Pluripotency-associated stem cell marker expression in proliferative cell cultures derived from adult human pancreas

in Journal of Endocrinology
View More View Less
  • Diabetes Research Group, Medical School, Institute of Cellular Medicine, North East Stem Cell Institute, Newcastle University, 4th Floor William Leech Building, Framlington Place, Newcastle upon Tyne NE2 4HH, UK

The source of new β-cells in adult human pancreas remains incompletely elucidated with recent studies on rodents providing evidence for neogenesis from progenitor cells in addition to self-replication. The aim of this study was to investigate the expression of pluripotency-associated stem cell markers in proliferative cultures derived from adult human pancreas. Human pancreatic tissue was obtained from deceased donors following ethical approval and relative consent. Islet-enriched fraction was separated from the retrieved organ by digestion and density gradient centrifugation. Dissociated cells were seeded in adherent culture forming proliferative ‘islet survivor cells’ (ISCs). These were characterised at fifth passage by RT-PCR, immunofluorescence staining, FACS, western blot and transfection studies with an OCT4 promoter-driven reporter. Nuclear expression of the pluripotency-associated stem cell marker complex OCT4/SOX2/NANOG was confirmed in ISCs. The phenotype constituted ∼8% of the overall population. OCT4 biosynthesis was confirmed by western blot and activation of an exogenous OCT4 promoter. Co-expression of pluripotency-associated markers has been confirmed in proliferative primary cells derived from adult human pancreas. Further studies are required to elucidate whether these cells possess functional stem cell characteristics and assess potential for differentiation into pancreatic cell lineages including new β-cells.

Abstract

The source of new β-cells in adult human pancreas remains incompletely elucidated with recent studies on rodents providing evidence for neogenesis from progenitor cells in addition to self-replication. The aim of this study was to investigate the expression of pluripotency-associated stem cell markers in proliferative cultures derived from adult human pancreas. Human pancreatic tissue was obtained from deceased donors following ethical approval and relative consent. Islet-enriched fraction was separated from the retrieved organ by digestion and density gradient centrifugation. Dissociated cells were seeded in adherent culture forming proliferative ‘islet survivor cells’ (ISCs). These were characterised at fifth passage by RT-PCR, immunofluorescence staining, FACS, western blot and transfection studies with an OCT4 promoter-driven reporter. Nuclear expression of the pluripotency-associated stem cell marker complex OCT4/SOX2/NANOG was confirmed in ISCs. The phenotype constituted ∼8% of the overall population. OCT4 biosynthesis was confirmed by western blot and activation of an exogenous OCT4 promoter. Co-expression of pluripotency-associated markers has been confirmed in proliferative primary cells derived from adult human pancreas. Further studies are required to elucidate whether these cells possess functional stem cell characteristics and assess potential for differentiation into pancreatic cell lineages including new β-cells.

Introduction

There is considerable evidence to support self-replication of existing β-cells as the predominant source of new β-cells in young growing rodents (Dor et al. 2004) and humans (Meier et al. 2008). In established adults (Manesso et al. 2009) and in response to injury (Dor et al. 2004, Xu et al. 2008), however, the potential for non-β-cell sources including facultative endocrine progenitor cells has been proposed in convincing studies. Several groups have identified and isolated putative stem cells from adult pancreas (Seaberg et al. 2004, Suzuki et al. 2004, Eberhardt et al. 2006), but the expression of the pluripotency-associated embryonic stem (ES) cell markers has only been reported in exploratory studies on mice (Zuba-Surma et al. 2009) and unmanipulated human pancreas (Zhao et al. 2007, Al-Turaifi et al. 2008).

In humans, maintenance of the pluripotent circuitry within ES cells is coordinated by three transcription factors: OCT4, SOX2 and NANOG (Boyer et al. 2005). These proteins are essential for generation and maintenance of the ES cell identity by forming an auto-regulatory network that controls the expression and repression of pluripotency- and differentiation-associated genes respectively (Boyer et al. 2005). Although a key pluripotency mediator in ES cells, several studies have reported the expression of OCT4 in unmanipulated and cultured somatic tissues (Zhao et al. 2007, Kristensen et al. 2010, Pacini et al. 2010).

In common with many important human developmental genes, multiple isoforms of OCT4 are generated by alternative mRNA splicing. The two main isoforms, OCT4A and OCT4B, have been reported as having differential expression patterns with OCT4A localising to the nuclei and OCT4B detected within the cytoplasm (Atlasi et al. 2008). Whilst OCT4A has been confirmed as the isoform responsible for maintaining the ES cell identity, OCT4B fails to confer the self-renewal and pluripotency of ES cell and is thought to be involved in cell stress responses (Lee et al. 2006). In addition to OCT4 splice variant expression, the presence of transcribed pseudogenes that demonstrate significant homology to the OCT4A sequence has been reported (Liedtke et al. 2007). Collectively, potential pseudogene and splice variant expression generate the potential for false-positive results and subsequently the detection and role of OCT4 within the soma has come under scrutiny.

By using the necessary controls (ES cells (positive) and human skin fibroblasts (negative)), primers that only amplify the OCT4A transcript, and demonstration of nuclear protein expression with both western blotting and immunocytochemistry, we here provide robust evidence for OCT4A expression in proliferative cells derived from adult human pancreas. This is supported by transfection studies in which we identified a population of cells within the proliferative culture that were capable of activating the transgenic OCT4 promoter as demonstrated by GFP expression. Importantly, we have demonstrated that OCT4A-positive cells co-express SOX2 and NANOG, a phenotype that has not been previously reported in proliferative cultures derived from adult human pancreas.

Materials and Methods

Human islets, fibroblasts and ES cells

Pancreases were retrieved from deceased donors following formal ethical approval and written informed relative consent. Organs were handled exactly as for a whole pancreas transplant including cooling of the lesser sac and were transferred into University of Wisconsin medium to the King's College Hospital islet isolation facility.

Islets were separated from exocrine tissue by Liberase HI digestion in a Ricordi chamber and a continuous density gradient according to the published methods (Huang et al. 2004). Purified islets were established in adherent culture in CMRL-1066 medium (Gibco, Invitrogen) including 10% foetal bovine serum and 1% insulin–transferrin–selenium supplement (Gibco). The medium was changed every 48–72 h and cells passaged at 80% confluence.

The MIN6 mouse β-cell line was available within the group. Primary human skin fibroblasts were generously provided by Dr Matthew Wright and undifferentiated human ES cells (H9) from Dr Linda Lako (both Newcastle University UK).

