Abstract
Phenolic estrogen pollutants, a class of typical endocrine-disrupting chemicals, have attracted public attention due to their estrogenic activities of imitating steroid hormone 17β-estradiol (E2) effects. Exposure to these pollutants may disrupt insulin secretion and be a risk factor for type 2 diabetes. In this study, we investigated the direct effects of phenolic estrogen diethylstilbestrol (DES), octylphenol (OP), nonylphenol (NP), and bisphenol A (BPA) on rat pancreatic islets in vitro, whose estrogenic activities were DES>NP>OP>BPA. Isolated β-cells were exposed to E2, DES, OP, NP, or BPA (0, 0.1, 0.5, 2.5, 25, and 250 μg/l) for 24 h. Parameters of insulin secretion, content, and morphology of β-cells were measured. In the glucose-stimulated insulin secretion test, E2 and DES increased insulin secretion in a dose-dependent manner in a 16.7 mM glucose condition. However, for BPA, NP, or OP with lower estrogenic activity, the relationship between the doses and insulin secretion was an inverted U-shape. Moreover, OP, NP, or BPA (25 μg/l) impaired mitochondrial function in β-cells and induced remarkable swelling of mitochondria with loss of distinct cristae structure within the membrane, which was accompanied by disruption of mRNA expression of genes playing a key role in β-cell function (Glut2 (Slc2a2), Gck, Pdx1, Hnf1α, Rab27a, and Snap25), and mitochondrial function (Ucp2 and Ogdh). Therefore, these phenolic estrogens can disrupt islet morphology and β-cell function, and mitochondrial dysfunction is suggested to play an important role in the impairment of β-cell function.
Introduction
Type 2 diabetes, characterized by high blood glucose in the context of insulin resistance and defective insulin secretion, is rising dramatically all over the world. In addition to genetic effects and a high-fat diet, increased exposure to environmental pollutants has been closely linked to the increasing incidence of diabetes mellitus, supported by several laboratory and animal researches as well as epidemiological studies (Carpenter 2008, Hectors et al. 2011).
Endocrine-disrupting chemicals (EDCs) are a class of typical environmental pollutants that were widely dispersed in the environment and to which people are exposed virtually in daily life (Diamanti-Kandarakis et al. 2009, Casals-Casas & Desvergne 2011). In recent decades, a variety of EDCs have been found to interfere with glucose metabolism (Cranmer et al. 2000, Alonso-Magdalena et al. 2010, Hectors et al. 2011, Lin et al. 2011). Physiological levels of estrogen are involved in maintaining normal insulin sensitivity, but an excess of estrogen, such as exposure to chemicals with estrogenic activity at an inappropriate concentration, would increase the risk of developing insulin resistance and diabetes (Zhang et al. 2002, Margolis et al. 2004, Godsland 2005). One of the most striking examples is that adult male mice injected with a daily dose of 100 μg/kg per day bisphenol A (BPA) or 17β-estradiol (E2) for 4 days showed higher insulin secretion, thereby resulting in insulin resistance and postprandial hyperinsulinemia (Alonso-Magdalena et al. 2006). Our previous studies also have demonstrated that perinatal exposure to 50 μg/kg per day BPA led to severe glucose and insulin intolerance in adult rat offspring along with progressive damage of β-cells (Wei et al. 2011).
Pancreatic β-cells are programmed to produce and secrete insulin, so the factors involved in initiation, acceleration, and exacerbation of β-cell dysfunction would disrupt glucose homeostasis and contribute to the development of diabetes. More importantly, recent studies in rodents suggest that endocrine pancreas is the target of some phenolic estrogens (Alonso-Magdalena et al. 2011). For example, long-term exposure to BPA or E2 (between 100 and 1 nM) has been reported to disrupt pancreatic insulin gene expression, insulin content, and secretion in isolated mice islets (Adachi et al. 2005, Alonso-Magdalena et al. 2008). The stimulation of insulin release under both hypoglycemic and hyperglycemic conditions was also observed in beta TC-6 cells treated with 100 μg/l BPA (Makaji et al. 2011). In addition to BPA and E2, long-term exposure to nonylphenol (NP) has been confirmed to increase insulin secretion via cytosolic/nuclear estrogen receptors (Adachi et al. 2005).
Human exposure to EDC pollutants is ubiquitous. Among the EDCs, alkyl phenols (for example, NP and octylphenol (OP)), phenolic estrogen mimics (such as BPA), and phenolic estrogens (such as diethylstilbestrol (DES)) are often studied as a group of environmental phenolic estrogens due to their structural similarity and estrogenic activity (Tapiero et al. 2002, Lin et al. 2008). These phenolic estrogens can act by mimicking the action of the sex hormone E2 to bind to the classical ERs, ERα and ERβ (Newbold 2004), and ERs are involved in important aspects of β-cell physiology, including the regulation of insulin biosynthesis and release (Wozniak et al. 2005, Alonso-Magdalena et al. 2008). However, little is known about whether the potencies of phenolic estrogen binding to ERs are correlated with their effects on insulin secretion in isolated rat islets.
In this study, we chose E2 and four phenolic estrogen pollutants (DES, OP, NP, and BPA), whose potencies of binding to ERs were E2>DES>NP>OP>BPA (Nakada et al. 2004), to investigate their effects on β-cell function. To further understand the disruptive effects of different phenolic estrogen pollutants on the isolated islets, morphology and ultrastructure of β-cells were observed. The mRNA expression levels of genes playing a key role in β-cell function and mitochondrial function were also studied.
