Abstract
Mice bearing the genomic mutation Δ337T on the thyroid hormone receptor β (TRβ) gene present the classical signs of resistance to thyroid hormone (TH), with high serum TH and TSH. This mutant TR is unable to bind TH, remains constitutively bound to co-repressors, and has a dominant negative effect on normal TRs. In this study, we show that homozygous (TRβΔ337T) mice for this mutation have reduced body weight, length, and body fat content, despite augmented relative food intake and relative increase in serum leptin. TRβΔ337T mice exhibited normal glycemia and were more tolerant to an i.p. glucose load accompanied by reduced insulin secretion. Higher insulin sensitivity was observed after single insulin injection, when the TRβΔ337T mice developed a profound hypoglycemia. Impaired hepatic glucose production was confirmed by the reduction in glucose generation after pyruvate administration. In addition, hepatic glycogen content was lower in homozygous TRβΔ337T mice than in wild type. Collectively, the data suggest that TRβΔ337T mice have deficient hepatic glucose production, by reduced gluconeogenesis and lower glycogen deposits. Analysis of liver gluconeogenic gene expression showed a reduction in the mRNA of phosphoenolpyruvate carboxykinase, a rate-limiting enzyme, and of peroxisome proliferator-activated receptor-γ coactivator 1α, a key transcriptional factor essential to gluconeogenesis. Reduction in both gene expressions is consistent with resistance to TH action via TRβ, reproducing a hypothyroid phenotype. In conclusion, mice carrying the Δ337T-dominant negative mutation on the TRβ are leaner, exhibit impaired hepatic glucose production, and are more sensitive to hypoglycemic effects of insulin.
Introduction
Thyroid hormones (TH) exert profound effects on metabolism and growth. Most of TH actions occur through the nuclear TH receptors (TRs), which are ligand-dependent and ligand-independent transcription factors (Yen 2001). TRs are encoded by two distinct genes, Thrα and Thrβ, located on mouse chromosomes 11 and 14 (Thompson et al. 1987, Wood et al. 1991). The use of alternative splicing or transcription initiation sites generates at least three TH-binding isoforms TRα1, TRβ1, and TRβ2. These isoforms display a distinct pattern of expression among tissues and during developmental stages (Yen 2001). The molecular mechanism of TH action involves TR binding to TH-responsive elements on the promoter region of target genes (Forman et al. 1992, Shibusawa et al. 2003) and the recruitment of transcriptional co-factors. These co-factors may act as co-activators, including members of the steroid receptor co-activator family (Hong et al. 1997, Ortiga-Carvalho et al. 2005) and the peroxisome proliferator-activated receptor-γ co-activator 1 (PGC1; Wu et al. 2002), or co-repressors (CoR), more importantly the nuclear receptor CoR and the silencing mediator of TR and retinoic acid receptor (Ishizuka & Lazar 2003).
Mice bearing TR mutations have been used as a tool to study TH effects in genes regulated by different TR isoforms. Here, we used mice that express the TRβΔ337T, which cannot bind TH, being constitutively associated with CoR and acting as a potent dominant negative inhibitor of the WT TR (Safer et al. 1998, Pazos-Moura et al. 2000, Hashimoto et al. 2001). This mouse model reproduces the human syndrome of resistance to TH (Hashimoto et al. 2001). Because of the hypothalamic–pituitary resistance to TH, serum TSH and TH were elevated and tissues present variable degrees of resistance, depending on the type of predominant receptor and on the specific mutation (O'Shea et al. 2006). Previous studies have shown that TRβΔ337T mice presented alterations in cholesterol metabolism (Hashimoto et al. 2006) and were deficient in S cone expression in the retina (Pessôa et al. 2008).
TH effects on growth, body composition, and glucose homeostasis have been described and result from the action of TH on different tissues (Dimitriadis & Raptis 2001, Fukuchi et al. 2002, Bassett et al. 2007); however, the molecular mechanisms and the subtype of TR predominantly involved are not completely understood. Thus, the aim of this study was to investigate the consequences of the impairment of TR signaling on growth, adiposity, and glucose metabolism of mice carrying the Δ337T mutation on TRβ.
Materials and Methods
Ethical approval
This study was approved by the ethics committee of the Health Sciences Center, Federal University of Rio de Janeiro (#IBCCF1002). Animal care and experimental protocols performed are in accordance with those stated by Drummond (2009).
Animals
Mice of different genotypes, wild type (TRβWT/WT), heterozygous (TRβWT/Δ337T), and homozygous (TRβΔ337T/Δ337T) for the TRβΔ337T mutation, were used. Mice were generated as described previously (Hashimoto et al. 2001). All mice were propagated in a mixed 129/C57/BL6 background strain and direct comparisons were made with littermate controls. Animals were generated by heterozygous mating pairs and a total of 79 males were used in this study. The genotyping of tail DNA was performed by PCR using the following primers: 5′ match ATGGGGAAATGGCAGTGAGAG, 5′ mismatch ATGGGGAAATGGCAGTGACAC and 3′ out AGCACACTCACCTGAAGACAT.
Animals were accommodated at controlled room temperature (24±1 °C) and submitted to 12 h light:12 h darkness cycles, lights on at 0700 h.