RNA analysis

Total RNA was extracted using the RNeasy microkit 50 (Qiagen) and treated with RQ1 RNase-Free DNase (Promega) to remove contaminating genomic DNA. cDNA was synthesised using superscript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions. The PCR contained 1 μl cDNA (500 ng/μl), 1.25 μl RedTaq polymerase (Sigma–Aldrich), 2.5 μl PCR buffer, 1 μl forward primer (10 pmol/l), 1 μl reverse primer (10 pmol/l), 1 μl dNTPs (10 mM) (Promega) and 17.75 μl nanopure water. Parallel PCRs with RNA alone served as negative controls. PCR primer sequences and cycle number are given in Table 1. RT-PCR for OCT4 was validated in serial dilutions of the H9 human ES cell line, confirming semi-quantification at 35 cycles. Semi-quantitative PCR was also validated for GAPDH as a reference gene at 32 cycles.

Table 1

PCR primers. All genes shown are human genes

Sequence
ForwardReverseNo. of cycles
Gene
GAPDHAAGGGCTCATGACCACAGTCCATCAGGAAATGAGCTTCACAAAGTT30
InsulinCATGGCCCTGTGGATGCGCAGTTGCAGTAGTTCTCCAG35
GlucagonCCCAAGATTTTGTGCAGTGGTTGCGGCCAAGTTCTTCAACAAT35
SomatostatinGACCCCAGACTCCGTCAGTTTCGCCTCATTTCATCCTGCTAGC35
PPCAATGCCACACCAGAGCAGATCTGGGAGCAGGGAGCAAGC35
CK19AGGTGGATTCCGCTCCGGGCAATCTTCCTGTCCCTCGAGCA35
AmylaseGGTTCAGGTCTCTCCACCAATCCTGCACTCACAGCGTTAC35
OCT4GAAGCTGGAGAAGGAGAAGCTGCAAGGGCCGCAGCTTACACATGTTC35
SOX2CGCCCCCAGCAGACTTCACACTCCTCTTTTGCACCCCTCCCATTT35
NANOGCATCGGGCCCGCCACCATGAGTGTGGATCCAGCTTGGATCGAGCTCCATCTTCACACGTCTTCAGGTTG35

Immunofluorescence

Frozen sections cut from human pancreas blocks; accutase-dissociated single cells obtained from isolated islet fractions (IF) and cytospun onto slides; and cells grown on sterile coverslips were fixed with 4% paraformaldehyde for 20 min and permeabilised with 1% t-octylphenoxy-polyethoxyethanol (Triton, Sigma–Aldrich) for 45 min. To block non-specific binding, the slides were treated with blocking buffer (Roche Applied Science) for 1 h at room temperature.

Primary antibodies diluted in blocking buffer, at concentrations given in Table 2, were added and incubated for 1 h at room temperature or overnight in a humid chamber at 4 °C. In all studies, parallel no primary antibody negative controls were undertaken. Secondary antibodies (Table 3) were applied for 1 h at room temperature in the dark. Quantification of OCT4-expressing cells was done by capturing 12 random fields at 200× magnification and expressing proportion of OCT4-positive cells as a percentage of total (DAPI-positive) cells per field. Images were captured using either a Nikon Eclipse 400 inverted fluorescence, Nikon Eclipse TE2000-5 transmission fluorescence or Leica SP2 AOBS UV confocal microscope.

Table 2

Primary antibodies

Species raised inClonalitySpecificityDilutionSupplier
Antibody
Anti-Ki67MouseMonoclonalH/M/R1:100Novocastra Laboratories (Milton Keynes, UK)
Anti-Oct4RabbitPolyclonalH/M/R1:50Abcam Ab18976 (Cambridge, UK)
Anti-NanogGoatPolyclonalH1:100R&D AF1997 (Abingdon, UK)
Anti-Sox2RabbitPolyclonalH/M1:50Abcam Ab15830
Anti-CK19MouseMonoclonalH/M1:200DAKO M088801 (Cambridge, UK)

H, human; M, mouse; R, rat; Cy3, cyanine 3; TR, Texas Red.

Table 3

Secondary antibodies (all supplied by Jackson ImmunoResearch, Newmarket, UK). Specificity of all IgG. Dilution of all 1:300

Species raised inConjugationSupplier code number
Antibody against
GoatDonkeyTR705-095-003
RabbitDonkeyTR711-076-152
RabbitDonkeyFITC711-095-152
RatDonkeyFITC712-095-153
MouseDonkeyCy3715-165-151

H, human; M, mouse; R, rat; Cy3, cyanine 3; TR, Texas Red.

Fluorescence-activated cell sorting

Cells were fixed with 4% paraformaldehyde for 20 min, permeabilised by 1% saponin (Sigma–Aldrich) for 20 min and treated with blocking buffer for 30 min (all at room temperature). Primary antibody (Table 2), at a concentration of 1:50, diluted in blocking buffer was then added with incubation for 60 min. Following washing with 1% saponin in PBS, secondary antibody (Table 3) was added at a concentration of 1:50 in blocking buffer with incubation in the dark for 30 min. Following further washes, cells were resuspended in PBS for FACS analysis.

Western blotting

Nuclear or whole cell extracts were prepared by performing western blotting as described previously (Macfarlane et al. 2000). Protein concentration was determined by Bradford protein assay and 30 μg of each sample were fractionated by SDS–PAGE. Following electrotransfer to a nitrocellulose membrane and blocking with 10% dried skimmed milk, the membrane was incubated overnight with primary antibody (GAPDH or OCT4 (Table 2) prepared in 1:200 dilutions) at 4 °C and then with secondary antibody (HRP-conjugated anti-rabbit 1:2000 dilution, Sigma–Aldrich) for 1 h at room temperature. Immunoreactivity was detected using a chemiluminescence kit (ECL, Amersham).

Transgene expression studies

Transfections were performed using 10 μl Lipofectamine 2000 (Invitrogen) and 3 μg plasmid DNA (pIRES-eGFP (available within the group) and OCT4–eGFP (provided by Dr Wei Cui, Imperial College London)) following the manufacturer's instructions.

Results

Expression of OCT4 was initially demonstrated in unmanipulated human pancreas by semi-quantitative RT-PCR in comparison to human ES cells and primary human skin fibroblasts (Fig. 1A). Following isolation and purification, expression of the pluripotency-associated markers OCT4, SOX2 and NANOG (Fig. 2A) could be detected by RT-PCR in the IF in addition to the classical differentiated pancreatic phenotypic markers (insulin, glucagon, somatostatin, pancreatic polypeptide, CK19 (ductal) and amylase (exocrine)) (Fig. 2A and B).

Figure 1
Figure 1

OCT4 expression in unmanipulated adult human pancreas. (A) RT-PCR analysis of OCT4 expression in human pancreas (HP) compared to human embryonic stem cells (hESCs) and human skin fibroblasts (HSF). (B) Immunofluorescence staining of OCT4 (red) in human pancreas sections. Size bar=100 μm. (C and D) Confocal images of small OCT4 (red)-positive cells (∼2–3 μm). Size bars=3.07 μm (C) and 2.23 μm (D). Nuclei are stained with DAPI blue. Data are representative of results from four separate human pancreases.