Materials and Methods
Animals
Male Sprague Dawley (SD) rats were obtained from the Center for Animal of Tongji Medical College, Huazhong University of Science and Technology (Wuhan, China), and housed under specific pathogen-free conditions. Rats were kept under controlled temperature (22±2 °C) and light conditions (12 h light:12 h darkness cycle) with ad libitum access to a normal diet and water. Glass water bottles and polypropylene cages were used in the study. All animal experiments were approved by the Ethics Committee of Tongji Medical College, in accordance with the guidelines for the care and use of animals established by Tongji Medical College, Huazhong University of Science and Technology.
Cell culture and treatments
Islets were isolated from pancreas of rats by collagenase V digestion and Ficoll 400 step density gradient separation as described (Cherif et al. 1998, Carter et al. 2009, Li et al. 2009). Briefly, collagenase V (Sigma–Aldrich) at 1.0 mg/ml was injected into the common bile duct of rats. The whole pancreas was then excised and digested in Hanks buffer at 37 °C for 12 min. After digestion, pancreatic tissue was rinsed using precooled Hanks buffer several times and the undigested fragments were carefully removed. Isolated cell pellets were resuspended in Ficoll 400 (GE Healthcare, Bucks, UK) and purified from acinar and ductal tissue by density gradient. Purified islets appeared as round or oval structures. A calibrated grid in the eyepiece was used to measure the diameter of the islets. Islets with 150 μm diameter were defined as an islet equivalent quantity (IEQ). Thirty IEQs were handpicked and cultured at 37 °C with 5% CO2 in RPMI 1640 complete medium with 20% fetal bovine serum (FBS) and 11.1 mM glucose for 24 h before experiments. When indicated, isolated islets were treated with E2, BPA, NP, OP, DES, or vehicle (DMSO, 0.1% v/v) for 24 h. Culture media and FBS were purchased from Invitrogen. E2, DES, BPA, NP, and OP were obtained from Sigma.
3-(4,5-Dimethyl thiazol-2-yl-)-2,5-diphenyl tetrazolium bromide assay
At the end of the treatments with phenolic estrogens, the medium of cell pellets was aspirated and 3-(4,5-dimethyl thiazol-2-yl-)-2,5-diphenyl tetrazolium bromide (MTT) was added. After 4 h, medium was removed and 150 μl DMSO was added to dissolve the purple formazan. Absorbance was determined at 570 nm with a microplate reader. Results were expressed as percent (%) cytotoxicity of the control.
Insulin secretion and content measurement
To measure the amount of insulin secretion in isolated islets after exposure to phenolic estrogens, glucose-stimulated insulin secretion (GSIS) was performed as described (Cherif et al. 1998). Briefly, islets were incubated with phenolic estrogens or vehicle for 24 h. Later, the media were switched to Krebs–Ringer/bicarbonate–HEPES (KRBH) buffer containing 0.5% BSA/3.0 mM glucose and incubated for 30 min. Next, media were removed and replaced with KRBH buffer containing 3.0 and 16.7 mM glucose for an additional 60 min. Supernatants were collected and insulin was measured by commercially available RIA Kits (Linco Research, Millipore, Billerica, MA, USA).
Cellular insulin content was determined by acid–ethanol extracts (Nguyen et al. 2012). After islets were exposed to E2 or phenolic estrogen for 24 h, the islets were lysed in 200 μl 70% ethanol plus HCl (1.5% vol/vol) and then sonicated for 15 s. Extraction was allowed to proceed overnight at 4 °C followed by centrifugation at 12 000 g, and the supernatant was used to determine insulin content.
Transmission electron microcopy
Islets treated with E2 or phenolic estrogens were fixed in 2.5% glutaraldehyde for 2 h at 4 °C, then were postfixed in 1% OsO4, dehydrated in a graded series of ethanol, and embedded in Epon. Ultrathin sections were stained with uranyl acetate and lead citrate and were examined with FEI Tecnai 12G2 transmission electron microscope (TEM; FEI, Eindhoven, The Netherlands). The number of insulin granules, the area, and density of mitochondria in β-cells were manually quantified by analyzing 13 500× magnification micrographs. Quantification was performed on ten sections from eight islets, which was analyzed by Image Pro Plus Version 6.0 Software (Media Cybernetics, Silver Spring, MD, USA).
Mitochondrial function assay
Mitochondrial function was assessed by detecting Complex IV (cytochrome c oxidase (COX)) activity and ATP content. At the end of treatment, cells were trypsinized, rinsed with PBS, and resuspended in 10 mM KH2PO4/K2HPO4 buffer (pH 7.4) containing 20 mM succinate. Then, cells were lysed in Triton X-100 and reduced cytochrome c (20 μM) was added to lysates. Complex IV activity was measured by the rate and extent of enzymatic cytochrome c oxidation at 550 nm. Assays were performed using u.v. spectrophotometry.
Cells were precultured and preincubated as described earlier. Cells were lysed and ATP contents were measured with an ATP bioluminescence assay kit (Roche) according to the manufacturer's instructions. Measurement of the protein concentration in cell lysates was performed using the Bradford assay. The ATP content was calculated as nanomoles ATP per microgram protein.
Real-time PCR analysis
After 24-h culture with phenolic estrogens, total RNA was extracted from isolated rat islets by TRIzol reagent (Invitrogen) according to the manufacturer's instructions. Total RNA was reverse transcribed using Fermentas Revert Aid First-Strand cDNA Synthesis Kit (ON, Burlington, Canada). Real-time PCR was performed using an Applied Biosystems model 7900HT Fast Real-Time PCR System. Specific mRNA content was normalized to 36B4 mRNA and was presented as the fold increase or decrease compared with control. Corresponding primer sequences used in the study are listed in Table 1.