For all experiments, mice were placed in cages containing four animals and fed standard chow (Bio-Tec, Rio de Janeiro, Brazil) and water made available ad libitum. Body weight (BW) and body length of animals were measured weekly from post-natal week 5 until 24. At the age of 23 weeks, mice were placed in individual cages and allowed to adapt for 5 days; after this period, daily food intake was measured for 8 days on two consecutive weeks and the same amount of chow was offered every 24 h, food waste was weighted. Killing was performed on 26-week-old mice by asphyxiation in CO2 chamber after 5 h of food restriction, unless otherwise stated. After killing, trunk blood was collected and glycemia was measured by a glucometer (Optium, MediSense, Maidenhead, Berkshire, UK), and serum was obtained after centrifugation and frozen at −20 °C for measurement of serum hormones.
Abdominal (inguinal, perigonadal, and retroperitoneal) white adipose tissue (WAT) and brown adipose tissue (BAT) were excised and weighed. Interscapular BAT was identified by its anatomical location and macroscopic characteristics, and care was taken in order to dissect it from surrounding WAT. Whole pituitary and liver samples were collected and frozen at −70 °C for RNA extraction.
Body composition analysis
Body composition (fat and protein masses) analysis was determined by carcass method, previously described (Souza et al. 2009). Briefly, frozen eviscerated and weighed carcasses were autoclaved and homogenized in distilled water (1:1 w/v). Proteins were extracted from 1 g homogenates using potassium hydroxide and total protein was quantified using the Bradford method (Bradford 1976). Homogenate (3 g) was used to determine fat mass gravimetrically. Samples were hydrolyzed with potassium hydroxide and ethanol, and, after the addition of sulfuric acid, total lipids were extracted by three successive washes with petroleum ether. The samples were dried at room temperature until constant weight was obtained. Both data were expressed as grams of protein or fat per 100 g carcass.
Serum thyroxine, tri-iodothyronine, leptin, and insulin measurements
Specific RIA kits were used to measure serum leptin, insulin (Linco Research, Billerica, MA, USA), total tri-iodothyronine (T3), and total thyroxine (T4; MP Biomedicals, New York, NY, USA) levels. The detection limit and intra-assay variation were 0.5 ng/ml and 3.2% for leptin, 0.1 ng/ml and 5.5% for insulin, 25 ng/dl and 4.6% for total T3, and 1 μg/dl and 1.4% for total T4, respectively. All samples were measured within the same assay.
Homeostasis model assessment-insulin resistance (HOMA-IR) was calculated from simultaneous measurements of serum glucose and insulin in mice under 5 h food restriction.
Glucose tolerance test
Mice were fasted for 12 h (from 1900 to 0700 h) before the test. Animals received an i.p. injection of 2 mg/g BW d-(+)-glucose (Merck) in PBS. One group of animals was used to measure the glycemia before the injection and 20, 40, 60, and 120 min after glucose administration, with blood samples obtained from venesection and glucose measured by a glucometer (Optium, MediSense). Another set of animals was killed before glucose injection at 15 and 30 min after glucose administration. Blood samples were collected from trunk and serum insulin measured by RIA.
Insulin sensitivity test
Mice were fasted for 12 h (from 1900 to 0700 h) before the test. Animals received an i.p. injection of 0.75 mIU/g BW of human recombinant insulin (Eli Lilly) in PBS. Glycemia was measured before the injection and 15, 30, 60, 90, and 120 min after insulin administration. Blood samples were obtained by tail vein section and glycemia was measured by a glucometer (Optium, MediSense). The animals used for this test were not used for further analysis presented in this paper. The last two protocols were adapted from Zhou et al. (2004).
Pyruvate challenge test
After 12 h overnight fast, TRβWT/WT and TRβΔ337T/Δ337T mice were injected intraperitoneally with 2 mg/g BW pyruvate (Sigma–Aldrich) dissolved in saline and blood glucose was measured before injection and 15, 30, 60, and 90 min after pyruvate administration. Blood samples were obtained from the tail vein and glycemia was measured by a glucometer (Optium, MediSense).
Liver glycogen content
Liver glycogen content was measured using a previously established protocol (Trevenzoli et al. 2010). Briefly, 250 mg liver samples were homogenized and glycogen was extracted. Glycogen was then hydrolyzed and the resultant glucose was measured using an enzymatic colorimetric method (Glucox commercial kit, Doles, Goiás, Brazil) and compared to a glucose standard curve.