Citation: Journal of Endocrinology 211, 2; 10.1530/JOE-11-0123

Figure 2
Figure 2

Expression of differentiated and pluripotency-associated genes in ISCs. (A) Analysis of insulin, CK19 and pluripotency-associated gene expression in islet-enriched fraction (IF) and cultured ISCs over ten passages. Human embryonic stem cells (hESCs) and human skin fibroblasts (HSFs) were included as positive and negative controls respectively. (B) Expression of endocrine and exocrine genes in ISCs at P5 in comparison to IF and primary HSFs. GAPDH was used as a reference gene control in all RT-PCR experiments. (C) Percentage expression of OCT4 mRNA relative to GAPDH expression in HSFs, ISCs (P5) and hESCs determined by densitometry. Data are mean±s.d.; *P<0.05; **P<0.01 (one-way ANOVA). Results are representative of those from three separate human pancreases (all of which are included in the data comprising the graph in panel C).

Citation: Journal of Endocrinology 211, 2; 10.1530/JOE-11-0123

Isolated human islet preparations of >70% purity were established in proliferative monolayer culture conditions. Islets and single cells with a range of morphologies adhered to the flask over the first 48–72 h, with proliferation over subsequent days including outgrowth of cells from the islets as described previously (Hardikar et al. 2002). Following passage, proliferative cells with a fibroblast-like morphology became the predominant phenotype. These cells were termed islet survivor cells (ISCs).

Characterisation by RT-PCR of ISCs in culture demonstrated loss of differentiated endocrine phenotypic marker expression including insulin, glucagon, somatostatin and pancreatic polypeptide over time with all being consistently undetectable at fifth passage (Fig. 2A and B). Whilst expression of the exocrine marker amylase was also lost, the specific ductal marker CK19 was maintained (Fig. 2A).

Expression of the classical pluripotent stem cell markers OCT4, SOX2 and NANOG appeared to diminish over time with increased expression in ISCs at fifth passage (Fig. 2A). H9 human ES cells and human skin fibroblasts were used as positive and negative controls respectively. Consistent OCT4 expression in ISCs was confirmed by semi-quantitative RT-PCR in three repeated studies, expressed at ∼30% of the level in ES cells at fifth passage (Fig. 2C).

Immunofluorescence studies demonstrated OCT4 staining in a small number of cells throughout the pancreas (Fig. 1B) with confocal microscopy confirming that stained cells were very small (1.5–3 μm) and nucleated with cytoplasmic OCT4 localisation (Fig. 1C). Cytoplasmic localisation was also demonstrated in IF cells with no evidence of co-localisation with insulin (Fig. 3A) or CK19 (Fig. 3B).

Figure 3
Figure 3

Immunofluorescence staining for OCT4 in IF and cultured ISCs. (A and B) Cytoplasmic expression of OCT4 (red) in islet fraction with no evidence of co-localisation with insulin (green) or CK19 (green). (C) Nuclear expression of OCT4 in ISCs at P5. (D) CK19-expressing ISCs (green) at P5 show no co-localisation with Oct4 (nuclear)-expressing cells. Size bar=50 μm. Data are representative of cultures derived from three separate donor pancreases.

Citation: Journal of Endocrinology 211, 2; 10.1530/JOE-11-0123

Following culture, the expression pattern of OCT4 was altered with nuclear localisation of the transcription factor evident in 8.6±2.2% (mean±s.d. of >500 cells from each of the three donors) of ISCs at fifth passage (Fig. 3C). There was no co-localisation of OCT4 and CK19 (Fig. 3D), with protein expression of insulin and all other end-differentiated endocrine markers lost (data not shown).

Nuclear co-localisation of NANOG (Fig. 4A) and SOX2 (Fig. 4B) in OCT4-positive cells was confirmed by confocal microscopy. H9 human ES cells were used as a positive OCT4, SOX2 and NANOG control and human skin fibroblasts as negative control showing no positive staining (data not shown).

Figure 4
Figure 4

Confocal images of ISC immunofluorescence staining for stem cell markers. (A) Nuclear co-localisation of OCT4 in green and NANOG in red. (B) Nuclear co-localisation of SOX2 in green and NANOG in red. Nuclei are stained with DAPI blue. Size bars=50 μm (A) and 25 μm (B). Data are representative of cultures derived from three separate donor pancreases.

Citation: Journal of Endocrinology 211, 2; 10.1530/JOE-11-0123

OCT4 protein expression in ISCs was quantified by flow cytometry (Fig. 5B), with no OCT4 positivity detected in the absence of primary antibody (Fig. 5A) or in control human skin fibroblasts (data not shown).

Figure 5
Figure 5

Flow cytometry and western blotting of ISCs for OCT4 protein expression. (A) Absence of signal in negative control lacking primary antibody. (B) Confirmation of OCT4 expression in ISCs (P5) by flow cytometry. (C) OCT4 expression in 8.3±0.3% of ISCs. Data expressed as mean±s.d. (n=3 donors). The gate was set to exclude cell debris. (D) OCT4 expression by western blotting in human embryonic stem cells (hESC) and in the nuclear but not cytoplasmic fraction of ISCs. GAPDH was used as a reference gene.

Citation: Journal of Endocrinology 211, 2; 10.1530/JOE-11-0123

Approximately 8% of ISCs at fifth passage expressed OCT4 (Fig. 5C). Nuclear OCT4 protein localisation in ISCs was further demonstrated by western blot with a band corresponding to that in H9 human ES cells (Fig. 5D). No OCT4 protein expression was seen in human skin fibroblasts. Western blot densitometry (corrected for GAPDH band intensity) demonstrated nuclear expression in ISCs at 48% of that in human ES cells.

ISCs were transfected with a plasmid designed to label undifferentiated pluripotent ES cells in which the GFP reporter gene is expressed under the control of the human OCT4 promoter. Control transfections with the pIRES-GFP plasmid in which GFP is driven by the constitutive cytomegalovirus demonstrated the capability of ISCs to express exogenous GFP with a transfection efficiency of ∼5% (Fig. 6A1). Expression of eGFP under the control of the OCT4 promoter in ISCs was confirmed in ∼0.5% of cells (Fig. 6A2) with expression of nuclear OCT4 (Fig. 6B) and NANOG (Fig. 6C) in all GFP-positive cells indicating the accurate designation of putative stem cells in these reporter gene studies. Furthermore, the absence of Ki67 staining in all GFP-positive ISCs demonstrated that OCT4-expressing cells showed no evidence of active proliferation (Fig. 6D). Stem cell specificity was evidenced by OCT4–GFP expression in transfected H9 human ES cells but absence of expression in transfected MIN6 mouse β-cells and primary human skin fibroblasts (data not shown).