Real-time PCR primer list for determination of gene expression
| Gene | Primers | Gene ID |
|---|---|---|
| Glut2 | Forward: AGCACATACGACACCAGACGC | NM_012879.2 |
| Reverse: AAGAGGGCTCCAGTCAACG | ||
| Gck | Forward: TGTGCTCCGCAGGACTAGCT | NM_012565.1 |
| Reverse: GGTGATTTCGCAGTTGGGTGT | ||
| Pdx1 | Forward: GTGCCAGAGTTCAGTGCTAATCC | NM_022852.3 |
| Reverse: GGACTTCCCTGTTCCAGCGT | ||
| Hnf1α | Forward: GGTGCCCACAGGGCTTGACT | NM_012669.1 |
| Reverse: GCCGGTGTCTACTGCTGGC | ||
| Rab27a | Forward: GAACGTAAACAGATGGCGGC | NM_017317.2 |
| Reverse: GTGGGCTGAACCACGGATAA | ||
| Snap25 | Forward: CTGGCATCAGGACTTTGGTT | NM_030991.3 |
| Reverse: ATTATTGCCCCAGGCTTTTT | ||
| Ucp2 | Forward: TGTGGTAAAGGTCCGCTTCC | NM_019354.2 |
| Reverse: TTCGGGCAACATTGGGAG | ||
| Ogdh | Forward: GTGTCGGCGCCTCACTCGG | NM_001017461.1 |
| Reverse: CAGTCTGGGAGGCTGTCAATGGC |
Statistical analysis
Results were expressed as mean±s.e.m. Statistical analysis was performed using SPSS 13.0 (SPSS, Inc., Chicago, IL, USA). Differences among groups were determined using one-way ANOVA followed by Dunnett's post hoc test, as indicated. Values with P<0.05 were considered statistically significant.
Results
Cytotoxic effects of phenolic estrogens on isolated islets
MTT assay was performed to examine the cytotoxic effect of phenolic estrogens on isolated islets from rat. After isolated islets were treated with E2, DES, NP, or OP for 24 h, cell viability was significantly decreased at doses 25 and 250 μg/l (Fig. 1A, B, C and D). However, BPA significantly attenuated cell viability at a dose of 2.5 μg/l (Fig. 1E).
Effect of phenolic estrogen pollutant administration on isolated islet viability. Islet cell viability was analyzed 1 day after islet isolation in groups of hand-picked islets by MTT. (A) E2, (B) DES, (C) OP, (D) NP, and (E) BPA. Results are expressed as mean±s.e.m. (n=5). *P<0.05 compared with control, **P<0.01 compared with control.
Citation: Journal of Endocrinology 215, 2; 10.1530/JOE-12-0219
In addition, the diameter of islets (an indicator of islet mass) was measured. As shown in Fig. 2, compared with control, the diameter of islets was significantly increased in a concentration-dependent manner after exposure to E2 or DES between 2.5 and 250 μg/l for 24 h. Similarly, the diameter of islets treated with 2.5 and 25 μg/l NP, OP, or BPA was increased. However, 250 μg/l BPA significantly decrease the diameter of islets.
Comparison between mean morphometric data measured from control and treated isolated islets. Results are expressed as mean±s.e.m. (n=5). *P<0.05 compared with control, **P<0.01 compared with control.
Citation: Journal of Endocrinology 215, 2; 10.1530/JOE-12-0219
Effects of phenolic estrogens on insulin secretion and content in isolated islets
To evaluate the effect of phenolic estrogens on β-cell function, GSIS was detected with a basal (3.0 mM) or a stimulatory (16.7 mM) concentration of glucose for 1 h (Fig. 3). In Fig. 3A, after 24-h phenolic estrogen treatment, basal insulin secretion at 3.0 mM glucose was increased by E2 (25 and 250 μg/l), DES (250 μg/l), OP (25 and 250 μg/l), NP (25 and 250 μg/l), or BPA (2.5, 25, and 250 μg/l) compared with control. When isolated islets were incubated with 16.7 mM glucose medium to mimic the increased glucose conditions in diabetes (Fig. 3B), increased insulin secretion was exhibited dose dependently after exposure to E2 and DES. However, insulin secretion showed an inverted U-shaped dose–response curve to different concentrations of BPA, NP, and OP. Particularly, insulin secretion was significantly increased by BPA treatment at a dose as low as 0.1 μg/l, while it was significantly decreased at 25 and 250 μg/l.
Effect of phenolic estrogen on insulin secretion and content in vitro. (A) Glucose-induced insulin secretion from isolated islets treated with E2, DES, OP, NP, or BPA (0, 0.1, 0.5, 2.5, 25, or 250 μg/l) for 24 h at basal 3.0 mM glucose. (B) Glucose-induced insulin secretion from isolated islets treated with E2, DES, OP, NP, or BPA (0, 0.1, 0.5, 2.5, 25, or 250 μg/l) for 24 h with 16.7 mM glucose stimulation. (C) Insulin content of islets exposed to increasing doses of E2, DES, OP, NP, or BPA (0, 0.1, 0.5, 2.5, 25, or 250 μg/l) for 24 h. Results are expressed as mean±s.e.m. (n=5). *P<0.05 compared with control, **P<0.01 compared with control.
