GH improves spatial memory and reverses certain anabolic androgenic steroid-induced effects in intact rats

in Journal of Endocrinology

GH has previously been shown to promote cognitive functions in GH-deficient rodents. In this study we report the effects of GH on learning and memory in intact rats pretreated with the anabolic androgenic steroid nandrolone. Male Wistar rats received nandrolone decanoate (15 mg/kg) or peanut oil every third day for 3 weeks and were subsequently treated with recombinant human GH (1.0 IU/kg) or saline for 10 consecutive days. During the GH/saline treatment spatial learning and memory were tested in the Morris water maze (MWM). Also, plasma levels of IGF1 were assessed and the gene expression of the GH receptors (Ghr), Igf1 and Igf2, in hippocampus and frontal cortex was analyzed. The results demonstrated a significant positive effect of GH on memory functions and increased gene expression of Igf1 in the hippocampus was found in the animals treated with GH. In addition, GH was demonstrated to increase the body weight gain and was able to attenuate the reduced body weight seen in nandrolone-treated animals. In general, the rats treated with nandrolone alone did not exhibit any pronounced alteration in memory compared with controls in the MWM, and in many cases GH did not induce any alteration. Regarding target zone crossings, considered to be associated with spatial memory, the difference between GH- and steroid-treated animals was significant and administration of GH improved this parameter in the latter group. In conclusion, GH improves spatial memory in intact rats and can reverse certain effects induced by anabolic androgenic steroid.

Abstract

GH has previously been shown to promote cognitive functions in GH-deficient rodents. In this study we report the effects of GH on learning and memory in intact rats pretreated with the anabolic androgenic steroid nandrolone. Male Wistar rats received nandrolone decanoate (15 mg/kg) or peanut oil every third day for 3 weeks and were subsequently treated with recombinant human GH (1.0 IU/kg) or saline for 10 consecutive days. During the GH/saline treatment spatial learning and memory were tested in the Morris water maze (MWM). Also, plasma levels of IGF1 were assessed and the gene expression of the GH receptors (Ghr), Igf1 and Igf2, in hippocampus and frontal cortex was analyzed. The results demonstrated a significant positive effect of GH on memory functions and increased gene expression of Igf1 in the hippocampus was found in the animals treated with GH. In addition, GH was demonstrated to increase the body weight gain and was able to attenuate the reduced body weight seen in nandrolone-treated animals. In general, the rats treated with nandrolone alone did not exhibit any pronounced alteration in memory compared with controls in the MWM, and in many cases GH did not induce any alteration. Regarding target zone crossings, considered to be associated with spatial memory, the difference between GH- and steroid-treated animals was significant and administration of GH improved this parameter in the latter group. In conclusion, GH improves spatial memory in intact rats and can reverse certain effects induced by anabolic androgenic steroid.

Introduction

GH is a polypeptide produced in somatotrophs of the anterior pituitary. Over the past decades, the effects that GH and its mediator insulin-like growth factor 1 (IGF1) may exert on functions related to the CNS have received attention among many investigators (for review, see Nyberg (2000)). In particular, the effects of GH on cognitive functions have attracted attention (Maruff & Falleti 2005). Replacement therapy with recombinant human GH (rhGH) in patients suffering from GH deficiency (GHD) has been demonstrated to attenuate cognitive deficits and improve memory (Deijen et al. 1996, Falleti et al. 2006). In addition, GH replacement has been found to improve the overall quality of life in GHD patients (Burman et al. 1995). Recently, another mediator of GH effects, IGF2, has been implicated in memory functions (Chen et al. 2011). In addition, GH was shown to counteract apoptosis induced by morphine treatment in cells derived from the mouse hippocampus (Svensson et al. 2008) and studies have further demonstrated that the hormone may promote neuroprotection (Nyberg & Sharma 2002, Aberg et al. 2006). Impairments of spatial learning and memory have also been seen in GH-deficient spontaneous dwarf rats (Li et al. 2011a), and in a model with hypoxia GH was able to attenuate deficits in spatial learning (Li et al. 2011b). We have recently demonstrated that GH may improve spatial performance in hypophysectomized rats using the Morris water maze (MWM; Le Grevès et al. 2006) as well as the radial arm maze (Le Grevès et al. 2011). Thus, it seems like GH may be able to improve learning and memory and counteract drug-induced cognitive deficiencies (Nyberg 2009).