RNA analysis
Total RNA was extracted from samples by standard methodology (TRIzol Reagent; Life technologies, Invitrogen) for analysis of expression of Gh, phosphoenolpyruvate carboxykinase (Pck1), and PGC1α (Ppargc1a). Total RNA was reverse transcribed using 1 μg RNA and the Superscript III kit (Invitrogen). Real-time PCR was performed on Applied Biosystems 7500 Real-Time PCR System (Life Technologies Corp., Carlsbad, CA, USA) using SYBR Green PCR Master Mix (Applied BioSystems, Rockville, MD, USA). Primers were synthesized by Integrated DNA Technologies and were designed as follows: Gh forward 5′-CAGAGAACGGACATGGAA-3′, Gh reverse 5′-ACTGGATGAGCAGCAGCG-3′, Pck1 forward 5′-ATCTTTGGTGGCCGTAGACCT-3′, Pck1 reverse 5′-GCCAGTGGGCCAGGTATTT-3′, Ppargc1a forward 5′-AGCACTCAGAACCATGCAGCAAAC-3′, Ppargc1a reverse 5′-TTTGGTGTGAGGAGGGTCATCGTT-3′, 36B4 primer was used as control as described previously (Machado et al. 2009). Samples were analyzed in duplicate and the cycle parameters were as follows: 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, 60 °C for 30 s, and 70 °C for 45 s. Product purity was confirmed by agarose gel analysis. Changes in mRNA expression were calculated from the cycle threshold, after correcting for 36B4 according to the 
Statistical analysis
Data are reported as mean±s.e.m. One-way ANOVA was employed when comparisons were made for different genotypes, Two-way ANOVA was employed when comparisons were made for different genotypes along a time course, and analyses were followed by Student–Newman–Keuls multiple comparisons test for assessment of significance (GraphPad Prism; GraphPad Software Inc., La Jolla, CA, USA). Differences were considered to be significant at P<0.05.
Results
As expected, TRβΔ337T/Δ337T presented higher levels of serum T3 compared with the other groups (TRβWT/WT: 103±5, TRβWT/Δ337T: 120±13, and TRβΔ337T/Δ337T: 466±140 ng/dl). BW and length of male mice of different genotypes are shown in Fig. 1. TRβΔ337T/Δ337T male mice displayed lower BW (Fig. 1A) and length (Fig. 1B) compared with TRβWT/WT (P<0.05). The differences in BW and length emerged by 14 and 16 weeks of age and persisted thereafter until killing at 26 weeks of age. Heterozygous male mice did not exhibit alterations in length or BW. In female mice, the TRβΔ337T mutation did not affect the BW or length (data not shown). For all the other parameters studied, female mice exhibited the same profile as males, and we here show the results obtained on males, since their alterations were more pronounced.
Body weight (A) and length (B) of TRβWT/WT (squares), TRβWT/Δ337T (circles), and TRβΔ337T/Δ337T (triangles) male mice from 5 to 24 weeks old. Values are expressed as mean±s.e.m., n=4–11. *TRβWT/WT versus TRβΔ337T/Δ337T, P<0.05, # TRβWT/WT versus TRβΔ337T/Δ337T, P<0.01.
Citation: Journal of Endocrinology 211, 1; 10.1530/JOE-11-0194
The reduced BW of TRβΔ337T/Δ337T mice cannot be completely justified by alterations in food intake, since even though in absolute values there was a slight reduction in food ingestion (data not shown), when corrected for BW, TRβΔ337T/Δ337T mice presented increased chow ingestion compared to 26 weeks of age (Fig. 2A, P<0.05). In addition, the reduced apparent growth of TRβΔ337T/Δ337T male mice could not be associated with alterations in pituitary GH mRNA, the expression of which was similar regardless of genotype (Fig. 2B).
Daily chow intake corrected for body weight (A) and pituitary Gh mRNA (B) in 26-week-old TRβWT/WT, TRβWT/Δ337T, and TRβΔ337T/Δ337T male mice. Values are expressed as mean±s.e.m., n=5–8.
Citation: Journal of Endocrinology 211, 1; 10.1530/JOE-11-0194
TRβΔ337T/Δ337T mice exhibited decreased adiposity as shown by the reduction in abdominal WAT mass (36% less than WT – Fig. 3A) and further confirmed by the lower body fat content, determined by the carcass method (Fig. 3B, P<0.01). However, there was no significant difference in body protein content among the genotypes (Fig. 3C). Contrary to WAT mass, BAT was enlarged in homozygous-mutant mice (P<0.001, Fig. 3D). Although serum levels of leptin were similar among genotypes, when corrected for body lipid content, a relative increase was evident (Fig. 3E and F, P<0.05).
Abdominal white adipose tissue mass (A), lipidic (B), and proteic (C) body composition, brown adipose tissue (D), serum leptin (E), and serum leptin corrected for body fat mass (F) in 26-week-old TRβWT/WT, TRβWT/Δ337T, and TRβΔ337T/Δ337T male mice. Values are expressed as mean±s.e.m., n=5–8.
Citation: Journal of Endocrinology 211, 1; 10.1530/JOE-11-0194
We next analyzed the metabolic profile of mutant mice concerning glucose homeostasis. After 5 h of fasting, blood glucose levels were similar among different genotypes (Fig. 4A). To maintain normal glycemia, TRβΔ337T/Δ337T and TRβWT/Δ337T mice needed lower insulin secretion as deduced by serum levels of insulin (Fig. 4B, P<0.05). The HOMA-IR, calculated as the product between serum insulin and blood glucose, was 60% lower in mice carrying the mutation, suggesting that their insulin sensitivity was increased (Fig. 4C, P<0.05). This fact opposes what was seen in one study of patients with RTH where HOMA-IR was 50% elevated in patients carrying different mutations in heterozygosis (Mitchell et al. 2010).