Citation: Journal of Endocrinology 215, 2; 10.1530/JOE-12-0219
To investigate whether insulin secretion was changed by phenolic estrogen because of changed insulin stores, insulin content was determined after isolated islets were cultured in the presence of 11 mM glucose and increasing concentrations of E2 or phenolic estrogens. As shown in Fig. 3C, E2 and phenolic estrogen increased pancreatic insulin content in a non-monotonic trend. Insulin content was significantly increased in β-cells treated with E2 (0.5–250 μg/l), DES (2.5 and 25 μg/l), OP (2.5 μg/l), NP (2.5 μg/l), or BPA (0.5 and 2.5 μg/l). However, 250 μg/l BPA, NP, or OP treatment significantly decreased insulin content.
Effects of phenolic estrogens on β-cell morphology and mitochondrial function in isolated islets
Effects of phenolic estrogens' exposure on ultrastructural alterations on β-cells were observed using a TEM. As shown in Fig. 4A, B, C, D, E, F and G, all the tested estrogen treatments (25 μg/l) reduced the proportion of filled insulin granule in β-cells compared with control. Additionally, E2 or DES exposure significantly increased the proportion of immature granules. Although no difference was displayed in the proportion of immature granules in islets after treated with OP, NP, or BPA, a significant increase in the proportion of empty granules compared with control was observed.
Morphological analysis of β-cells in isolated islets. Representative electron microscopy photomicrographs of control (A), E2-exposed β-cells (B), DES-exposed β-cells (C), OP-exposed β-cells (D), NP-exposed β-cells (E), and BPA-exposed β-cells (F) at a dose of 25 μg/l illustrated the typical insulin granules and mitochondrial pattern. N, nucleus; Gr, secrete granulation. Swollen mitochondria are indicated by black boxes. Black arrows show immature secretory granules and black arrowheads show empty granules. Photographs were taken at 13 500× magnification. Mitochondria were quantified within the β-cells and presented as the average mitochondrial area (H) and the average mitochondrial optical density (I). Higher optical density values (a measure of brightness) was an indication of organelle swelling. (G) Manual quantifications of the percentage of total number of granules (filled, immature, and empty). (J) Complex IV enzyme activity (an indicator of mitochondrial electron transport chain function). (K) ATP content. Results are expressed as mean±s.e.m. *P<0.05 compared with control, **P<0.01 compared with control.
Citation: Journal of Endocrinology 215, 2; 10.1530/JOE-12-0219
Ultrastructure abnormalities in mitochondrial morphology were also observed in β-cells treated with 25 μg/l E2 or phenolic estrogens. For E2- or DES-treated β-cells, mitochondria were mildly enlarged but maintained almost normal cristae structure (Fig. 4B and C). Further quantitative analysis revealed that there was no significant difference in density of mitochondria among control, E2-, and DES-treated β-cells (Fig. 4H and I). The mitochondria in β-cells treated with NP, OP, or BPA were remarkably swollen and most of the mitochondria in β-cells exhibited loss of structural integrity with abnormal cristae relative to control (Fig. 4D, E and F). The average area and optical density of the mitochondria in NP-, OP-, or BPA-treated β-cells were significantly higher than those of control (Fig. 4H and I).
Pancreatic complex IV mitochondrial respiratory chain enzyme (COX) activity, an indicator of mitochondrial function, was significantly decreased in 25 μg/l NP-, OP-, and BPA-treated islets relative to control (Fig. 4J), but that did not differ among control, E2, and DES groups. In addition, NP-, OP-, or BPA-treated islets had lower cytosolic ATP level than control (Fig. 4K).
Effects of phenolic estrogens on mRNA levels of genes involved in β-cell function
To investigate the possible mechanisms leading to defects in β-cells, mRNA expression levels of genes playing a key role in β-cell function were measured by quantitative real-time PCR. As shown in Fig. 5, exposure to 25 μg/l E2 or phenolic estrogens for 24 h significantly decreased mRNA expression of glucose transporter 2 (Glut2 (Slc2a2)), glycolytic enzyme glucokinase (Gck), insulin promoter factor 1 (Pdx1), and hepatocyte nuclear factor 1α (Hnf1α). A significant increase in mRNA levels of Rab27a was observed in E2- or DES-treated islets, and the mRNA levels of synaptosome-associated protein of 25 kDa (Snap25) was downregulated by BPA, NP, or OP treatment.
Comparison of the mRNA levels of islet-associated transcription factor and β-cell function in isolated islets after exposed to E2, DES, OP, NP, or BPA at 25 μg/l. Results are expressed as mean±s.e.m. determined of five replicates. The mRNA levels were compared by real-time PCR. Each gene was normalized to the 36B4 internal control and gene expression values were normalized to control islet values. *P<0.05 compared with control, **P<0.01 compared with control.
Citation: Journal of Endocrinology 215, 2; 10.1530/JOE-12-0219
An increase in the mRNA expression of uncoupling protein 2 (Ucp2), a gene that participates in mitochondrial biogenesis, was found by 25 μg/l BPA, NP, or OP treatment. The mRNA expression of 2-oxoglutarate dehydrogenase (Ogdh), another gene associated with mitochondrial function, was reduced in BPA-, NP-, or OP-treated islets. But the mRNA levels of both Ucp2 and Ogdh in isolated islets were unchanged after 25 μg/l E2 or DES treatment for 24 h.
Discussion
In this study, we have demonstrated that the phenolic estrogens impaired islet morphology and disrupted insulin secretion in isolated rat pancreatic islets, and OP, NP, or BPA (25 μg/l) induced remarkable swelling of mitochondria in β-cells, which was accompanied by disruption of mRNA expression of genes playing a key role in β-cell function and mitochondrial function.