Anabolic androgenic steroids (AASs), synthetic derivatives of testosterone, are known to induce profound effects in different peripheral organs as well as in a variety of regions in the CNS. A large number of studies have reported significant effects of AASs on CNS-related behaviors, such as aggression, anxiety, depression, and impaired cognitive functions (Su et al. 1993, Steensland et al. 2005, Hallberg 2011). In an animal model, treatment with supraphysiological doses of nandrolone decanoate was recently demonstrated to impair spatial memory in certain parameters of the MWM (Magnusson et al. 2009). On the contrary, Schneider-Rivas et al. (2007) demonstrated that the male steroid testosterone and GH administered alone or in combination improved long-term memory in young rats. A link between the GH/IGF1 axis and AAS-induced mechanisms has been discovered (Weissberger & Ho 1993, Veldhuis et al. 1997). For example a reduction of IGF1 in plasma has been reported after 24 months of AAS use (Bonetti et al. 2008) On the contrary, some studies have also reported testosterone to stimulate the production of IGF1 (Hobbs et al. 1993). Short-term treatment with testosterone has also been shown to inhibit GH release when stimulated with a GH secretagogue in dogs (Rigamonti et al. 2006), and in humans testosterone was shown to lower IGF1 bioavailability (Veldhuis et al. 2005). Interestingly, a recent study revealed that almost half of individuals abusing steroids combined these agents with GH (Skarberg et al. 2009). Fewer details are known of the association between GH and AAS in the CNS and on behavior, but it has been suggested that an interaction between testosterone and GH plays an important role in the modulation of memory (Schneider-Rivas et al. 2007). Hence, it would be of value to know if the steroid-induced impairment of cognitive function observed in man after AAS abuse could possibly be modified by administration of GH.

The aim of this study was to address this issue and to examine the impact of rhGH on learning and memory in male rats and to investigate the effects of this hormone on cognition in rats pretreated with supraphysiological doses of AAS. In addition, the effects on gene expression in hippocampus and frontal cortex as well as weight parameters were investigated.

Materials and methods

Animal experiment

Forty-eight male Wistar rats of an age of 8 weeks were obtained from Taconic Farms (Ejeby, Denmark) and allowed to adapt to the new environment for 2 weeks. The animals, with a body weight of 316±3 g at the start of the experiment, were housed together (three in each cage) in an air-conditioned room with controlled temperature (22–24 °C) and humidity (50–60%). They had free access to water and food and were kept under a reversed 12 h light:12 h darkness cycle with lights off at 0700 h. During the experiment rats were subjected to s.c. injections with nandrolone decanoate (Deca-Durabol, Organon, Oss, The Netherlands), 15 mg/kg, or peanut oil (Apoteket AB, Umeå, Sweden) every third day for 3 weeks (at 1600 h), from days 1 to 21. Following completed treatment with nandrolone decanoate or peanut oil, rats were injected s.c. with 1 IU/kg rhGH (Amersham) or saline for 10 consecutive days, days 22–31 of the experiment (see Table 1 and Fig. 1). The AAS nandrolone decanoate is a prodrug with an estimated half-life of at least 5 days (van der Vies 1985, Minto et al. 1997). The repeated injections will result in a depot effect with duration several weeks after the last administration (Minto et al. 1997). This means that the AAS-treated rats will have high concentrations of the steroid during GH treatment (including the water maze testing) and that the combined effects of the AAS and rhGH will be observed in the AAS+GH-treated animals. All rats were weighed eight times during the experiment. The animal experimental procedures followed the guidelines of the Swedish legislation on animal experimentation and were performed according to the protocol approved by the Uppsala Animal Care and Ethical Committee.

Table 1

Outline of the four treatment groups. Nandrolone decanoate/peanut oil was administered s.c. every third day for 3 weeks and GH/saline for 10 consecutive days

Treatment groupDays 1–21Days 22–31
ControlsPeanut oilSaline
GHPeanut oilrhGH, 1 IU/kg
AASNandrolone decanoate, 15 mg/kgSaline
AAS+GHNandrolone decanoate, 15 mg/kgrhGH, 1 IU/kg
Figure 1
Figure 1

Timeline of the procedures in this experiment. The rats were treated with nandrolone decanoate (an AAS) or saline every third day from days 1 to 21. From day 22 the rats were treated with rhGH or saline for 10 consecutive days. D, decapitation.

