cytochrome c oxidase (COX) Va subunit, as shown in isolated rat liver mitochondria (Goglia et al. 1994, Arnold et al. 1998). The Kadenback group showed that in mitochondria, intrinsic and extrinsic uncoupling mechanisms of oxidative phosphorylation may take place through COX (Ramzan et al. 2010). Moreover, T3 was reported to stimulate in vitro the mitochondrial adenine nucleotide translocase 1 that catalyzes the exchange of ADP and ATP across the mitochondrial inner membrane (Sterling & Brenner 1995). Despite all these hypotheses, further investigations are needed to fully clarify the mechanisms involved in the uncoupling effect of T2 and T3.
In addition to the short-term effects on mitochondria, THs are known to exert pleiotropic effects on lipid metabolism. In the liver, THs stimulate enzymes regulating both lipogenesis and lipolysis. Since PPARs also play a crucial role in lipid metabolism, the transcription profiles of the three subtypes, PPARα, PPARγ, and PPARδ, were evaluated in FaO cells in different experimental conditions. Our results showed that all the three subtypes were constitutively expressed in rat FaO hepatoma cells, with higher expression of PPARα and PPARδ compared with PPARγ. Excess lipid accumulation in FaO cells resulted in upregulation of PPARγ mRNA, whereas that of PPARα was unaffected. These data are in line with the role of PPARγ in promoting lipid storage (Gavrilova et al. 2003, Schadinger et al. 2005). Moreover, in HepG2 cells, expression of PPARα was increased by palmitate (Ricchi et al. 2009). Therefore, the absence of PPARα upregulation in lipid-loaded FaO cells may depend on the excess oleate versus palmitate (2:1) in the FFA mixture, and this excess oleate may also explain the decrease in the transcription of SCD1 observed in lipid-loaded FaO cells, since this enzyme synthesizes oleic acid. On the other hand, the downregulation of PPARδ observed in lipid-loaded FaO cells fits well with previous reports showing an opposite regulation of PPARδ and PPARγ in ob/ob mice (Roberts et al. 2009). Indeed, PPARδ was shown to increase the synthesis of high-density lipoproteins, to inhibit LD formation in the liver, and to enhance FFA catabolism and energy uncoupling in adipose tissue and muscle (Wang et al. 2003, Nagasawa et al. 2006). Therefore, the concomitant downregulation of PPARδ and upregulation of PPARγ in lipid-loaded FaO cells may sustain inhibition of FFA oxidation and secretion, and promote their storage into LDs. Overall, the differential transcription pattern of the three PPAR subtypes suggests that, in our in vitro model of hepatic steatosis, the hepatocyte did not activate markedly β-oxidation pathways (through PPARα- and PPARδ-mediated mechanisms), as confirmed by the lack of significant changes in the expression of their downstream lipolytic gene AOX, but induced the storing of excess fat in LDs (probably through PPARγ-mediated mechanisms).
Treatment of lipid-enriched FaO cells with iodothyronines leads to a decrease in TAG content. Accordingly, the FFA-induced upregulation of PPARγ was abolished following incubation with either T2 or T3 that also decreased the mRNA expression of PPARα and upregulated the expression of PPARδ. In the light of the role of PPARδ in promoting synthesis of high-density lipoproteins, FFA catabolism and energy uncoupling, and inhibiting LD formation, our data indicate that in lipid-loaded hepatocytes, both iodothyronines may act by stimulation of FFA catabolism and energy uncoupling, at the same time decreasing LD formation. Moreover, the decrease in intracellular lipid content induced by both T2 and T3 could be coupled with changes in the synthesis of lipoproteins and in the rate of lipid exocytosis, and experiments are in progress to investigate this mechanism.
We wish to underline that our study showing that T2 is as effective as T3 in reducing the fat excess in lipid-loaded FaO cells may be of great interest since it supports the possible utilization of T2 as a pharmacological tool in the treatment of dysmetabolic syndromes such as NAFLD, also in the light of its lack of thyrotoxic effects (Cimmino et al. 1996, Cioffi et al. 2010a).
In conclusion, this study demonstrates that the lipid-lowering effect of iodothyronines in FaO rat hepatoma cells occurs via non-receptor-mediated mechanisms that seem to involve both a short-term action by stimulation of mitochondrial O2 consumption and a long-term action by differential transcriptional effects on PPARs that could in turn activate pathways promoting mitochondrial oxidation and/or lipid exocytosis.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by research grants from MIUR-COFIN 2008 (Prot. 20089SRS2X_002), Compagnia San Paolo (Torino), and University of Genoa.