Figure 6
Figure 6

Oct4–eGFP expression in ISCs. (A1) Control transfections of ISCs (P5) with pIRES–eGFP. (A2) ISCs transfected with Oct4–eGFP. Oct4–eGFP-positive ISCs co-staining with nuclear (B) OCT4 (red) and (C) NANOG (red) antibodies. (D) Non co-localisation of proliferative (Ki67 positive (red)) ISCs with Oct4–eGFP-positive cells. Nuclei stained with DAPI blue. Size bars=100 μm (A1 and A2), 50 μm (B and D) and 25 μm (C). Data are representative of cultures derived from three separate donor pancreases.

Citation: Journal of Endocrinology 211, 2; 10.1530/JOE-11-0123

Discussion

Several groups have previously published evidence of proliferative cultures derived from purified human islet preparations, with lineage tracing studies confirming the contribution of de-differentiated β-cells (Gershengorn et al. 2004, Kayali et al. 2007, Russ et al. 2008, 2009). However, these islet-enriched fractions are not entirely pure as evidenced by initial expression of ductal and exocrine markers in these studies. Following culturing to the fifth passage, exocrine and differentiated endocrine marker expression was lost, although the ductal marker CK19 was maintained with evidence of proliferation by Ki67 positivity.

Collectively, OCT4, SOX2 and NANOG form the core transcriptional network responsible for maintaining pluripotency in ES cells (Boyer et al. 2005). Although a key ES cell regulator, OCT4 expression has been detected in multiple somatic tissues including the liver, kidney, bone marrow and umbilical cord blood (Tai et al. 2005, Seo et al. 2009, Wer & Shen 2011). Cells expressing OCT4 termed ‘very small embryonic-like stem cells’ have recently been isolated from murine pancreas (Zuba-Surma et al. 2009), and it has been proposed that these may provide a quiescent pool of stem cells for replenishing tissue-specific progenitors in times of extensive tissue injury. The presence of cells expressing OCT4 and SOX2 in unmanipulated human pancreas has previously been reported (Zhao et al. 2007). In this study, we have confirmed the size of OCT4-positive cells as only ∼1.5–3 μm, in keeping with murine ‘very small embryonic-like stem cells’. Furthermore, we have demonstrated the presence of larger OCT4-expressing cells in purified islet-enriched fractions, with no co-localisation with insulin or CK19-positive cells.

Expression of OCT4 in human pancreas-derived primary cell cultures has been previously reported (Tai et al. 2005, Gorjup et al. 2009). However, here we have demonstrated for the first time evidence for the nuclear co-localisation of OCT4, SOX2 and NANOG, a phenotype that constitutes ∼8% of the overall population following five passages. Critically, through specific experimental design, we have provided novel evidence for expression in human pancreatic derived proliferative cells of OCT4A, the only isoform capable of maintaining pluripotency.

Two main OCT4 isoforms have been described, OCT4A and OCT4B (Lee et al. 2006, Atlasi et al. 2008). Since OCT4A is the only isoform capable of conferring pluripotency, considerable concerns have been expressed regarding the potential for falsely designating expression of OCT4B as OCT4A in cells derived from adult tissues. Given that the OCT4B mRNA transcript is truncated without exon 1 of the original OCT4A isoform (Atlasi et al. 2008), we were able to eliminate false-positive RT-PCR results by designing the 5′ primer to recognise a sequence within the first exon. Additionally, the potential for pseudogene expression was eliminated by treating all RNA samples with DNase and conducting parallel RNA only PCR-negative control reactions.

In all of these studies, H9 ES cells were used as the gold standard positive control. Moreover, no OCT4 gene or protein expression was detected in human skin fibroblasts used as a negative control. OCT4 protein expression was confirmed by immunostaining, flow cytometry and western blotting. Nuclear localisation provided further evidence for functional OCT4A, as opposed to OCT4B expression, which has been reported as being expressed exclusively within the cytoplasm (Atlasi et al. 2008). In addition, activation of the OCT4 promoter in a reporter gene construct was seen in H9 ES cells and ISCs but not in control differentiated β-cells or human skin fibroblasts.

Recently, expression of OCT4B in peripheral blood mononuclear cells has been reported (Papamichos et al. 2009). This study also found the regulatory sequences of the human OCT4 promoter in these cells to be densely methylated and hence the OCT4 locus transcriptionally inactive (Papamichos et al. 2009). This paradox suggests that transcription of the OCT4A isoform is controlled by the promoter region upstream of exon 1 while OCT4B transcription may be regulated by an alternative promoter possibly located within the OCT4A gene, i.e. exon 1. The OCT4 promoter sequence within our reporter construct comprised the full-length promoter sequence upstream of the transcription start site (Okazawa et al. 1991, Minucci et al. 1996, Yeom et al. 1996). This reporter construct has been extensively characterised with several reports demonstrating its stem cell-specific expression (Gerrard et al. 2005). In particular, GFP expression has been shown to closely correlate with endogenous OCT4 expression in human ES cells (Gerrard et al. 2005). Furthermore, utilisation of this reporter construct has enabled groups to identify false-positive detection of OCT4 in adult tissues. For example, by using several published primers, OCT4 expression was detected in a number of adult tissues; however, the only cells capable of activating GFP expression under the control of the OCT4 promoter were embryonic carcinoma cells (positive control) (Redshaw & Strain 2010). Sequencing of each mRNA transcript identified OCT4A expression in EC cells only, with all adult cells demonstrating OCT4 pseudogene or splice variant expression.

Demonstration of OCT4–GFP-expressing ISCs with nuclear co-localisation of OCT4, NANOG and SOX2 and absence of co-localisation with any differentiated markers provides robust evidence for the existence of a pancreatic phenotype, which has not previously been adequately characterised. Although the origin of these cells remains unknown, migratory mesenchymal stem cells (MSCs) are a possible candidate with studies indicating the presence of cells within pancreatic primary cultures expressing markers characteristic of MSCs, including CD90 and CD105 (Carlotti et al. 2010). Indeed, expression of OCT4, SOX2 and NANOG has been previously demonstrated in MSCs derived from adult tissues (Riekstina et al. 2009) with OCT4 and NANOG RNA expression in pancreas-derived cells (Gorjup et al. 2009). Further studies are planned to explore the origin of these cells and to undertake in vitro lineage tracing studies to determine whether these are derived from cells in unmanipulated pancreas expressing OCT4 in the cytoplasm, whether they possess functional stem cell characteristics and potential for differentiation into mature pancreatic cell types.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This work was supported by the Diabetes Foundation, Diabetes UK and the Ministry of Health, Kingdom of Saudi Arabia.

Acknowledgements

We are very grateful to Dr Guo Cai Huang and Prof. Stephanie Amiel (King's College Hospital London, UK) for providing human islets; Dr Wei Cui (Imperial College London, UK) for providing OCT4–eGFP plasmid; and Dr Matthew Wright and Dr Linda Lako (both Newcastle University UK) for providing control non-pancreatic human cells.

References

  • Al-Turaifi HRH, Aldibbiat AIM, Holliman GN, Campbell SC, Shaw JAM, Huang GC & Amiel SA 2008 Expression of pluripotent stem cell markers within intact adult human pancreas and proliferative adherent cell cultures derived from digested pancreas. Diabetologia 51 S182 (abstract).