To examine the cytotoxic effects of E2 and the phenolic estrogens on β-cells, 0.1, 0.5, and 2.5 μg/l were chosen as lower doses to mimic the real levels of human exposure to environmental estrogen (Vandenberg et al. 2010, Asimakopoulos et al. 2011). From the MTT results, the viability of β-cells was decreased with increasing chemical concentration. E2, DES, OP, and NP decreased β-cell viability significantly at doses of 25 and 250 μg/l. However, BPA significantly attenuated cell viability from the dose of 2.5 μg/l, which is similar to a previous study demonstrating that 10 μg/l BPA exposure can affect the viability of β-cells (Adachi et al. 2005).
Estrogen administration in rodents can induce islet hypertrophy, which may be crucial in the development of diabetes (Rosmalen et al. 2001). In this study, the diameter of islets was increased in a concentration-dependent manner after exposure to E2 or the phenolic estrogen chemicals. While it was decreased by 250 μg/l OP, NP, or BPA treatment, which may be explained by remarkably cytotoxic effects on β-cells at such high dose.
Next, we examined insulin secretion and content in β-cells following exposure to E2 or phenolic estrogens. At 16.7 mM glucose, E2 and the phenolic estrogens were demonstrated to result in a greater change of insulin response than that at the basal glucose concentration. These data are consistent with a previous report that exposure to BPA or NP for 24 h significantly changes insulin secretion in isolated rat islets with 16.7 mM glucose stimulation (Adachi et al. 2005). For BPA, NP, and OP with lower estrogen activity, the relationship between the doses and insulin secretion was an inverted U-shape, namely increased at first and then declined. E2 and phenolic estrogen below 2.5 μg/l increased insulin secretion along with increased insulin content in the experiments. These results are consistent with the concept that increased insulin secretion in response to stimulatory glucose in phenolic-treated islets may be a consequence of their higher insulin content (Alonso-Magdalena et al. 2008). But the disruption of insulin secretion by phenolic estrogen can be partly explained by the change of insulin content, as insulin content presented a tendency of decrease after the islets were treated with 25 μg/l BPA, NP, or OP. In the past decades, EDCs have been recognized to exhibit a lack of linear dose-dependent relationship with endocrine abnormalities, showing instead inverted U-shaped curves (Alonso-Magdalena et al. 2011). In a recent report from Wei et al. (2011), perinatal exposure to BPA (50 μg/kg per day) induces hyperinsulinemia and impaired glucose regulation in SD rat offspring. Interestingly, the effects are not observed at higher doses. These reports and our results in this study propose a non-monotonic dose response that low dose exposure of some EDCs might be more effective on altering β-cell function. But there is no ready explanation for this phenomenon, suggesting the existence of two independent mechanisms for low doses and high doses (vom Saal et al. 2007).
Note that BPA, with the lowest estrogenic activity in the four phenolic estrogens, was able to significantly increase insulin release at a dose as low as 0.1 μg/l with 16.7 mM glucose stimulation, which means that BPA would affect insulin secretion within the environmental concentration range. These data suggest that BPA has more effect on disrupting insulin secretion and content in isolated β-cells than those with higher estrogenic activity, which also indicates that the ability of the phenolic estrogens to disrupt insulin secretion is not positively correlated with their estrogenic activity.
E2 or phenolic estrogen treatment induced downregulation of key genes important for β-cell function in β-cells, such as Glut2, Gck, Pdx1, and Hnf1α. Glucose is the predominant regulator of insulin secretion and biosynthesis. In pancreatic β-cells, glucose enters the cell through GLUT2 transporter phosphorylated by GCK, and then glucose is metabolized to generate ATP, which promotes insulin secretion. Therefore, the reduction in mRNA levels of Gck and Glut2 induced by E2 or phenolic estrogen treatment partly contributes to the impaired insulin secretion to glucose in isolated islets, and the mRNA levels of Glut2 and Gck might be downregulated by the decreased expression levels of Pdx1 and Hnf1α in phenolic estrogen-treated islets. Pdx1 is considered as a β-cell master regulator gene, which plays a critical role in the maintenance of mature β-cell function (Chakrabarti & Mirmira 2003). Downregulation of Pdx1 would inhibit Glut2 transcription and Gck promoter activity in β-cells (Waeber et al. 1996, Lee et al. 2009), finally leading to β-cell dysfunction. Hnf1α is also required for Glut2 transcription; the expression pattern of Glut2 is quite similar to that of Hnf1α (Boj et al. 2001, Shih et al. 2001). Also, Pdx1 and Hnf1α regulate expression of the insulin gene and other components of the GSIS pathway (Shih et al. 2001, Chakrabarti & Mirmira 2003), so Pdx1 and Hnf1α deficiency would lead to reduced insulin content and impaired insulin secretion. Moreover, Rab27a and Snap25 are necessary plasma membrane factors that mediate glucose signals for the exocytosis of insulin granules in pancreatic β-cells (Takahashi et al. 2004, Kasai et al. 2005). The change in mRNA levels of Rab27a and Snap25 induced by phenolic estrogen treatment are partly responsible for the change of secretory granules in β-cells and the impaired insulin release. But how the phenolic estrogens affect the process of insulin secretory granules is unclear and remains to be demonstrated.
Mitochondria are critical for the regulation of β-cell mass and maintenance of β-cell function through the coupling of glucose stimulus to insulin release (Lowell & Shulman 2005, MacDonald et al. 2005, Maechler & de Andrade 2006). Mitochondrial dysfunction has been implicated as a key factor in the development of type 2 diabetes (Lu et al. 2010). In our study, the ultrastructure of β-cells was observed with abnormal alteration after exposure to E2 or phenolic estrogens (25 μg/l), characterized by swollen mitochondria and a modest deregulation in β-cells. Particularly, administration of OP, NP, or BPA induced remarkable swelling of mitochondria with loss of distinct cristae structure within the membrane, offering an explanation for the blunted insulin secretion stimulated by 16.7 mM glucose in BPA, as well as NP- and OP-treated islets. So mitochondrial swelling is suggested to be a key initiating event in the mitochondrial mediated defects in GSIS.