Author contribution statement
All authors contributed to this work significantly. E G followed all the experimental activities and carried out the RT-qPCR experiments; A V and L C followed the activities of hepatoma cell culture and treatments, supervised all the experimental activities, and revised the manuscript; G G and F G supported the experimental design and revised the manuscript; S R and I P performed the oxygraphic measurements; L V carried out the planning of the study, analyzed the data, and wrote the manuscript; G G provided funding, laboratory facilities, and project oversight.
Acknowledgements
We thank Giulia Vecchione for her collaboration in experimental activity. A special thanks to Dr Giorgio Filosa for his help with TAG content assessment, and to Prof. Emilia Fugassa for her critical reading of the manuscript and for the constant support and encouragement.
References
Arnold S, Goglia F & Kadenbach B 1998 3,5-Diiodothyronine binds to subunit Va of cytochrome-c oxidase and abolishes the allosteric inhibition of respiration by ATP. European Journal of Biochemistry 252 325–330 doi:10.1046/j.1432-1327.1998.2520325.x.
Ball SG, Sokolov J & Chin WW 1997 3,5-Diiodo-l-thyronine (T2) has selective thyromimetic effects in vivo and in vitro. Journal of Molecular Endocrinology 19 137–147 doi:10.1677/jme.0.0190137.
Barish GD, Narkar VA & Evans RM 2006 PPAR delta: a dagger in the heart of the metabolic syndrome. Journal of Clinical Investigation 116 590–597 doi:10.1172/JCI27955.
Bassett JH, Harvey CB & Williams GR 2003 Mechanisms of thyroid hormone receptor-specific nuclear and extra nuclear actions. Molecular and Cellular Endocrinology 213 1–11 doi:10.1016/j.mce.2003.10.033.
Bergh JJ, Lin HY, Lansing L, Mohamed SN, Davis FB, Mousa S & Davis PJ 2005 Integrin alphaVbeta3 contains a cell surface receptor site for thyroid hormone that is linked to activation of mitogen-activated protein kinase and induction of angiogenesis. Endocrinology 146 2864–2871 doi:10.1210/en.2005-0102.
Burns KA & Vanden Heuvel JP 2007 Modulation of PPAR activity via phosphorylation. Biochimica et Biophysica Acta 1771 952–960 doi:10.1016/j.bbalip.2007.04.018.
Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW & Shipley GL et al. 2009 The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry 55 611–622 doi:10.1373/clinchem.2008.112797.
Casas F, Pessemesse L, Grandemange S, Seyer P, Baris O, Gueguen N, Ramonatxo C, Perrin F, Fouret G & Lepourry L et al. 2009 Overexpression of the mitochondrial T3 receptor induces skeletal muscle atrophy during aging. PLoS ONE 4 e5631 doi:10.1371/journal.pone.0005631.
Cheng SY, Leonard JL & Davis PJ 2010 Molecular aspects of thyroid hormone actions. Endocrine Reviews 31 139–170 doi:10.1210/er.2009-0007.
Chomczynski P & Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Analytical Biochemistry 162 156–159 doi:10.1016/0003-2697(87)90021-2.
Chu R, Lin Y, Rao MS & Reddy JK 1995 Cooperative formation of higher order peroxisome proliferator-activated receptor and retinoid X receptor complexes on the peroxisome proliferator responsive element of the rat hydratase–dehydrogenase gene. Journal of Biological Chemistry 270 29636–29639 doi:10.1074/jbc.270.30.17917.
Cimmino M, Mion F, Goglia F, Minaire Y & Geloen A 1996 Demonstration of in vivo metabolic effects of 3,5-di-iodothyronine. Journal of Endocrinology 149 319–325 doi:10.1677/joe.0.1490319.
Cioffi F, Lanni A & Goglia F 2010a Thyroid hormones, mitochondrial bioenergetics and lipid handling. Current Opinion in Endocrinology, Diabetes, and Obesity 17 402–407 doi:10.1097/MED.0b013e32833cf354.