    • Search Google Scholar
    • Export Citation
  • Atlasi Y, Mowla SJ, Ziaee SA, Gokhale PJ & Andrews PW 2008 OCT4 spliced variants are differentially expressed in human pluripotent and nonpluripotent cells. Stem Cells 26 30683074. doi:10.1634/stemcells.2008-0530.

    • Search Google Scholar
    • Export Citation
  • Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, Zucker JP, Guenther MG, Kumar RM, Murray HL & Jenner RG et al. 2005 Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122 947956. doi:10.1016/j.cell.2005.08.020.

    • Search Google Scholar
    • Export Citation
  • Carlotti F, Zaldumbide A, Loomans CJ, van Rossenberg E, Engelse M, de Koning EJ & Hoeben RC 2010 Isolated human islets contain a distinct population of mesenchymal stem cells. Islets 2 164173. doi:10.4161/isl.2.3.11449.

    • Search Google Scholar
    • Export Citation
  • Dor Y, Brown J, Martinez OI & Melton DA 2004 Adult pancreatic betacells are formed by self duplication rather than stem-cell differentiation. Nature 429 4146. doi:10.1038/nature02520.

    • Search Google Scholar
    • Export Citation
  • Eberhardt M, Salmon P, von Mach MA, Hengstler JG, Brulport M, Linscheid P, Seboek D, Oberholzer J, Barbero A & Martin I et al. 2006 Multipotential nestin and Isl-1 positive mesenchymal stem cells isolated from human pancreatic islets. Biochemical and Biophysical Research Communications 345 11671176. doi:10.1016/j.bbrc.2006.05.016.

    • Search Google Scholar
    • Export Citation
  • Gerrard L, Zhao D, Clark AJ & Cui W 2005 Stably transfected human embryonic stem cell clones express OCT4-specific green fluorescent protein and maintain self-renewal and pluripotency. Stem Cells 23 124133. doi:10.1634/stemcells.2004-0102.

    • Search Google Scholar
    • Export Citation
  • Gershengorn MC, Hardikar AA, Wei C, Geras-Raaka E, Marcus-Samuels B & Raaka BM 2004 Epithelial-to-mesenchymal transition generates proliferative human islet precursor cells. Science 306 22612264. doi:10.1126/science.1101968.

    • Search Google Scholar
    • Export Citation
  • Gorjup E, Danner S, Rotter N, Habermann J, Brassat U, Brummendorf TH, Wien S, Meyerhans A, Wollenberg B & Kruse C et al. 2009 Glandular tissue from human pancreas and salivary gland yields similar stem cell populations. European Journal of Cell Biology 88 409421. doi:10.1016/j.ejcb.2009.02.187.

    • Search Google Scholar
    • Export Citation
  • Hardikar AA, Marcus-Samuels B, Geras-Raaka E, Raaka BM & Gershengorn MC 2002 Human pancreatic precursor cells secrete FGF2 to stimulate clustering into hormone-expressing islet-like cell aggregates. PNAS 100 71177122. doi:10.1073/pnas.1232230100.

    • Search Google Scholar
    • Export Citation
  • Huang GC, Zhao M, Jones P, Persaud S, Ramracheya R, Löbner K, Christie MR, Banga JP, Peakman M & Sirinivsan P et al. 2004 The development of new density gradient media for purifying human islets and islet-quality assessments. Transplantation 77 143145. doi:10.1097/01.TP.0000100401.62912.B2.

    • Search Google Scholar
    • Export Citation
  • Kayali AG, Flores LE, Lopez AD, Kutlu B, Baetge E, Kitamura R, Hao E, Beattie GM & Hayek A 2007 Limited capacity of human adult islets expanded in vitro to redifferentiate into insulin-producing beta-cells. Diabetes 56 703708. doi:10.2337/db06-1545.

    • Search Google Scholar
    • Export Citation
  • Kristensen DM, Nielsen JE, Kalisz M, Dalgaard MD, Audouze K, Larsen ME, Jacobsen GK, Horn T, Brunak S & Skakkebaek NE et al. 2010 OCT4 and downstream factors are expressed in human somatic urogenital epithelia and in culture of epididymal spheres. Molecular Human Reproduction 16 835845. doi:10.1093/molehr/gaq008.

    • Search Google Scholar
    • Export Citation
  • Lee J, Lee J, Jeung-Yon Rho HKK, Han YM & Kim J 2006 The human OCT-4 isoforms differ in their ability to confer self-renewal. Journal of Biological Chemistry 281 3355433565. doi:10.1074/jbc.M603937200.

    • Search Google Scholar
    • Export Citation
  • Liedtke S, Enczmann J, Waclawczyk S, Wernet P & Kögler G 2007 Oct4 and its pseudogenes confuse stem cell research. Cell Stem Cell 1 364366. doi:10.1016/j.stem.2007.09.003.

    • Search Google Scholar
    • Export Citation
  • Macfarlane WM, Shepherd RM, Cosgrove KE, James RF, Dunne MJ & Docherty K 2000 Glucose modulation of insulin mRNA levels is dependent on transcription factor PDX-1 and occurs independently of changes in intracellular Ca2+. Diabetes 49 418423. doi:10.2337/diabetes.49.3.418.

    • Search Google Scholar
    • Export Citation
  • Manesso E, Toffolo GM, Saisho Y, Butler AE, Matveyenko AV, Cobelli C & Butler PC 2009 Dynamics of beta-cell turnover: evidence for beta-cell turnover and regeneration from sources of beta-cells other than beta-cell replication in the HIP rat. American Journal of Physiology. Endocrinology and Metabolism 297 E323E330. doi:10.1152/ajpendo.00284.2009.

    • Search Google Scholar
    • Export Citation
  • Meier JJ, Butler AE, Saisho Y, Monchamp T, Galasso R, Bhushan A, Rizza RA & Butler PC 2008 Beta-cell replication is the primary mechanism subserving the postnatal expansion of beta-cell mass in humans. Diabetes 57 15841594. doi:10.2337/db07-1369.

    • Search Google Scholar
    • Export Citation
  • Minucci S, Botquin V, Yeom YI, Dey A, Sylvester I, Zand DJ, Ohbo K, Ozato K & Scholer HR 1996 Retinoic acid-mediated down-regulation of Oct3/4 coincides with the loss of promoter occupancy in vivo. EMBO Journal 15 888899..

    • Search Google Scholar
    • Export Citation
  • Okazawa H, Okamoto K, Ishino F, Ishino-Kaneko T, Takeda S, Toyoda Y, Muramatsu M & Hamada H 1991 The oct3 gene, a gene for an embryonic transcription factor, is controlled by a retinoic acid repressible enhancer. EMBO Journal 10 29973005..