In addition, BPA, NP, and OP significantly decreased COX activity in isolated rat islets, indicating that mitochondrial respiratory enzyme function had been damaged. As the enzymes in the electron transport chain are located in the inner membrane of the mitochondria, they would be affected by impaired mitochondrial structure (Bruin et al. 2010). COX is the last enzyme in the respiratory electron transport chain of mitochondria, helping to establish a transmembrane difference of proton electrochemical potential to synthesize ATP, so decreased COX activity may cause defects in glucose-stimulated ATP production. Consistent with COX activity reduction, cellular ATP content was reduced in islets treated with 25 μg/l NP, OP, or BPA relative to control. Thus, estrogen pollutants differentially affect mitochondrial function, resulting in defective insulin secretion.
To further study whether phenolic estrogen treatment impairs the mRNA expression of genes that are critical for mitochondrial function, we measured mRNA levels of typical mitochondrial genes, including Ogdh and Ucp2. Data from this study demonstrated that BPA, NP, or OP exposure (25 μg/l) resulted in reduced mRNA expression of Ogdh and increased mRNA expression of Ucp2 in isolated islets. Ogdh constitutes the rate-limiting enzyme in the mitochondria tricarboxylic acid cycle, so the reduction in Ogdh mRNA expression may be partially responsible for defective mitochondrial function and consequently impaired insulin secretory responses to glucose induced by BPA, NP, and OP treatment. UCP2 has been shown to promote proton leakage across the mitochondrial membrane (Rial et al. 1999) and play a critical role in insulin resistance, glucose utilization, and the regulation of reactive oxygen species (Arsenijevic et al. 2000). Overexpression of UCP2 could reduce the efficiency of mitochondrial ATP generation and inhibit GSIS in cultured β-cell lines (Chan et al. 1999, 2001). So we suggest that increased mRNA expression of Ucp2 in islets treated with BPA, NP, or OP induces mitochondrial dysfunction and thereby limits β-cell function in response to hyperglycemia.
But interestingly, E2 and DES (25 μg/l) treatment of islets in vitro did not significantly affect mitochondrial structure and function of β-cells in this study. The mRNA levels of Ogdh and Ucp2 were also comparable among E2-, DES-, and control-treated islets. DES, with higher estrogen activity, impairs islet morphology and β-cell function in a similar way as E2. As a result, we propose E2 and DES impair β-cell function through different mechanisms, and the detailed mechanisms remain to be elucidated in further studies.
In conclusion, data in this study show that low-level exposure to DES, OP, NP, or BPA impairs islet morphology and β-cell function in isolated rat islets. BPA with the lowest estrogenic activity among the four phenolic estrogens can disrupt insulin secretion in isolated β-cells at a dose as low as 0.1 μg/l, and β-cell dysfunction induced by OP, NP, or BPA is correlated with mitochondrial dysfunction. Mitochondrial swelling induced by OP, NP, or BPA is suggested to be a key initiating event for defects in GSIS.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the National Program on Key Basic Research Project of China (973 Program; 2012CB722401), the National Natural Science Foundation of China (81030051, 21177046), the R&D Special Fund for Public Welfare Industry (Environment; 200909102), the National Basic Research Development Program of China (2008CB418206), the Doctoral Fund of Ministry of Education of China (20080487087), and the Fundamental Research Funds for the Central Universities, HUST (2012QN240, 2012TS072).
Acknowledgements
All authors are grateful to Yang Guan, Zebin Zhou, and Bing Liu for helping to perform TEM inspections.
References
Adachi T, Yasuda K, Mori C, Yoshinaga M, Aoki N, Tsujimoto G & Tsuda K 2005 Promoting insulin secretion in pancreatic islets by means of bisphenol A and nonylphenol via intracellular estrogen receptors. Food and Chemical Toxicology 43 713–719. (doi:10.1016/j.fct.2005.01.009)
Alonso-Magdalena P, Morimoto S, Ripoll C, Fuentes E & Nadal A 2006 The estrogenic effect of bisphenol A disrupts pancreatic β-cell function in vivo and induces insulin resistance. Environmental Health Perspectives 114 106–112. (doi:10.1289/ehp.8451)
Alonso-Magdalena P, Ropero AB, Carrera MP, Cederroth CR, Baquie M, Gauthier BR, Nef S, Stefani E & Nadal A 2008 Pancreatic insulin content regulation by the estrogen receptor ERα. PLoS ONE 3 e2069. (doi:10.1371/journal.pone.0002069)
Alonso-Magdalena P, Ropero AB, Soriano S, Quesada I & Nadal A 2010 Bisphenol-A: a new diabetogenic factor? Hormones 9 118–126.