Cioffi F, Zambad SP, Chhipa L, Senese R, Busiello RA, Tuli D, Munshi S, Moreno M, Lombardi A & Gupta RC et al. 2010b TRC150094, a novel functional analog of iodothyronines, reduces adiposity by increasing energy expenditure and fatty acid oxidation in rats receiving a high-fat diet. FASEB Journal 24 3451–3461 doi:10.1096/fj.10-157115.
Clayton DF, Weiss M & Darnell JE Jr 1985 Liver-specific RNA metabolism in hepatoma cells: variations in transcription rates and mRNA levels. Molecular and Cellular Biology 5 2633–2641.
Cocco T, Pacelli C, Sgobbo P & Villani G 2009 Control of OXPHOS efficiency by complex I in brain mitochondria. Neurobiology of Aging 30 622–629 doi:10.1016/j.neurobiolaging.2007.08.002.
Davis P 2010 New insights into thyroid hormone actions and lipid metabolism. Current Opinion in Endocrinology, Diabetes, and Obesity 17 395 doi:10.1097/MED.0b013e32833e2f0f.
Davis PJ, Leonard JL & Davis FB 2008 Mechanisms of nongenomic actions of thyroid hormone. Frontiers in Neuroendocrinology 29 211–218 doi:10.1016/j.yfrne.2007.09.003.
Demori I, Bottazzi C, Voci A, Gallo G, Scharf JG & Fugassa E 1997 Tri-iodothyronine increases insulin-like growth factor binding protein-4 expression in rat hepatocytes. Journal of Endocrinology 154 155–165 doi:10.1677/joe.0.1540155.
Demori I, Gerdoni E, Fugassa E & Voci A 2004 3,5-Diiodothyronine mimics the effect of triiodothyronine on insulin-like growth factor binding protein-4 expression in cultured rat hepatocytes. Hormone and Metabolic Research 36 679–685 doi:10.1055/s-2004-826017.
Fava G, Ueno Y, Glaser S, Francis H, Demorrow S, Marucci L, Marzioni M, Benedetti A, Venter J & Vaculin B et al. 2007 Thyroid hormone inhibits biliary growth in bile duct-ligated rats by PLC/IP(3)/Ca(2+)-dependent downregulation of SRC/ERK1/2. American Journal of Physiology. Cell Physiology 292 C1467–C1475 doi:10.1152/ajpcell.00575.2006.
Feldstein AE, Werneburg NW, Canbay A, Guicciardi ME, Bronk SF, Rydzewski R, Burgart LJ & Gores GJ 2004 Free fatty acids promote hepatic lipotoxicity by stimulating TNF-alpha expression via a lysosomal pathway. Hepatology 40 185–194 doi:10.1002/hep.20283.
Ferrannini E, Barrett EJ, Bevilacqua S & DeFronzo RA 1983 Effect of fatty acids on glucose production and utilization in man. Journal of Clinical Investigation 72 1737–1747 doi:10.1172/JCI111133.
Flores-Morales A, Gullberg H, Fernandez L, Stahlberg N, Lee NH, Vennstrom B & Norstedt G 2002 Patterns of liver gene expression governed by TRbeta. Molecular Endocrinology 16 1257–1268 doi:10.1210/me.16.6.1257.
Gavrilova O, Haluzik M, Matsusue K, Cutson JJ, Johnson L, Dietz KR, Nicol CJ, Vinson C, Gonzalez FJ & Reitman ML 2003 Liver peroxisome proliferator-activated receptor gamma contributes to hepatic steatosis, triglyceride clearance, and regulation of body fat mass. Journal of Biological Chemistry 278 34268–34276 doi:10.1074/jbc.M300043200.
Giudetti AM, Leo M, Geelen MJ & Gnoni GV 2005 Short-term stimulation of lipogenesis by 3,5-l-diiodothyronine in cultured rat hepatocytes. Endocrinology 146 3959–3966 doi:10.1210/en.2005-0345.
Goglia F, Lanni A, Barth J & Kadenbach B 1994 Interaction of diiodothyronines with isolated cytochrome c oxidase. FEBS Letters 346 295–298 doi:10.1016/0014-5793(94)00476-5.
Goglia F, Moreno M & Lanni A 1999 Action of thyroid hormones at the cellular level: the mitochondrial target. FEBS Letters 452 115–120 doi:10.1016/S0014-5793(99)00642-0.