    • Search Google Scholar
    • Export Citation
  • Pacini S, Carnicelli V, Trombi L, Montali M, Fazzi R, Lazzarini E, Giannotti S & Petrini M 2010 Constitutive expression of pluripotency-associated genes in mesodermal progenitor cells (MPCs). PLoS ONE 5 e9861 doi:10.1371/journal.pone.0009861.

    • Search Google Scholar
    • Export Citation
  • Papamichos SI, Lambropoulos AF & Kotoula V 2009 OCT4B expression in PBMNCs suggests the existence of an alternative OCT4 promoter. Genes, Chromosomes & Cancer 48 11121114. doi:10.1002/gcc.20707.

    • Search Google Scholar
    • Export Citation
  • Redshaw Z & Strain A 2010 Human haematopoietic stem cells express Oct4 pseudogenes and lack the ability to initiate Oct4 promoter-driven gene expression. Journal of Negative Results in Biomedicine 9 2 doi:10.1186/1477-5751-9-2.

    • Search Google Scholar
    • Export Citation
  • Riekstina U, Cakstina I, Parfejevs V, Hoogduijn M, Jankovskis G, Muiznieks I, Muceniece R & Ancans J 2009 Embryonic stem cell marker expression pattern in human mesenchymal stem cells derived from bone marrow, adipose tissue, heart and dermis. Stem Cell Reviews 5 378386. doi:10.1007/s12015-009-9094-9.

    • Search Google Scholar
    • Export Citation
  • Russ HA, Bar Y, Ravassard P & Efrat S 2008 In vitro proliferation of cells derived from adult human beta-cells revealed by cell-lineage tracing. Diabetes 57 15751583. doi:10.2337/db07-1283.

    • Search Google Scholar
    • Export Citation
  • Russ HA, Ravassard P, Kerr-Conte J, Pattou F & Efrat S 2009 Epithelial–mesenchymal transition in cells expanded in vitro from lineage-traced adult human pancreatic beta cells. PLoS ONE 4 e6417 doi:10.1371/journal.pone.0006417.

    • Search Google Scholar
    • Export Citation
  • Seaberg RM, Smukler SR, Kieffer TJ, Enikolopov G, Asghar Z, Wheeler MB, Korbutt G & van der Kooy D 2004 Clonal identification of multipotent precursors from adult mouse pancreas that generate neural and pancreatic lineages. Nature Biotechnology 22 11151124. doi:10.1038/nbt1004.

    • Search Google Scholar
    • Export Citation
  • Seo KW, Lee SR, Bhandari DR, Roh K-H, Park SB, So AH, Jung JW, Seo MS, Kang SK & Lee YS et al. 2009 OCT4A contributes to the stemness and multi-potency of human umbilical cord blood-derived multipotent stem cells (hUCB–MSCs). Biochemical and Biophysical Research Communications 384 120125. doi:10.1016/j.bbrc.2009.04.094.

    • Search Google Scholar
    • Export Citation
  • Suzuki A, Nakauchi H & Taniguchi H 2004 Prospective isolation of multipotent pancreatic progenitors using flow-cytometric cell sorting. Diabetes 53 21432152. doi:10.2337/diabetes.53.8.2143.

    • Search Google Scholar
    • Export Citation
  • Tai MH, Chang CC, Olson LK & Trosko JE 2005 Oct4 expression in adult human stem cells: evidence in support of the stem cell theory of carcinogenesis. Carcinogenesis 26 495502. doi:10.1093/carcin/bgh321.

    • Search Google Scholar
    • Export Citation
  • Wer X & Shen CY 2011 Transcriptional regulation of Oct4 in human bone marrow mesenchymal stem cells. Stem Cells and Development 20 441449. doi:10.1089/scd.2010.0069.

    • Search Google Scholar
    • Export Citation
  • Xu X, D'Hoker J, Stangé G, Bonné S, De Leu N, Xiao X, Van de Casteele M, Mellitzer G, Ling Z & Pipeleers D et al. 2008 Beta cells can be generated from endogenous progenitors in injured adult mouse pancreas. Cell 132 197207. doi:10.1016/j.cell.2007.12.015.

    • Search Google Scholar
    • Export Citation
  • Yeom YI, Fuhrmann G, Ovitt CE, Brehm A, Ohbo K, Gross M, Hübner K & Schöler HR 1996 Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells. Development 122 881894..

    • Search Google Scholar
    • Export Citation
  • Zhao M, Amiel SA, Christie MR, Muiesan P, Srinivasan P, Littlejohn W, Rela M, Arno M, Heaton N & Huang GC 2007 Evidence for the presence of stem cell-like progenitor cells in human adult pancreas. Journal of Endocrinology 195 407414. doi:10.1677/JOE-07-0436.

    • Search Google Scholar
    • Export Citation
  • Zuba-Surma EK, Kucia M, Ratajczak J & Ratajczak MZ 2009 "Small stem cells" in adult tissues: very small embryonic-like stem cells stand up! Cytometry Part A 75 413. doi:10.1002/cyto.a.20665.

    • Search Google Scholar
    • Export Citation
*

(M G White and H R Al-Turaifi contributed equally to experimental data and manuscript preparation)

 

Society for Endocrinology

Sept 2018 onwards Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 398 74 11
PDF Downloads 584 187 28
  • View in gallery

    OCT4 expression in unmanipulated adult human pancreas. (A) RT-PCR analysis of OCT4 expression in human pancreas (HP) compared to human embryonic stem cells (hESCs) and human skin fibroblasts (HSF). (B) Immunofluorescence staining of OCT4 (red) in human pancreas sections. Size bar=100 μm. (C and D) Confocal images of small OCT4 (red)-positive cells (∼2–3 μm). Size bars=3.07 μm (C) and 2.23 μm (D). Nuclei are stained with DAPI blue. Data are representative of results from four separate human pancreases.

  • View in gallery

    Expression of differentiated and pluripotency-associated genes in ISCs. (A) Analysis of insulin, CK19 and pluripotency-associated gene expression in islet-enriched fraction (IF) and cultured ISCs over ten passages. Human embryonic stem cells (hESCs) and human skin fibroblasts (HSFs) were included as positive and negative controls respectively. (B) Expression of endocrine and exocrine genes in ISCs at P5 in comparison to IF and primary HSFs. GAPDH was used as a reference gene control in all RT-PCR experiments. (C) Percentage expression of OCT4 mRNA relative to GAPDH expression in HSFs, ISCs (P5) and hESCs determined by densitometry. Data are mean±s.d.; *P<0.05; **P<0.01 (one-way ANOVA). Results are representative of those from three separate human pancreases (all of which are included in the data comprising the graph in panel C).

  • View in gallery

    Immunofluorescence staining for OCT4 in IF and cultured ISCs. (A and B) Cytoplasmic expression of OCT4 (red) in islet fraction with no evidence of co-localisation with insulin (green) or CK19 (green). (C) Nuclear expression of OCT4 in ISCs at P5. (D) CK19-expressing ISCs (green) at P5 show no co-localisation with Oct4 (nuclear)-expressing cells. Size bar=50 μm. Data are representative of cultures derived from three separate donor pancreases.