Citation: Journal of Endocrinology 216, 1; 10.1530/JOE-12-0315

Water maze

To study the effects of the hormone treatment on spatial learning and memory the rats were tested in the MWM, a commonly used procedure for the assessments of the ability of rodents to learn the spatial location of a hidden platform in a pool filled with water. The MWM protocol was adapted from Karlsson et al. (2011) and consisted of a black large circular pool with a diameter of 160 cm. The pool was filled with tap water, thermostatically controlled at 22±1 °C. The pool was divided into four different quadrants with a hidden platform submerged 1.5 cm underneath the water surface, placed in the southwest (target) quadrant. The pool was located in an experimental room with several cues and the location of the platform remained constant over the days of acquisition. The rats were started facing the pool wall and the starting position was randomized between the quadrants. The rats were allowed five acquisition trials during 5 consecutive days with four trials each day and were allowed to search for the platform for a maximum of 90 s. If the rat did not find the platform in 90 s, the experimenter gently guided it there. Before the start of the next trial the rats were allowed to stay at the platform for 30 s. Parameters such as escape latency, latency to target quadrant, swim distance, swim length and thigmotaxic swimming were recorded. The probe trial was performed 72 h after the last acquisition trial, as a single trial where the rats were allowed to swim for 90 s without the platform. The animals were started in the northeast quadrant. Latency in the first crossing of the former platform location (target zone), number of crossings of the target zone and the number and duration of visits to the different quadrants were analyzed in addition to the parameters scored in the acquisition trials. Also, the number of target zone crossings (TZCs) during the first 30 s of the probe trial was recorded.

RNA extraction and cDNA synthesis

Following the probe trial, the rats were decapitated and whole brains were removed and dissected using a rat brain matrix. All collected tissues were immediately frozen on dry ice and then stored at −80 °C until further analysis. RNA was extracted from hippocampus and frontal cortex using Qiagen's RNeasy Lipid Tissue Mini Kit (Qiagen) according to the manufacturer's protocol. Briefly, 1000 μl Qiazol tissue lyzer (Qiagen) was added to the frozen tissue sample and the samples were then quickly homogenized. Two hundred microliters of chloroform were added and the samples were then centrifuged at 4 °C (12 000 g, 15 min). A 1:1 volume of 70% ethanol was added to the supernatant and the samples were then eluted using Mini Spin columns. The RNA concentration was quantified using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA). The quality of the RNA was examined using the Xperion System for RNA analysis (Bio-Rad Laboratories, Solna, Sweden) and samples demonstrating clear 18S and 28S rRNA and RNA quality indicator between seven and ten were used for further analysis. cDNA synthesis was conducted using the High Capacity cDNA RT Archive kit (Applied Biosystems). The reactions were performed in a final volume of 100 μl, including 250 ng of RNA, MultiScribe reverse transcriptase 50 U/μl, RT buffer, dNTP mixture, RT random primers and RNase-free water. The cycling parameters used were 25 °C for 10 min, 37 °C for 120 min and 85 °C for 5 min. A control reaction without reversed transcriptase was also performed.

Quantitative real-time PCR

The gene expression was analyzed with quantitative real-time PCR (qPCR) in 96-well plates with 2 μl cDNA (5 ng) and 23 μl master mix containing iQ SYBR Green Supermix (Bio-Rad Laboratories), 20 μM forward primer, 20 μM reverse primer and RNase-free water. Amplification was performed using a CFX96 Real-Time PCR detection system (Bio-Rad Laboratories) with the following protocol: 95 °C for 3 min following 40 cycles of 95 °C for 15 s, 60 °C for 20 s and 72 °C for 40 s. To assure specific amplification, a melt curve was included in the end of each run. Each assay included samples, internal controls and negative controls in triplicates. A mean of the PCR efficiency for each primer set was calculated using the software LinRegPCR, version 12.17, and used in the gene expression analysis (Ruijter et al. 2009). Cq values were obtained from the CFX Manager Software (Bio-Rad Laboratories) and the calculation of normalized expression levels was performed using the software qBASEplus, version 2.0 (Biogazelle, Zwijnaarde, Belgium). GeNorm, a part of qBASEplus, was used to evaluate the stability of a set of reference gene candidates and three genes were chosen (Actb, Rpl19 and Arbp (Rplp0)) for normalization of the data. Primer sequences were designed using the Primer-BLAST tool (NCBI) and validated in silico using RTprimerDB primer evaluation, primers for Igf1 and Igf2 targeting several transcripts were based on previous studies (Chen et al. 2011, Garbayo et al. 2011). Primer sequences are presented in Table 2.