Grasselli E, Canesi L, Voci A, De Matteis R, Demori I, Fugassa E & Vergani L 2008 Effects of 3,5-diiodo-l-thyronine administration on the liver of high fat diet-fed rats. Experimental Biology and Medicine 233 549–557 doi:10.3181/0710-RM-266.
Grasselli E, Voci A, Pesce C, Canesi L, Fugassa E, Gallo G & Vergani L 2010 PAT protein mRNA expression in primary rat hepatocytes: effects of exposure to fatty acids. International Journal of Molecular Medicine 25 505–512 doi:10.3892/ijmm_00000370.
Grasselli E, Voci A, Canesi L, De Matteis R, Goglia F, Cioffi F, Fugassa E, Gallo G & Vergani L 2011 Direct effects of iodothyronines on excess fat storage in rat hepatocytes. Journal of Hepatology In press doi:10.1016/j.jhep.2010.09.027.
Horst C, Rokos H & Seitz HJ 1989 Rapid stimulation of hepatic oxygen consumption by 3,5-di-iodo-l-thyronine. Biochemical Journal 261 945–950.
Izumo S & Mahdavi V 1988 Thyroid hormone receptor alpha isoforms generated by alternative splicing differentially activate myosin HC gene transcription. Nature 334 539–542 doi:10.1038/334539a0.
Konig B & Eder K 2006 Differential action of 13-HPODE on PPARalpha downstream genes in rat Fao and human HepG2 hepatoma cell lines. Journal of Nutritional Biochemistry 17 410–418 doi:10.1016/j.jnutbio.2005.08.011.
Konig B, Koch A, Giggel K, Dordschbal B, Eder K & Stangl GI 2008 Monocarboxylate transporter (MCT)-1 is up-regulated by PPARalpha. Biochimica et Biophysica Acta 1780 899–904 doi:10.1016/j.bbagen.2008.03.002.
Koopman R, Schaart G & Hesselink MK 2001 Optimisation of oil red O staining permits combination with immunofluorescence and automated quantification of lipids. Histochemistry and Cell Biology 116 63–68 doi:10.1007/s004180100297.
Lanni A, Moreno M, Lombardi A, de Lange P, Silvestri E, Ragni M, Farina P, Baccari GC, Fallahi P & Antonelli A et al. 2005 3,5-Diiodo-l-thyronine powerfully reduces adiposity in rats by increasing the burning of fats. FASEB Journal 19 1552–1554 doi:10.1096/fj.05-3977fje.
Lauris V, Crettaz M & Kahn CR 1986 Coordinate roles of insulin and glucose on the growth of hepatoma cells in culture. Endocrinology 118 2519–2524 doi:10.1210/endo-118-6-2519.
Lazar MA 1993 Thyroid hormone receptors: multiple forms, multiple possibilities. Endocrine Reviews 14 184–193 doi:10.1210/edrv-14-2-184.
Lu C & Cheng SY 2010 Thyroid hormone receptors regulate adipogenesis and carcinogenesis via crosstalk signaling with peroxisome proliferator-activated receptors. Journal of Molecular Endocrinology 44 143–154 doi:10.1677/JME-09-0107.
Martin G, Schoonjans K, Lefebvre AM, Staels B & Auwerx J 1997 Coordinate regulation of the expression of the fatty acid transport protein and acyl-CoA synthetase genes by PPARalpha and PPARgamma activators. Journal of Biological Chemistry 272 28210–28217 doi:10.1074/jbc.272.45.28210.
Mollica MP, Lionetti L, Moreno M, Lombardi A, De Lange P, Antonelli A, Lanni A, Cavaliere G, Barletta A & Goglia F 2009 3,5-Diiodo-l-thyronine, by modulating mitochondrial functions, reverses hepatic fat accumulation in rats fed a high-fat diet. Journal of Hepatology 51 363–370 doi:10.1016/j.jhep.2009.03.023.
Moreno M, Lanni A, Lombardi A & Goglia F 1997 How the thyroid controls metabolism in the rat: different roles for triiodothyronine and diiodothyronines. Journal of Physiology 2 529–538 doi:10.1111/j.1469-7793.1997.529bb.x.
Moreno M, Lombardi A, Beneduce L, Silvestri E, Pinna G, Goglia F & Lanni A 2002 Are the effects of T3 on resting metabolic rate in euthyroid rats entirely caused by T3 itself? Endocrinology 143 504–510 doi:10.1210/en.143.2.504.