Alonso-Magdalena P, Quesada I & Nadal A 2011 Endocrine disruptors in the etiology of type 2 diabetes mellitus. Nature Reviews. Endocrinology 7 346–353. (doi:10.1038/nrendo.2011.56)
Arsenijevic D, Onuma H, Pecqueur C, Raimbault S, Manning BS, Miroux B, Couplan E, Alves-Guerra MC, Goubern M & Surwit R et al. 2000 Disruption of the uncoupling protein-2 gene in mice reveals a role in immunity and reactive oxygen species production. Nature Genetics 26 435–439. (doi:10.1038/82565)
Asimakopoulos AG, Thomaidis NS & Koupparis MA 2011 Recent trends in biomonitoring of bisphenol A, 4-t-octylphenol, and 4-nonylphenol. Toxicology Letters 210 141–154. (doi:10.1016/j.toxlet.2011.07.032)
Boj SF, Parrizas M, Maestro MA & Ferrer J 2001 A transcription factor regulatory circuit in differentiated pancreatic cells. PNAS 98 14481–14486. (doi:10.1073/pnas.241349398)
Bruin JE, Petrik JJ, Hyslop JR, Raha S, Tarnopolsky MA, Gerstein HC & Holloway AC 2010 Rosiglitazone improves pancreatic mitochondrial function in an animal model of dysglycemia: role of the insulin-like growth factor axis. Endocrine 37 303–311. (doi:10.1007/s12020-009-9294-8)
Carpenter DO 2008 Environmental contaminants as risk factors for developing diabetes. Reviews on Environmental Health 23 59–74. (doi:10.1515/REVEH.2008.23.1.59)
Carter JD, Dula SB, Corbin KL, Wu R & Nunemaker CS 2009 A practical guide to rodent islet isolation and assessment. Biological Procedures Online 11 3–31. (doi:10.1007/s12575-009-9021-0)
Casals-Casas C & Desvergne B 2011 Endocrine disruptors: from endocrine to metabolic disruption. Annual Review of Physiology 73 135–162. (doi:10.1146/annurev-physiol-012110-142200)
Chakrabarti SK & Mirmira RG 2003 Transcription factors direct the development and function of pancreatic β cells. Trends in Endocrinology and Metabolism 14 78–84. (doi:10.1016/S1043-2760(02)00039-5)
Chan CB, MacDonald PE, Saleh MC, Johns DC, Marban E & Wheeler MB 1999 Overexpression of uncoupling protein 2 inhibits glucose-stimulated insulin secretion from rat islets. Diabetes 48 1482–1486. (doi:10.2337/diabetes.48.7.1482)
Chan CB, De Leo D, Joseph JW, McQuaid TS, Ha XF, Xu F, Tsushima RG, Pennefather PS, Salapatek AM & Wheeler MB 2001 Increased uncoupling protein-2 levels in β-cells are associated with impaired glucose-stimulated insulin secretion: mechanism of action. Diabetes 50 1302–1310. (doi:10.2337/diabetes.50.6.1302)
Cherif H, Reusens B, Ahn MT, Hoet JJ & Remacle C 1998 Effects of taurine on the insulin secretion of rat fetal islets from dams fed a low-protein diet. Journal of Endocrinology 159 341–348. (doi:10.1677/joe.0.1590341)
Cranmer M, Louie S, Kennedy RH, Kern PA & Fonseca VA 2000 Exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is associated with hyperinsulinemia and insulin resistance. Toxicological Sciences 56 431–436. (doi:10.1093/toxsci/56.2.431)
Diamanti-Kandarakis E, Bourguignon JP, Giudice LC, Hauser R, Prins GS, Soto AM, Zoeller RT & Gore AC 2009 Endocrine-disrupting chemicals: an Endocrine Society scientific statement. Endocrine Reviews 30 293–342. (doi:10.1210/er.2009-0002)
Godsland IF 2005 Oestrogens and insulin secretion. Diabetologia 48 2213–2220. (doi:10.1007/s00125-005-1930-0)
Hectors TL, Vanparys C, van der Ven K, Martens GA, Jorens PG, Van Gaal LF, Covaci A, De Coen W & Blust R 2011 Environmental pollutants and type 2 diabetes: a review of mechanisms that can disrupt β cell function. Diabetologia 54 1273–1290. (doi:10.1007/s00125-011-2109-5)
Kasai K, Ohara-Imaizumi M, Takahashi N, Mizutani S, Zhao S, Kikuta T, Kasai H, Nagamatsu S, Gomi H & Izumi T 2005 Rab27a mediates the tight docking of insulin granules onto the plasma membrane during glucose stimulation. Journal of Clinical Investigation 115 388–396. (doi:10.1172/JCI200522955)
Lee JW, Kim WH, Lim JH, Song EH, Song J, Choi KY & Jung MH 2009 Mitochondrial dysfunction: glucokinase downregulation lowers interaction of glucokinase with mitochondria, resulting in apoptosis of pancreatic β-cells. Cellular Signalling 21 69–78. (doi:10.1016/j.cellsig.2008.09.015)
Li DS, Yuan YH, Tu HJ, Liang QL & Dai LJ 2009 A protocol for islet isolation from mouse pancreas. Nature Protocols 4 1649–1652. (doi:10.1038/nprot.2009.150)
Lin Y, Shi Y, Jiang M, Jin Y, Peng Y, Lu B & Dai K 2008 Removal of phenolic estrogen pollutants from different sources of water using molecularly imprinted polymeric microspheres. Environmental Pollution 153 483–491. (doi:10.1016/j.envpol.2007.08.001)
Lin Y, Wei J, Li Y, Chen J, Zhou Z, Song L, Wei Z, Lv Z, Chen X & Xia W et al. 2011 Developmental exposure to di(2-ethylhexyl) phthalate impairs endocrine pancreas and leads to long-term adverse effects on glucose homeostasis in the rat. American Journal of Physiology. Endocrinology and Metabolism 301 E527–E538. (doi:10.1152/ajpendo.00233.2011)