Glycemia (A), serum insulin (B), and HOMA-IR (C) of 5 h food-restricted TRβWT/WT, TRβWT/Δ337T, and TRβΔ337T/Δ337T male mice. Values are expressed as mean±s.e.m., mice were 26-weeks-old, n=5–8.
Citation: Journal of Endocrinology 211, 1; 10.1530/JOE-11-0194
We proceeded with the investigation on insulin sensitivity performing the glucose tolerance test and insulin sensitivity test on 12 h fasted mice (Fig. 5A–C). TRβΔ337T/Δ337T displayed lower glycemia 20, 40, and 60 min after an i.p. glucose load compared with TRβWT/WT (P<0.05). Insulin concentrations measured 15 and 30 min after glucose load revealed that although at 15 min there is no significant differences among groups, homozygous animals failed to increase insulin levels at 30 min (Fig. 5B), indicating that insulin concentrations reduced more rapidly as blood glucose reduced (Fig. 5A and B).
Glucose tolerance test with serum insulin (A and B) and insulin sensitivity test (C) in TRβWT/WT(squares), TRβWT/Δ337T (circles), and TRβΔ337T/Δ337T (triangles) male mice after overnight fast. Values are expressed as mean±s.e.m., mice were 26-weeks-old, n=5–7. AUC, area under the curve. * TRβWT/WT and TRβWT/Δ337T versus TRβΔ337T/Δ337T, P<0.05, # TRβWT/WT and TRβWT/Δ337T versus TRβΔ337T/Δ337T, P<0.01. At time points 60, 90 and 120 min, mice presenting severe hypoglycemia were excluded from study.
Citation: Journal of Endocrinology 211, 1; 10.1530/JOE-11-0194
TRβΔ337T/Δ337T mice were more sensitive to the hypoglycemic effects of insulin and some of them exhibited a severe hypoglycemia (below 20 mg/dl) 60 and 90 min after the i.p. insulin injection and had to be rescued with glucose infusion (Fig. 5C). In case glycemia was below the detection limit (20 mg/dl), mice received an i.p. injection of glucose 2 mg/g BW d-(+)-glucose (Merck) in PBS. Heterozygous mice behaved similarly to WT on glucose tolerance test and insulin sensitivity test, leading us to exclude this group from the following evaluations.
In order to have some insight into hepatic glucose production, we evaluated liver glycogen content and the glucose generation after the administration of pyruvate, a precursor for gluconeogenesis. Hepatic glycogen content of TRβΔ337T/Δ337T mice was 70% reduced compared with controls (Fig. 6A, P<0.05). TRβWT/WT mice displayed an expected increase in blood glucose concentration after pyruvate injection; on the other hand, TRβΔ337T/Δ337T mice could not reach the same glucose production rate as TRβWT/WT mice and exhibited lower blood glucose concentration 30 min after pyruvate injection (Fig. 6B).
Hepatic glycogen (A), pyruvate challenge test (B), liver mRNA expression of Pepck (C), and Pgc1α (D) in TRβWT/WT (squares) and TRβΔ337T/Δ337T (triangles) male mice. Hepatic glycogen was measured after 5 h of fasting. Pyruvate challenge was performed after overnight fasting. Values are expressed as mean±s.e.m., mice were 26-weeks-old, n=5–7. * TRβWT/WT versus TRβΔ337T/Δ337T, P<0.01. PEPCK, phosphoenolpyruvate carboxykinase and PGC1, peroxisome proliferator-activated receptor-γ coactivator 1.
Citation: Journal of Endocrinology 211, 1; 10.1530/JOE-11-0194
Since these results suggested that the gluconeogenic pathway could be impaired in mutant mice, we investigated the hepatic mRNA expression of PEPCK, a key gluconeogenic enzyme, which revealed a reduction in the enzyme mRNA levels in the liver of TRβΔ337T/Δ337T mice (Fig. 6C, P<0.01) and it was accompanied by a reduction in Pgc1α liver mRNA (Fig. 6D, P<0.01), which is an essential transcriptional factor involved in the regulation of gluconeogenic enzymes (Yoon et al. 2001).
Discussion
In this study, we have demonstrated that mice carrying the Δ337T mutation in both alleles of the TRβ presented growth impairment, decreased adiposity, and higher insulin sensitivity.
Mutations on the binding domain of TRβ are found in the syndrome of TH resistance leading to high levels of serum TH and to signs and symptoms that are typical of either hyperthyroidism or hypothyroidism. Although mechanisms leading to resistance are not completely clarified and may be mutation specific, it is generally accepted that the resulting phenotype depends on the level of expression of a specific TR isoform in different tissues, and, for tissues where TRα is predominant, signs of hyperthyroidism can be found, the opposite being true for tissues where TRβ is more abundant. Here, we used mice carrying a human natural mutation Δ337T that does not bind T3 but still binds to DNA and to CoR (Hashimoto et al. 2001). Although the Δ337T TRβ has been described to have a potent dominant negative effect over the WT TR, except for 5 h fasting serum insulin, no other significant alterations were observed in heterozygous mice herein studied. Thus, the phenotype of the homozygous mice resulted either from total disruption of TRβ signaling or from the very high levels of TH acting through TRα. Still, another possible mechanism is that a higher dose of the mutant TRβ interferes with the TRα function or with the ability of other transcription factors to regulate gene expression.