Moreno M, Lombardi A, Silvestri E, Senese R, Cioffi F, Goglia F, Lanni A & de Lange P 2010 PARs: nuclear receptors controlled by, and controlling, nutrient handling through nuclear and cytosolic signaling. PPAR Research 2010, Article ID 435689 doi:10.1155/2010/435689.
Munoz A, Hoppner W, Sap J, Brady G, Nordstrom K, Seitz HJ & Vennstrom B 1990 The chicken c-erbA alpha-product induces expression of thyroid hormone-responsive genes in 3,5,3′-triiodothyronine receptor-deficient rat hepatoma cells. Molecular Endocrinology 4 312–320 doi:10.1210/mend-4-2-312.
Nagasawa T, Inada Y, Nakano S, Tamura T, Takahashi T, Maruyama K, Yamazaki Y, Kuroda J & Shibata N 2006 Effects of bezafibrate, PPAR pan-agonist, and GW501516, PPARdelta agonist, on development of steatohepatitis in mice fed a methionine- and choline-deficient diet. European Journal of Pharmacology 536 182–191 doi:10.1016/j.ejphar.2006.02.028.
Nobes CD, Brown GC, Olive PN & Brand MD 1990 Non-ohmic proton conductance of the mitochondrial inner membrane in hepatocytes. Journal of Biological Chemistry 265 12903–12909.
Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 e45 doi:10.1093/nar/29.9.e45.
Qin B, Anderson RA & Adeli K 2008 Tumor necrosis factor-alpha directly stimulates the overproduction of hepatic apolipoprotein B100-containing VLDL via impairment of hepatic insulin signaling. American Journal of Physiology. Gastrointestinal and Liver Physiology 294 G1120–G1129 doi:10.1152/ajpgi.00407.2007.
Ramzan R, Staniek K, Kadenbach B & Vogt S 2010 Mitochondrial respiration and membrane potential are regulated by the allosteric ATP-inhibition of cytochrome c oxidase. Biochimica et Biophysica Acta 1797 1672–1680 doi:10.1016/j.bbabio.2010.06.005.
Ravera S, Panfoli I, Calzia D, Aluigi MG, Bianchini P, Diaspro A, Mancardi G & Morelli A 2009 Evidence for aerobic ATP synthesis in isolated myelin vesicles. International Journal of Biochemistry and Cell Biology 41 1581–1591 doi:10.1016/j.biocel.2009.01.009.
Ricchi M, Odoardi MR, Carulli L, Anzivino C, Ballestri S, Pinetti A, Fantoni LI, Marra F, Bertolotti M & Banni S et al. 2009 Differential effect of oleic and palmitic acid on lipid accumulation and apoptosis in cultured hepatocytes. Journal of Gastroenterology and Hepatology 24 830–840 doi:10.1111/j.1440-1746.2008.05733.x.
Roberts LD, Hassall DG, Winegar DA, Haselden JN, Nicholls AW & Griffin JL 2009 Increased hepatic oxidative metabolism distinguishes the action of peroxisome proliferator-activated receptor delta from peroxisome proliferator-activated receptor gamma in the ob/ob mouse. Genome Medicine 1 115 doi:10.1186/gm115.
Rooda SJ, van Loon MA & Visser TJ 1987 Metabolism of reverse triiodothyronine by isolated rat hepatocytes. Journal of Clinical Investigation 79 1740–1748 doi:10.1172/JCI113014.
Schadinger SE, Bucher NL, Schreiber BM & Farmer SR 2005 PPARgamma2 regulates lipogenesis and lipid accumulation in steatotic hepatocytes. American Journal of Physiology. Endocrinology and Metabolism 288 E1195–E1205 doi:10.1152/ajpendo.00513.2004.
Schoonjans K, Staels B & Auwerx J 1996 The peroxisome proliferator activated receptors (PPARS) and their effects on lipid metabolism and adipocyte differentiation. Biochimica et Biophysica Acta 1302 93–109 doi:10.1016/0005-2760(96)00066-5.
Shan W, Nicol CJ, Ito S, Bility MT, Kennett MJ, Ward JM, Gonzalez FJ & Peters JM 2008 Peroxisome proliferator-activated receptor-beta/delta protects against chemically induced liver toxicity in mice. Hepatology 47 225–235 doi:10.1002/hep.21925.