Table 2

qPCR primer sequences. 1) Igf1 primer sequences were based on a previous study from Garbayo et al. (2011) and 2) Igf2 primer sequences were based on a previous study from Chen et al. (2011)

Gene namesPrimer sequencesAccession numbers
ActbF: CGTCCACCCGCGAGTACAACCTNM_031144
R: ATCCATGGCGAACTGGTGGCG
Arbp(Rplp0)F: GGGCAATCCCTGACGCACCGNM_022402
R: AGCTGCACATCGCTCAGGATTTCA
Rpl19F: GCGTCTGCAGCCATGAGTATGCTTNM_031103
R: ATCGAGCCCGGGAATGGACAGT
Igf1F: GCTGAAGCCGTTCATTTAGCNM_001082477, NM_001082478, NM_001082479, NM_178866
R: GAGGAGGCCAAATTCAACAA(transcript variant 1–4)
Igf2F: CCCAGCGAGACTCTGTGCGGANM_001190163, NM_001190162, NM_031511
R: GGAAGTACGGCCTGAGAGGTA(transcript variant 1–3)
GhrF: GAAATAGTGCAACCTGATCCGCCCANM_017094
R: GCGGTGGCTGCCAACTCACT

Actb, actin beta; Arbp, ribosomal protein, large, P0, Rpl19, ribosomal protein L19.

IGF1 ELISA

Trunk blood was collected during decapitation in 0.1% EDTA, put on ice and then centrifuged at 1500 g. for 10 min in 4 °C. The plasma was collected and stored in a freezer, −80 °C, until further analysis. Secreted IGF1 in plasma was quantified using a commercial ELISA kit (mouse/rat IGF1 REF E25, Mediagnost, Reutlingen, Germany). Plasma was diluted in sample buffer (1:500) and further analyzed according to the manufacturer's instructions.

Statistical analysis

Values are presented as mean±s.e.m. Statistical analyses were performed using GraphPad Prism, version 5.0d GraphPad Software Inc., La Jolla, CA, USA and SPSS. The normality of the data distribution was examined using the Shapiro–Wilks W test. Results from the MWM acquisition trials, the time spent in the different quadrants during the probe trial, and the weight measurements were analyzed using two-way repeated measures ANOVA with Bonferroni's multiple comparisons test. Data obtained from the MWM probe test were statistically analyzed using a univariate ANOVA using the mean rank (i.e. an average of the rank-transformed variables) as dependent variable and treatment as fixed factor and the nonparametric Kruskal–Wallis test and Dunn's multiple comparisons test where appropriate. Results from the gene expression and the ELISA results were analyzed using one-way ANOVA and Tukey's post hoc test where appropriate. The gene expression results were also analyzed using multivariate ANOVA to study a possible overall effect of treatment. Pearson's correlation test was used for analysis of correlations. P values <0.05 were considered significant.

Results

Water maze

Spatial learning and memory was examined in the MWM and results from the 5 days of acquisition trials are presented in Fig. 2. No significant differences between the treatment groups in latency to target quadrant were observed, although a significant effect of day was seen (F(4, 172)=5.39, MSE=7.69, P=0.0004, ηp2=0.066). From the acquisition trials in the MWM it is obvious that data recorded did not demonstrate any alterations in latency to target zone between the groups, but an effect of day was found (F(4, 172)=48.72, MSE=143.68, P<0.0001, ηp2=0.301). In general, all groups learned to locate the platform, and as expected the escape latency decreased during the acquisition days. An effect of day was seen in thigmotaxis, i.e. the time spent for swimming 15 cm from the border of the pool, F(4, 172)=13.19, MSE=70.80, P<0.0001, ηp2=0.13; swim speed F(4, 172)=13.93, MSE=5.43, P<0.0001, ηp2=0.13; and swim distance F(4, 172)=53.62, MSE=76 240.21, P<0.0001, ηp2=0.32, during the acquisition trials. No effect of treatment was seen in these parameters.