TRβΔ337T/Δ337T mice presented a reduced body length and weight despite increased food intake. Both hypo- and hyperthyroidism can lead to growth retardation through different mechanisms (O'Shea et al. 2003, Bassett et al. 2007). TH have potent stimulatory effects over GH and IGF1 production (Miell et al. 1993); however, in this study, despite high serum levels of TH, pituitary GH mRNA was not changed in TRβΔ337T/Δ337T mice. This argues against an impairment of the GH/IGF1 production as a cause of growth retardation in homozygous mice. Thus, it is possible that TRβΔ337T/Δ337T are shorter as a consequence of hyperthyroidism in bone, as seems to be the case for the PV mice, which bear a deletion in TRβ that prevents T3 binding and is a strong dominant negative mutant (O'Shea et al. 2003). For unknown reasons, and contrary to the PV mice that showed growth delay in both genders, TRβΔ337T/Δ337T female mice did not present deficits in growth.
TRβΔ337T/Δ337T mice were also leaner, exhibiting decreased body fat mass in the presence of increased food intake. Previous data demonstrated that TRβPV mice did not present alterations in fat mass (Araki et al. 2009). The lower adiposity found in TRβΔ337T/Δ337T mice may be caused by increased energy expenditure, an expected effect of the high TH levels (Kim 2008), possibly via the TRα. Future studies aiming to evaluate energy expenditure should elucidate this point. In addition, reduced fat mass may result from increased lipolysis, since the elevated TH levels can act through TRα to increase the lipolytic effect of catecholamines (Ribeiro et al. 2001). Previous studies have demonstrated that leptin serum concentrations correlate positively with WAT mass (Licinio et al. 2007), and that TH has the ability to inhibit leptin production (Escobar-Morreale et al. 1997, Cabanelas et al. 2010). However, despite the high serum TH, the mutant mice exhibited increased levels of leptin. This raises the possibility that the inhibitory action of TH on leptin secretion is mediated, in most part, by TRβ. An alternative explanation for the increased serum leptin is related to the high serum TSH in TRβΔ337T/Δ337T mice, since TSH has previously been reported to increase leptin secretion from WAT cell cultures (Menendez et al. 2003). In addition, adult TRβΔ337T/Δ337T mice exhibited higher food ingestion even though serum leptin was increased, suggesting a partial resistance to the anorexigenic effect of leptin.
BAT was enlarged in TRβΔ337T/Δ337T mice, which may be due to stimulatory action of high TH levels through TRα, which enhances the adrenergic sensitivity, and is the major TR expressed in BAT (Hernandez & Obregon 1996). In view of the important diet-induced thermogenic effect of BAT (Feldmann et al. 2009), this tissue hypertrophy may contribute to the leaner phenotype of TRβΔ337T/Δ337T mice, even though the TRβ mutant may have impaired expression of uncoupling protein 1, which induction by T3 has shown to be dependent mainly on TRβ (Ribeiro et al. 2001).
Normal glycemia seems to be maintained in heterozygous and homozygous mice in the presence of lower basal insulinemia after a short period of fasting (5 h), and with normal insulinemia after an overnight fast (12 h). However, TRβΔ337T/Δ337T mice presented an abrupt decrease in glycemia levels in response to insulin and recovered euglycemic levels faster after glucose load. This increased glucose tolerance was accompanied by lower serum insulin secretion at least in the first 30 min after glucose load (note area under the curve, Fig. 5B). These data indicated that insulin was more efficient in increasing glucose utilization in homozygous mice. TH is known to increase insulin-induced muscle glucose uptake and the expression of glucose transporter 4 in WAT and muscle (Weinstein et al. 1994, Torrance et al. 1997, Dimitriadis et al. 2006). Therefore, hyperthyroidism in TRβΔ337T/Δ337T mice could explain the increased glucose tolerance and insulin sensitivity that, in this case, would be mediated by the TRα. However, experimental hyperthyroidism has also been associated with insulin resistance and with impaired β-cell responsiveness to the stimulatory action of glucose on insulin secretion (Fukuchi et al. 2002, Holness et al. 2008). Therefore, it is possible that the phenotype of the mutant mice results from multiple alterations of the homeostasis of glucose utilization and production caused not only by hyperthyroidism but also by resistance to TH action, as seems to be the case in liver glucose metabolism.