  • View in gallery

    Confocal images of ISC immunofluorescence staining for stem cell markers. (A) Nuclear co-localisation of OCT4 in green and NANOG in red. (B) Nuclear co-localisation of SOX2 in green and NANOG in red. Nuclei are stained with DAPI blue. Size bars=50 μm (A) and 25 μm (B). Data are representative of cultures derived from three separate donor pancreases.

  • View in gallery

    Flow cytometry and western blotting of ISCs for OCT4 protein expression. (A) Absence of signal in negative control lacking primary antibody. (B) Confirmation of OCT4 expression in ISCs (P5) by flow cytometry. (C) OCT4 expression in 8.3±0.3% of ISCs. Data expressed as mean±s.d. (n=3 donors). The gate was set to exclude cell debris. (D) OCT4 expression by western blotting in human embryonic stem cells (hESC) and in the nuclear but not cytoplasmic fraction of ISCs. GAPDH was used as a reference gene.

  • View in gallery

    Oct4–eGFP expression in ISCs. (A1) Control transfections of ISCs (P5) with pIRES–eGFP. (A2) ISCs transfected with Oct4–eGFP. Oct4–eGFP-positive ISCs co-staining with nuclear (B) OCT4 (red) and (C) NANOG (red) antibodies. (D) Non co-localisation of proliferative (Ki67 positive (red)) ISCs with Oct4–eGFP-positive cells. Nuclei stained with DAPI blue. Size bars=100 μm (A1 and A2), 50 μm (B and D) and 25 μm (C). Data are representative of cultures derived from three separate donor pancreases.

  • Al-Turaifi HRH, Aldibbiat AIM, Holliman GN, Campbell SC, Shaw JAM, Huang GC & Amiel SA 2008 Expression of pluripotent stem cell markers within intact adult human pancreas and proliferative adherent cell cultures derived from digested pancreas. Diabetologia 51 S182 (abstract).

    • Search Google Scholar
    • Export Citation
  • Atlasi Y, Mowla SJ, Ziaee SA, Gokhale PJ & Andrews PW 2008 OCT4 spliced variants are differentially expressed in human pluripotent and nonpluripotent cells. Stem Cells 26 30683074. doi:10.1634/stemcells.2008-0530.

    • Search Google Scholar
    • Export Citation
  • Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, Zucker JP, Guenther MG, Kumar RM, Murray HL & Jenner RG et al. 2005 Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122 947956. doi:10.1016/j.cell.2005.08.020.

    • Search Google Scholar
    • Export Citation
  • Carlotti F, Zaldumbide A, Loomans CJ, van Rossenberg E, Engelse M, de Koning EJ & Hoeben RC 2010 Isolated human islets contain a distinct population of mesenchymal stem cells. Islets 2 164173. doi:10.4161/isl.2.3.11449.

    • Search Google Scholar
    • Export Citation
  • Dor Y, Brown J, Martinez OI & Melton DA 2004 Adult pancreatic betacells are formed by self duplication rather than stem-cell differentiation. Nature 429 4146. doi:10.1038/nature02520.

    • Search Google Scholar
    • Export Citation
  • Eberhardt M, Salmon P, von Mach MA, Hengstler JG, Brulport M, Linscheid P, Seboek D, Oberholzer J, Barbero A & Martin I et al. 2006 Multipotential nestin and Isl-1 positive mesenchymal stem cells isolated from human pancreatic islets. Biochemical and Biophysical Research Communications 345 11671176. doi:10.1016/j.bbrc.2006.05.016.

    • Search Google Scholar
    • Export Citation
  • Gerrard L, Zhao D, Clark AJ & Cui W 2005 Stably transfected human embryonic stem cell clones express OCT4-specific green fluorescent protein and maintain self-renewal and pluripotency. Stem Cells 23 124133. doi:10.1634/stemcells.2004-0102.

    • Search Google Scholar
    • Export Citation
  • Gershengorn MC, Hardikar AA, Wei C, Geras-Raaka E, Marcus-Samuels B & Raaka BM 2004 Epithelial-to-mesenchymal transition generates proliferative human islet precursor cells. Science 306 22612264. doi:10.1126/science.1101968.

    • Search Google Scholar
    • Export Citation
  • Gorjup E, Danner S, Rotter N, Habermann J, Brassat U, Brummendorf TH, Wien S, Meyerhans A, Wollenberg B & Kruse C et al. 2009 Glandular tissue from human pancreas and salivary gland yields similar stem cell populations. European Journal of Cell Biology 88 409421. doi:10.1016/j.ejcb.2009.02.187.

    • Search Google Scholar
    • Export Citation
  • Hardikar AA, Marcus-Samuels B, Geras-Raaka E, Raaka BM & Gershengorn MC 2002 Human pancreatic precursor cells secrete FGF2 to stimulate clustering into hormone-expressing islet-like cell aggregates. PNAS 100 71177122. doi:10.1073/pnas.1232230100.

    • Search Google Scholar
    • Export Citation
  • Huang GC, Zhao M, Jones P, Persaud S, Ramracheya R, Löbner K, Christie MR, Banga JP, Peakman M & Sirinivsan P et al. 2004 The development of new density gradient media for purifying human islets and islet-quality assessments. Transplantation 77 143145. doi:10.1097/01.TP.0000100401.62912.B2.

    • Search Google Scholar
    • Export Citation
  • Kayali AG, Flores LE, Lopez AD, Kutlu B, Baetge E, Kitamura R, Hao E, Beattie GM & Hayek A 2007 Limited capacity of human adult islets expanded in vitro to redifferentiate into insulin-producing beta-cells. Diabetes 56 703708. doi:10.2337/db06-1545.

    • Search Google Scholar
    • Export Citation
  • Kristensen DM, Nielsen JE, Kalisz M, Dalgaard MD, Audouze K, Larsen ME, Jacobsen GK, Horn T, Brunak S & Skakkebaek NE et al. 2010 OCT4 and downstream factors are expressed in human somatic urogenital epithelia and in culture of epididymal spheres. Molecular Human Reproduction 16 835845. doi:10.1093/molehr/gaq008.

    • Search Google Scholar
    • Export Citation
  • Lee J, Lee J, Jeung-Yon Rho HKK, Han YM & Kim J 2006 The human OCT-4 isoforms differ in their ability to confer self-renewal. Journal of Biological Chemistry 281 3355433565. doi:10.1074/jbc.M603937200.

    • Search Google Scholar
    • Export Citation
  • Liedtke S, Enczmann J, Waclawczyk S, Wernet P & Kögler G 2007 Oct4 and its pseudogenes confuse stem cell research. Cell Stem Cell 1 364366. doi:10.1016/j.stem.2007.09.003.