Figure 2
Figure 2

Performance in the MWM during the 5 days of acquisition trials. (A) The latency (s) to first entry in target (SW) quadrant in the five acquisition trials. (B) The escape latency (s), i.e. latency to climb up on the platform during acquisition trials. (C) Thigmotaxis, i.e. percentage of total time spent in swimming within 15 cm of the walls during the acquisition trials. (D) Swim speed (cm/s) during the acquisition trials. (E) Swim distance (cm) during the acquisition trials. Values are presented as mean±s.e.m. Two-way ANOVA for repeated measures with treatment as between factor was used for measurements over time; see text for further details. Controls, n=12; the GH, n=12; AAS, n=12; and AAS+GH, n=11.

Citation: Journal of Endocrinology 216, 1; 10.1530/JOE-12-0315

The results from the probe trial demonstrated an overall improved behavior in the rhGH-treated animals. Results from the 90 s probe trial, performed 72 h after the last acquisition trial, are presented in Fig. 3. Data obtained demonstrated that the rhGH-treated animals had a significantly decreased latency to the target zone compared with the controls. During the probe trial, the animals receiving rhGH also had significantly more TZC than the AAS-treated animals. Furthermore, a significant increase in the number of TZCs was detected in the GH-treated animals compared with controls also from the data recorded during the first 30 s of the probe trial (Fig. 3C). The rhGH-treated animals had more visits (percentage of total visits) to the target quadrant than the AAS+GH-treated animals (Fig. 3D). Using a two-way repeated measures ANOVA the probe trial results also demonstrated an effect of quadrant F(3, 129)=15.76, MSE=80.01, P<0.0001, ηp2=0.20, in the parameter time spent in quadrants (percentage of total time); however, no effect of treatment was found. In order to investigate the existence of an overall effect of treatment the dependent variables were transformed using the ranks transformation method. A univariate ANOVA using the mean rank as dependent variable and treatment as fixed factor revealed a significant effect of treatment, F(3, 43)=3.89, MSE=67.79, P=0.015, ηp2=0.21. Follow-up comparisons using Bonferroni's correction showed that rats treated with GH performed better overall than the controls, P=0.013. There were no differences in thigmotaxis, swim speed or swim length during the probe trial.

Figure 3
Figure 3

Results from the MWM probe trial. Values are presented as mean±s.e.m., n=11–12. (A) Target zone crossings. (B) Latency to first visit to the target zone. (C) Target zone crossings recorded during the first 30 s of the probe trial. (D) Frequency (%) of visits to SW (target) quadrant. (E) Time spent in quadrants (%) in the 90 s probe trial. *P<0.05. For details regarding the statistical analysis, see text. Controls, n=12; GH, n=12; AAS, n=12; and AAS+GH, n=11.

Citation: Journal of Endocrinology 216, 1; 10.1530/JOE-12-0315

Quantitative real-time PCR

The expression of the gene transcripts of Igf1, Igf2, and Ghr from frontal cortex and hippocampus was analyzed, and the results are presented in Fig. 4A and Table 3. As shown, an increase of the Igf1 gene transcript in hippocampus in the GH-treated animals compared with the group treated with AAS was found. Furthermore, a multivariate ANOVA revealed a trend toward a significant overall effect of treatment on the gene transcripts from the hippocampus, F(9, 126)=1.90, P=0.058. No such trend was found regarding the gene transcripts from the frontal cortex.

Figure 4
Figure 4

Results from biochemical experiments, (A) mRNA expression of Igf1 in the hippocampus. (B) Plasma concentration of IGF1 (ng/ml). Values are presented as mean±s.e.m., n=11–12/group. *P<0.05, **P<0.01, ***P<0.001 analyzed with one-way ANOVA and Tukey's post hoc test.

Citation: Journal of Endocrinology 216, 1; 10.1530/JOE-12-0315

Table 3

Results from the qPCR analysis presented as fold of controls (mean±s.e.m.). A multivariate ANOVA revealed a trend towards a significant overall effect of treatment on the gene transcripts from the hippocampus but not in the frontal cortex. For details regarding the statistical analysis, see text. n=11–12/group. The data for Igf1 mRNA in hippocampus is shown in Fig. 4A

Frontal cortex mRNA (fold of control)Hippocampus mRNA (fold of control)
Igf1GhrIgf2GhrIgf2
Controls1.00±0.031.00±0.021.00±0.061.00±0.041.00±0.07
GH1.05±0.041.03±0.041.04±0.071.03±0.030.98±0.05
AAS1.12±0.100.99±0.051.31±0.200.91±0.020.89±0.09
AAS+GH1.21±0.200.97±0.021.27±0.271.02±0.041.03±0.18