Indeed, TRβΔ337T/Δ337T mice were unable to recover from the insulin-induced hypoglycemia, which was fatal for some mice. Liver glycogen is the first glucose resource to be utilized in an attempt to return to normoglycemia, and in TRβΔ337T/Δ337T mice, liver glycogen was reduced by 70%. Hepatic gluconeogenesis, which is necessary for recovery from hypoglycemia, was also impaired in TRβΔ337T/Δ337T mice, as demonstrated by the reduced conversion of pyruvate to glucose. The mechanism involves the lower liver expression of PEPCK, the rate-limiting enzyme for gluconeogenesis, and PGC1α, an essential transcriptional factor for hepatic gluconeogenesis (Yoon et al. 2001). Despite the known stimulatory effect of TH over these genes' expression (Weitzel et al. 2003, Klieverik et al. 2008), they were not able to respond in the presence of the mutant TRβ. These findings highlight the role of TRβ in mediating TH effects on hepatic glucose production. The central control of hepatic glucose production is also subject to regulation by TH as was demonstrated in hyperthyroid rats that showed an increase in glucose production and resistance to insulin (Klieverik et al. 2008). When infused centrally, TH produced and increased in plasma glucose, an effect mediated by sympathetic nerve activity in the liver (Klieverik et al. 2009).
The great majority of patients with the syndrome of TH resistance are heterozygous for the TRβ mutation. The rare cases of homozygous presentation were very severe (Ono et al. 1991), and cardiovascular disorders have been associated with lethality. However, in view of our data, and in spite of species differences, severe hypoglycemia due to impaired hepatic glucose production may be investigated as another contributing factor.
In conclusion, the Δ337T TRβ mutation, associated with the syndrome of resistance to TH, resulted in reduced BW and length in male mice and metabolic alterations in both genders. Reduced fat accumulation was accompanied by an increase in food intake despite relatively higher leptin. More importantly, TRβΔ337T/Δ337T mice were more tolerant to glucose but more sensitive to the hypoglycemic effect of insulin due in part to an important deficit in hepatic glucose production.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) and Thyroid Department of SBEM.
Author contribution statement
The conception and design of this study was conducted by L A S, T M O-C, and C C P-M. F E W was responsible for the generation of the mutant mouse model. Experiments were performed by L A S, D A S, L C F, A C, and P C L. All authors contributed to the analysis and interpretation of data as well as writing, revising, and final approval of the version to be published. The study was conducted at the Instituto de Biofisica Carlos Chagas Filho, Federal University of Rio de Janeiro, Brazil.
References
Araki O, Ying H, Zhu XG, Willingham MC & Cheng CY 2009 Distinct regulation of lipid metabolism by unliganded thyroid hormone receptor isoforms. Molecular Endocrinology 23 308–315. doi:10.1210/me.2008-0311.
Bassett JHD, O'Shea PJ, Sriskantharajah S, Rabier B, Boyde A, Howell PGT, Weiss RE, Roux JP, Malaval L & Clement-Lacroix P et al. 2007 Thyroid hormone excess rather than thyrotropin deficiency induces osteoporosis in hyperthyroidism. Molecular Endocrinology 21 1095–1107. doi:10.1210/me.2007-0033.
Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72 248–254. doi:10.1016/0003-2697(76)90527-3.
Cabanelas A, Cordeiro A, Santos Almeida NA, Monteiro de Paula GS, Coelho VM, Ortiga-Carvalho TM & Pazos-Moura CC 2010 Effect of triiodothyronine on adiponectin expression and leptin release by white adipose tissue of normal rats. Hormone and Metabolic Research 42 254–260. doi:10.1055/s-0029-1246118.
Dimitriadis GD & Raptis SA 2001 Thyroid hormone excess and glucose intolerance. Experimental and Clinical Endocrinology & Diabetes 109 S225–S239. doi:10.1055/s-2001-18584.
Dimitriadis G, Mitrou P, Lambadiari V, Boutati E, Maratou E, Panagiotakos DB, Koukkou E, Tzanela M, Thalassinos N & Raptis SA 2006 Insulin action in adipose tissue and muscle in hypothyroidism. Journal of Clinical Endocrinology and Metabolism 91 4930–4937. doi:10.1210/jc.2006-0478.
Drummond GB 2009 Reporting ethical matters in The Journal of Physiology: standards and advice. Journal of Physiology 587 713–719. doi:10.1113/jphysiol.2008.167387.
Escobar-Morreale HF, Escobar del Rey F & Morreale de Escobar G 1997 Thyroid hormones influence serum leptin concentrations in the rat. Endocrinology 138 4485–4488. doi:10.1210/en.138.10.4485.
Feldmann HM, Golozoubova V, Cannon B & Nedergaard J 2009 UCP1 ablation induces obesity and abolishes diet-induced thermogenesis in mice exempt from thermal stress by living at thermoneutrality. Cell Metabolism 9 203–209. doi:10.1016/j.cmet.2008.12.014.
Forman BM, Casanova J, Raaka BM, Ghysdael J & Samuels HH 1992 Half-site spacing and orientation determines whether thyroid hormone and retinoic acid receptors and related factors bind to DNA response elements as monomers, homodimers, or heterodimers. Molecular Endocrinology 6 429–442. doi:10.1210/me.6.3.429.
Fukuchi M, Shimabukuro M, Shimajiri Y, Oshiro Y, Higa M, Akamine H, Komiya I & Takasu N 2002 Evidence for a deficient pancreatic beta-cell response in a rat model of hyperthyroidism. Life Sciences 71 1059–1070. doi:10.1016/S0024-3205(02)01791-5.