    • Search Google Scholar
    • Export Citation
  • Macfarlane WM, Shepherd RM, Cosgrove KE, James RF, Dunne MJ & Docherty K 2000 Glucose modulation of insulin mRNA levels is dependent on transcription factor PDX-1 and occurs independently of changes in intracellular Ca2+. Diabetes 49 418423. doi:10.2337/diabetes.49.3.418.

    • Search Google Scholar
    • Export Citation
  • Manesso E, Toffolo GM, Saisho Y, Butler AE, Matveyenko AV, Cobelli C & Butler PC 2009 Dynamics of beta-cell turnover: evidence for beta-cell turnover and regeneration from sources of beta-cells other than beta-cell replication in the HIP rat. American Journal of Physiology. Endocrinology and Metabolism 297 E323E330. doi:10.1152/ajpendo.00284.2009.

    • Search Google Scholar
    • Export Citation
  • Meier JJ, Butler AE, Saisho Y, Monchamp T, Galasso R, Bhushan A, Rizza RA & Butler PC 2008 Beta-cell replication is the primary mechanism subserving the postnatal expansion of beta-cell mass in humans. Diabetes 57 15841594. doi:10.2337/db07-1369.

    • Search Google Scholar
    • Export Citation
  • Minucci S, Botquin V, Yeom YI, Dey A, Sylvester I, Zand DJ, Ohbo K, Ozato K & Scholer HR 1996 Retinoic acid-mediated down-regulation of Oct3/4 coincides with the loss of promoter occupancy in vivo. EMBO Journal 15 888899..

    • Search Google Scholar
    • Export Citation
  • Okazawa H, Okamoto K, Ishino F, Ishino-Kaneko T, Takeda S, Toyoda Y, Muramatsu M & Hamada H 1991 The oct3 gene, a gene for an embryonic transcription factor, is controlled by a retinoic acid repressible enhancer. EMBO Journal 10 29973005..

    • Search Google Scholar
    • Export Citation
  • Pacini S, Carnicelli V, Trombi L, Montali M, Fazzi R, Lazzarini E, Giannotti S & Petrini M 2010 Constitutive expression of pluripotency-associated genes in mesodermal progenitor cells (MPCs). PLoS ONE 5 e9861 doi:10.1371/journal.pone.0009861.

    • Search Google Scholar
    • Export Citation
  • Papamichos SI, Lambropoulos AF & Kotoula V 2009 OCT4B expression in PBMNCs suggests the existence of an alternative OCT4 promoter. Genes, Chromosomes & Cancer 48 11121114. doi:10.1002/gcc.20707.

    • Search Google Scholar
    • Export Citation
  • Redshaw Z & Strain A 2010 Human haematopoietic stem cells express Oct4 pseudogenes and lack the ability to initiate Oct4 promoter-driven gene expression. Journal of Negative Results in Biomedicine 9 2 doi:10.1186/1477-5751-9-2.

    • Search Google Scholar
    • Export Citation
  • Riekstina U, Cakstina I, Parfejevs V, Hoogduijn M, Jankovskis G, Muiznieks I, Muceniece R & Ancans J 2009 Embryonic stem cell marker expression pattern in human mesenchymal stem cells derived from bone marrow, adipose tissue, heart and dermis. Stem Cell Reviews 5 378386. doi:10.1007/s12015-009-9094-9.

    • Search Google Scholar
    • Export Citation
  • Russ HA, Bar Y, Ravassard P & Efrat S 2008 In vitro proliferation of cells derived from adult human beta-cells revealed by cell-lineage tracing. Diabetes 57 15751583. doi:10.2337/db07-1283.

    • Search Google Scholar
    • Export Citation
  • Russ HA, Ravassard P, Kerr-Conte J, Pattou F & Efrat S 2009 Epithelial–mesenchymal transition in cells expanded in vitro from lineage-traced adult human pancreatic beta cells. PLoS ONE 4 e6417 doi:10.1371/journal.pone.0006417.

    • Search Google Scholar
    • Export Citation
  • Seaberg RM, Smukler SR, Kieffer TJ, Enikolopov G, Asghar Z, Wheeler MB, Korbutt G & van der Kooy D 2004 Clonal identification of multipotent precursors from adult mouse pancreas that generate neural and pancreatic lineages. Nature Biotechnology 22 11151124. doi:10.1038/nbt1004.

    • Search Google Scholar
    • Export Citation
  • Seo KW, Lee SR, Bhandari DR, Roh K-H, Park SB, So AH, Jung JW, Seo MS, Kang SK & Lee YS et al. 2009 OCT4A contributes to the stemness and multi-potency of human umbilical cord blood-derived multipotent stem cells (hUCB–MSCs). Biochemical and Biophysical Research Communications 384 120125. doi:10.1016/j.bbrc.2009.04.094.

    • Search Google Scholar
    • Export Citation
  • Suzuki A, Nakauchi H & Taniguchi H 2004 Prospective isolation of multipotent pancreatic progenitors using flow-cytometric cell sorting. Diabetes 53 21432152. doi:10.2337/diabetes.53.8.2143.

    • Search Google Scholar
    • Export Citation
  • Tai MH, Chang CC, Olson LK & Trosko JE 2005 Oct4 expression in adult human stem cells: evidence in support of the stem cell theory of carcinogenesis. Carcinogenesis 26 495502. doi:10.1093/carcin/bgh321.

    • Search Google Scholar
    • Export Citation
  • Wer X & Shen CY 2011 Transcriptional regulation of Oct4 in human bone marrow mesenchymal stem cells. Stem Cells and Development 20 441449. doi:10.1089/scd.2010.0069.

    • Search Google Scholar
    • Export Citation
  • Xu X, D'Hoker J, Stangé G, Bonné S, De Leu N, Xiao X, Van de Casteele M, Mellitzer G, Ling Z & Pipeleers D et al. 2008 Beta cells can be generated from endogenous progenitors in injured adult mouse pancreas. Cell 132 197207. doi:10.1016/j.cell.2007.12.015.

    • Search Google Scholar
    • Export Citation
  • Yeom YI, Fuhrmann G, Ovitt CE, Brehm A, Ohbo K, Gross M, Hübner K & Schöler HR 1996 Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells. Development 122 881894..

    • Search Google Scholar
    • Export Citation
  • Zhao M, Amiel SA, Christie MR, Muiesan P, Srinivasan P, Littlejohn W, Rela M, Arno M, Heaton N & Huang GC 2007 Evidence for the presence of stem cell-like progenitor cells in human adult pancreas. Journal of Endocrinology 195 407414. doi:10.1677/JOE-07-0436.

    • Search Google Scholar
    • Export Citation
  • Zuba-Surma EK, Kucia M, Ratajczak J & Ratajczak MZ 2009 "Small stem cells" in adult tissues: very small embryonic-like stem cells stand up! Cytometry Part A 75 413. doi:10.1002/cyto.a.20665.

    • Search Google Scholar
    • Export Citation