Sterling K & Brenner MA 1995 Thyroid hormone action: effect of triiodothyronine on mitochondrial adenine nucleotide translocase in vivo and in vitro. Metabolism 44 193–199 doi:10.1016/0026-0495(95)90264-3.
Sterling K, Campbell GA & Brenner MA 1984 Purification of the mitochondrial triiodothyronine (T3) receptor from rat liver. Acta Endocrinologica 105 391–397 doi:10.1530/acta.0.1050391.
Viswakarma N, Jia Y, Bai L, Vluggens A, Borensztajn J, Xu J & Reddy JK 2010 Coactivators in PPAR-regulated gene expression. PPAR Research 2010, Article ID 250126 doi:10.1155/2010/250126.
Vock C, Gleissner M, Klapper M & Doring F 2008 Oleate regulates genes controlled by signaling pathways of mitogen-activated protein kinase, insulin, and hypoxia. Nutrition Research 28 681–689 doi:10.1016/j.nutres.2008.06.010.
Wang YX, Lee CH, Tiep S, Yu RT, Ham J, Kang H & Evans RM 2003 Peroxisome-proliferator-activated receptor delta activates fat metabolism to prevent obesity. Cell 113 159–170 doi:10.1016/S0092-8674(03)00269-1.
Waters KM, Miller CW & Ntambi JM 1997 Localization of a negative thyroid hormone-response region in hepatic stearoyl-CoA desaturase gene 1. Biochemical and Biophysical Research Communications 233 838–843 doi:10.1006/bbrc.1997.6550.
Weiss RE, Murata Y, Cua K, Hayashi Y, Seo H & Refetoff S 1998 Thyroid hormone action on liver, heart, and energy expenditure in thyroid hormone receptor beta-deficient mice. Endocrinology 139 4945–4952 doi:10.1210/en.139.12.4945.
Wiechelman KJ, Braun RD & Fitzpatrick JD 1988 Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical Biochemistry 175 231–237 doi:10.1016/0003-2697(88)90383-1.
Wrutniak C, Cassar-Malek I, Marchal S, Rascle A, Heusser S, Keller JM, Flechon J, Dauca M, Samarut J & Ghysdael J et al. 1995 A 43-kDa protein related to c-Erb A alpha 1 is located in the mitochondrial matrix of rat liver. Journal of Biological Chemistry 270 16347–16354 doi:10.1074/jbc.270.27.16347.
Wrutniak-Cabello C, Casas F & Cabello G 2001 Thyroid hormone action in mitochondria. Journal of Molecular Endocrinology 26 67–77 doi:10.1677/jme.0.0260067.
Xu HE, Lambert MH, Montana VG, Parks DJ, Blanchard SG, Brown PJ, Sternbach DD, Lehmann JM, Wisely GB & Willson TM et al. 1999 Molecular recognition of fatty acids by peroxisome proliferator-activated receptors. Molecular Cell 3 397–403 doi:10.1016/S1097-2765(00)80467-0.
Yao-Borengasser A, Rassouli N, Varma V, Bodles AM, Rasouli N, Unal R, Phanavanh B, Ranganathan G, McGehee RE Jr & Kern PA 2008 Stearoyl-coenzyme A desaturase 1 gene expression increases after pioglitazone treatment and is associated with peroxisomal proliferator-activated receptor-gamma responsiveness. Journal of Clinical Endocrinology 93 4431–4439 doi:10.1210/jc.2008-0782.
Ye L, Li YL, Mellstrom K, Mellin C, Bladh LG, Koehler K, Garg N, Garcia Collazo AM, Litten C & Husman B et al. 2003 Thyroid receptor ligands. 1. Agonist ligands selective for the thyroid receptor beta1. Journal of Medicinal Chemistry 46 1580–1588 doi:10.1021/jm021080f.
Yu S, Matsusue JK, Kashireddy P, Cao WQ, Yeldandi V, Yeldandi AV, Rao MS, Gonzalez FJ & Reddy JK 2003 Adipocyte-specific gene expression and adipogenic steatosis in the mouse liver due to peroxisome proliferator-activated receptor gamma1 (PPARgamma1) overexpression. Journal of Biological Chemistry 278 498–505 doi:10.1074/jbc.M210062200.