Hashimoto K, Curty FH, Borges PP, Lee CE, Abel ED, Elmquist JK, Cohen RN & Wondisford FE 2001 An unliganded thyroid hormone receptor causes severe neurological dysfunction. PNAS 98 3998–4003. doi:10.1073/pnas.051454698.
Hashimoto K, Cohen RN, Yamada M, Markar KR, Monden T, Satoh T, Mori M & Wondisford FE 2006 Cross-talk between thyroid hormone receptor and liver X receptor regulatory pathways is revealed in a thyroid hormone resistance mouse model. Journal of Biological Chemistry 281 295–302. doi:10.1074/jbc.M507877200.
Hernandez A & Obregon MJ 1996 Presence and mRNA expression of T3 receptors in differentiating rat brown adipocytes. Molecular and Cellular Endocrinology 121 37–46. doi:10.1016/0303-7207(96)03849-X.
Holness MJ, Greenwood GK, Smith ND & Sugden MC 2008 PPAR alpha activation and increased dietary lipid oppose thyroid hormone signaling and rescue impaired glucose-stimulated insulin secretion in hyperthyroidism. American Journal of Physiology, Endocrinology and Metabolism 295 E1380–E1389. doi:10.1152/ajpendo.90700.2008.
Hong H, Kohli K, Garabedian MJ & Stallcup MR 1997 GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Molecular and Cellular Biology 17 2735–2744..
Ishizuka T & Lazar MA 2003 The N-CoR/histone deacetylase 3 complex is required for repression by thyroid hormone receptor. Molecular and Cellular Biology 23 5122–5131. doi:10.1128/MCB.23.15.5122-5131.2003.
Kim B 2008 Thyroid hormone as a determinant of energy expenditure and the basal metabolic rate. Thyroid 12 141–144. doi:10.1089/thy.2007.0266.
Klieverik LP, Sauerwein HP, Ackermans MT, Boelen A, Kalsbeek A & Fliers E 2008 Effects of thyrotoxicosis and selective hepatic autonomic denervation on hepatic glucose metabolism in rats. American Journal of Physiology, Endocrinology and Metabolism 294 E513–E520. doi:10.1152/ajpendo.00659.2007.
Klieverik LP, Janssen SF, van Riel A, Foppen E, Bisschop PH, Serlie MJ, Boelen A, Ackermans MT, Sauerwein HP & Fliers E et al. 2009 Thyroid hormone modulates glucose production via a sympathetic pathway from the hypothalamic paraventricular nucleus to the liver. PNAS 106 5966–5971. doi:10.1073/pnas.0805355106.
Licinio J, Milane M, Thakur S, Whelan F, Yildiz BO, Delibasi T, de Miranda PB, Ozata M, Bolu E & Depaoli A et al. 2007 Effects of leptin on intake of specific micro- and macronutrients in a woman with leptin gene deficiency studied off and on leptin at stable body weight. Appetite 49 594–599. doi:10.1016/j.appet.2007.03.228.
Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25 402–408. doi:10.1006/meth.2001.1262.
Machado DS, Sabet A, Santiago LA, Sidhaye AR, Chiamolera MI, Ortiga-Carvalho TM & Wondisford FE 2009 A thyroid hormone receptor mutation that dissociates thyroid hormone regulation of gene expression in vivo. PNAS 23 9441–9446. doi:10.1073/pnas.0903227106.
Menendez C, Baldelli R, Camiña JP, Escudero B, Peino R, Dieguez C & Casanueva FF 2003 TSH stimulates leptin secretion by a direct effect on adipocytes. Journal of Endocrinology 176 7–12. doi:10.1677/joe.0.1760007.
Miell JP, Taylor AM, Zini M, Maheshwari HG, Ross RJ & Valcavi R 1993 Effects of hypothyroidism and hyperthyroidism on insulin-like growth factors (IGFs) and growth hormone- and IGF-binding proteins. Journal of Clinical Endocrinology and Metabolism 76 950–955. doi:10.1210/jc.76.4.950.
Mitchell CS, Savage DB, Dufour S, Schoenmakers N, Murgatroyd P, Befroy D, Halsall D, Northcott S, Raymond-Barker P & Curran S et al. 2010 Resistance to thyroid hormone is associated with raised energy expenditure, muscle mitochondrial uncoupling, and hyperphagia. Journal of Clinical Investigation 120 1345–1354. doi:10.1172/JCI38793.
Ono S, Schwartz ID, Mueller OT, Root AW, Usala SJ & Bercu BB 1991 Homozygosity for a dominant negative thyroid hormone receptor gene responsible for generalized resistance to thyroid hormone. Journal of Clinical Endocrinology and Metabolism 73 990–994. doi:10.1210/jcem-73-5-990.
Ortiga-Carvalho TM, Shibusawa N, Nikrodhanond A, Oliveira KJ, Machado DS, Liao XH, Cohen RN, Refetoff S & Wondisford FE 2005 Negative regulation by thyroid hormone receptor requires an intact coactivator-binding surface. Journal of Clinical Investigation 115 2517–2523. doi:10.1172/JCI24109.
O'Shea PJ, Harvey CB, Suzuki H, Kaneshige M, Kaneshige K, Cheng SY & Williams GR 2003 A thyrotoxic skeletal phenotype of advanced bone formation in mice with resistance to thyroid hormone. Molecular Endocrinology 17 1410–1424. doi:10.1210/me.2002-0296.