Lowell BB & Shulman GI 2005 Mitochondrial dysfunction and type 2 diabetes. Science 307 384–387. (doi:10.1126/science.1104343)
Lu H, Koshkin V, Allister EM, Gyulkhandanyan AV & Wheeler MB 2010 Molecular and metabolic evidence for mitochondrial defects associated with β-cell dysfunction in a mouse model of type 2 diabetes. Diabetes 59 448–459. (doi:10.2337/db09-0129)
MacDonald PE, Joseph JW & Rorsman P 2005 Glucose-sensing mechanisms in pancreatic β-cells. Philosophical Transactions of the Royal Society of London. Series B, Biological sciences 360 2211–2225. (doi:10.1098/rstb.2005.1762)
Maechler P & de Andrade PB 2006 Mitochondrial damages and the regulation of insulin secretion. Biochemical Society Transactions 34 824–827. (doi:10.1042/BST0340824)
Makaji E, Raha S, Wade MG & Holloway AC 2011 Effect of environmental contaminants on β cell function. International Journal of Toxicology 30 410–418. (doi:10.1177/1091581811405544)
Margolis KL, Bonds DE, Rodabough RJ, Tinker L, Phillips LS, Allen C, Bassford T, Burke G, Torrens J & Howard BV 2004 Effect of oestrogen plus progestin on the incidence of diabetes in postmenopausal women: results from the Women's Health Initiative Hormone Trial. Diabetologia 47 1175–1187. (doi:10.1007/s00125-004-1448-x)
Nakada N, Nyunoya H, Nakamura M, Hara A, Iguchi T & Takada H 2004 Identification of estrogenic compounds in wastewater effluent. Environmental Toxicology and Chemistry 23 2807–2815. (doi:10.1897/03-699.1)
Newbold RR 2004 Lessons learned from perinatal exposure to diethylstilbestrol. Toxicology and Applied Pharmacology 199 142–150. (doi:10.1016/j.taap.2003.11.033)
Nguyen KH, Lee JH & Nyomba BL 2012 Ethanol causes endoplasmic reticulum stress and impairment of insulin secretion in pancreatic β-cells. Alcohol 46 89–99. (doi:10.1016/j.alcohol.2011.04.001)
Rial E, Gonzalez-Barroso M, Fleury C, Iturrizaga S, Sanchis D, Jimenez-Jimenez J, Ricquier D, Goubern M & Bouillaud F 1999 Retinoids activate proton transport by the uncoupling proteins UCP1 and UCP2. EMBO Journal 18 5827–5833. (doi:10.1093/emboj/18.21.5827)
Rosmalen JG, Pigmans MJ, Kersseboom R, Drexhage HA, Leenen PJ & Homo-Delarche F 2001 Sex steroids influence pancreatic islet hypertrophy and subsequent autoimmune infiltration in nonobese diabetic (NOD) and NODscid mice. Laboratory Investigation 81 231–239. (doi:10.1038/labinvest.3780231)
vom Saal FS, Akingbemi BT, Belcher SM, Birnbaum LS, Crain DA, Eriksen M, Farabollini F, Guillette LJ Jr, Hauser R & Heindel JJ et al. 2007 Chapel Hill bisphenol A expert panel consensus statement: integration of mechanisms, effects in animals and potential to impact human health at current levels of exposure. Reproductive Toxicology 24 131–138. (doi:10.1016/j.reprotox.2007.07.005)
Shih DQ, Screenan S, Munoz KN, Philipson L, Pontoglio M, Yaniv M, Polonsky KS & Stoffel M 2001 Loss of HNF-1α function in mice leads to abnormal expression of genes involved in pancreatic islet development and metabolism. Diabetes 50 2472–2480. (doi:10.2337/diabetes.50.11.2472)
Takahashi N, Hatakeyama H, Okado H, Miwa A, Kishimoto T, Kojima T, Abe T & Kasai H 2004 Sequential exocytosis of insulin granules is associated with redistribution of SNAP25. Journal of Cell Biology 165 255–262. (doi:10.1083/jcb.200312033)
Tapiero H, Ba GN & Tew KD 2002 Estrogens and environmental estrogens. Biomedicine & Pharmacotherapy 56 36–44. (doi:10.1016/S0753-3322(01)00155-X)
Vandenberg LN, Chahoud I, Heindel JJ, Padmanabhan V, Paumgartten FJ & Schoenfelder G 2010 Urinary, circulating, and tissue biomonitoring studies indicate widespread exposure to bisphenol A. Environmental Health Perspectives 118 1055–1070. (doi:10.1289/ehp.0901716)
Waeber G, Thompson N, Nicod P & Bonny C 1996 Transcriptional activation of the GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor. Molecular Endocrinology 10 1327–1334. (doi:10.1210/me.10.11.1327)
Wei J, Lin Y, Li Y, Ying C, Chen J, Song L, Zhou Z, Lv Z, Xia W & Chen X et al. 2011 Perinatal exposure to bisphenol A at reference dose predisposes offspring to metabolic syndrome in adult rats on a high-fat diet. Endocrinology 152 3049–3061. (doi:10.1210/en.2011-0045)
Wozniak AL, Bulayeva NN & Watson CS 2005 Xenoestrogens at picomolar to nanomolar concentrations trigger membrane estrogen receptor-α-mediated Ca2+ fluxes and prolactin release in GH3/B6 pituitary tumor cells. Environmental Health Perspectives 113 431–439. (doi:10.1289/ehp.7505)
Zhang Y, Howard BV, Cowan LD, Yeh J, Schaefer CF, Wild RA, Wang W & Lee ET 2002 The effect of estrogen use on levels of glucose and insulin and the risk of type 2 diabetes in American Indian postmenopausal women: the strong heart study. Diabetes Care 25 500–504. (doi:10.2337/diacare.25.3.500)
(L Song and W Xia contributed equally to this work)