O'Shea PJ, Bassett JH, Cheng SY & Williams GR 2006 Characterization of skeletal phenotypes of TRα1PV and TRβPV mutant mice: implications for tissue thyroid status and T3 target gene expression. Nuclear Receptor Signaling 4 e011 doi:10.1621/nrs.04011.
Pazos-Moura C, Abel ED, Boers ME, Moura E, Hampton TG, Wang J, Morgan JP & Wondisford FE 2000 Cardiac dysfunction caused by myocardium-specific expression of a mutant thyroid hormone receptor. Circulation Research 86 700–706..
Pessôa CN, Santiago LA, Santiago DA, Machado DS, Rocha FA, Ventura DF, Hokoç JN, Pazos-Moura CC, Wondisford FE & Gardino PF et al. 2008 Thyroid hormone action is required for normal cone opsin expression during mouse retinal development. Investigative Ophthalmology & Visual Science 49 2039–2045. doi:10.1167/iovs.07-0908.
Ribeiro MO, Carvalho SD, Schultz JJ, Chiellini G, Scanlan TS, Bianco AC & Brent GA 2001 Thyroid hormone – sympathetic interaction and adaptive thermogenesis are thyroid hormone receptor isoform – specific. Journal of Clinical Investigation 108 97–105. doi:10.1172/JCI200112584.
Safer JD, Cohen RN, Hollenberg AN & Wondisford FE 1998 Defective release of corepressor by hinge mutants of the thyroid hormone receptor found in patients with resistance to thyroid hormone. Journal of Biological Chemistry 273 30175–30182. doi:10.1074/jbc.273.46.30175.
Shibusawa N, Hollenberg AN & Wondisford FE 2003 Thyroid hormone receptor DNA binding is required for both positive and negative gene regulation. Journal of Biological Chemistry 278 732–738. doi:10.1074/jbc.M207264200.
Souza LL, Nunes MO, Paula GSM, Cordeiro A, Penha-Pinto V, Neto JFN, Oliveira KJ, Tavares do Carmo MG & Pazos-Moura CC 2009 Effects of dietary fish oil on thyroid hormone signaling in the liver. Journal of Nutritional Biochemistry 21 935–940. doi:10.1016/j.jnutbio.2009.07.008.
Thompson CC, Weinberger C, Lebo R & Evans RM 1987 Identification of a novel thyroid hormone receptor expressed in the mammalian central nervous system. Science 237 1610–1614. doi:10.1126/science.3629259.
Torrance CJ, Devente JE, Jones JP & Dohm GL 1997 Effects of thyroid hormone on GLUT4 glucose transporter gene expression and NIDDM in rats. Endocrinology 138 1204–1214. doi:10.1210/en.138.3.1204.
Trevenzoli IH, Rodrigues AL, Oliveira E, Thole AA, Carvalho L, Figueiredo MS, Toste FP, Neto JF, Passos MC & Lisboa PC et al. 2010 Leptin treatment during lactation programs leptin synthesis, intermediate metabolism, and liver microsteatosis in adult rats. Hormone and Metabolic Research 42 483–490. doi:10.1055/s-0030-1249103.
Weinstein SP, O'Boyle E & Haber RS 1994 Thyroid hormone increases basal and insulin-stimulated glucose transport in skeletal muscle. The role of GLUT4 glucose transporter expression. Diabetes 43 1185–1189. doi:10.2337/diabetes.43.10.1185.
Weitzel JM, Hamann S, Jauk M, Lacey M, Filbry A, Radtke C, Iwen KA, Kutz S, Harneit A & Lizardi PM et al. 2003 Hepatic gene expression patterns in thyroid hormone-treated hypothyroid rats. Journal of Molecular Endocrinology 31 291–303. doi:10.1677/jme.0.0310291.
Wood WM, Ocran KW, Gordon DF & Ridgway EC 1991 Isolation and characterization of mouse complementary DNAs encoding alpha and beta thyroid hormone receptors from thyrotrope cells: the mouse pituitary-specific beta 2 isoform differs at the amino terminus from the corresponding species from rat pituitary tumor cells. Molecular Endocrinology 5 1049–1061. doi:10.1210/mend-5-8-1049.
Wu Y, Delerive P, Chin WW & Burris TP 2002 Requirement of helix 1 and the AF-2 domain of the thyroid hormone receptor for coactivation by PGC-1. Journal of Biological Chemistry 277 8898–8905. doi:10.1074/jbc.M110761200.
Yen PM 2001 Physiological and molecular basis of thyroid hormone action. Physiological Reviews 81 1097–1142..
Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn CR & Granner DK et al. 2001 Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413 131–138. doi:10.1038/35093050.
Zhou XY, Shibusawa N, Naik K, Porras D, Temple K, Ou H, Kaihara K, Roe MW, Brady MJ & Wondisford FE 2004 Insulin regulation of hepatic gluconeogenesis through phosphorylation of CREB-binding protein. Nature Medicine 10 633–637. doi:10.1038/nm1050.