IGF1 ELISA

The IGF1 concentration in plasma was determined using ELISA. The results demonstrated a significant decrease of the IGF1 plasma concentration in the AAS-treated group compared with controls and rhGH-treated animals (Fig. 4B). This decrease in IGF1 plasma levels was also seen in the AAS+GH group compared with the rhGH-treated animals, although the animals receiving AAS+GH had a slightly higher mean (1410+141 ng/ml) compared with the AAS-treated animals (1196+105 ng/ml). Correlation test with behavioral parameters from MWM did not demonstrate any strong correlations.

Weight parameters

The animals were weighed eight times during the experiment and the results from the body weight measurements are presented in Fig. 5. The two-way repeated measures ANOVA demonstrated a significant interaction between day and treatment, F(21, 301)=51.63, MSE=3.66, P<0.0001, ηp2=0.12. An effect of both day F(7, 301)=553.8, MSE=3.66, P<0.0001, ηp2=0.33 and treatment F(21, 301)=51.63, MSE=56.23, P<0.0001, ηp2=0.20 was found. Bonferroni's post hoc test revealed several differences between the treatment groups, for example, from day 12 the AAS and AAS+GH-treated animals had a slower weight development compared with the controls. On day 22 the rhGH treatment was initiated, and on days 28 and 31 the AAS+GH-treated animals gained significantly more weight than the animals receiving AAS. On days 28 and 31 there were significant differences between all four treatment groups, where the rhGH-treated animals had gained most weight since day 1 of the experiment demonstrating an overall effect of the GH treatment.

Figure 5
Figure 5

Body weight gain expressed as percentage of initial body weight. Values are expressed as mean±s.e.m., n=11-12/group. Statistical testing was performed with two-way ANOVA for repeated measurements and Bonferroni's post hoc test where appropriate. A significant interaction between day and treatment was found as well as a main effect of both day and treatment (for further details, see text). *P<0.05 compared with controls, #P<0.05 compared with the AAS-treated group.

Citation: Journal of Endocrinology 216, 1; 10.1530/JOE-12-0315

Discussion

The results from this study demonstrated an improved performance of the rhGH-treated animals in the MWM, suggesting an impact of GH on memory. The effects of rhGH on the animals treated with AAS were not pronounced indicating that certain AAS-induced behaviors related to spatial performance and underlying mechanisms seem unaffected by GH. However, administration of rhGH showed prominent effects on weight gain and was able to increase body weight also in the animals pretreated with AAS.

The results from the MWM probe trial demonstrated improved spatial memory functions in the rhGH-treated rats. This is in accordance with previous studies using experimental rats with depleted endogenous GH production due to removal of the hypophysis, where the hormone was found to improve performance in the MWM as well as in the radial maze (Le Grevès et al. 2006, 2011). GHD in both rats and humans has been associated with memory impairments, which is attenuated by GH treatment (Burman & Deijen 1998, Nieves-Martinez et al. 2010, Li et al. 2011a). The results from the MWM also suggest that rhGH may improve the performance of the AAS-treated animals in certain parameters, e.g. TZC. Positive effects from GH on drug-induced effects have been reported earlier from studies on opioid-induced apoptosis in hippocampal cells (Svensson et al. 2008). Several studies suggest that not only GH but also IGF1 is involved in cognition (Markowska et al. 1998, Sonntag et al. 2005, Gong et al. 2012). Hence, both these growth factors may possibly be able to act as cognitive enhancers on drug-induced cognitive impairments.

The mechanism by which GH and IGF1 elicit their positive effects on cognition is still not clarified in all its detail. The somatotropic axis is believed to have an important impact on neuroprotection (Nyberg 2000, Nyberg & Sharma 2002) and neurogenesis (Aberg et al. 2006). GH treatment has been shown to promote neurogenesis in hippocampal areas both in intact and hypophysectomized animals (Aberg et al. 2009, David Aberg et al. 2010). In addition, treatment with GH may attenuate age-related alterations of hippocampal plasticity (Ramsey et al. 2004). The rhGH treatment in the present study increased the IGF1 gene expression in hippocampus compared with the AAS-treated animals. In alignment with this is a recent demonstration of increased hippocampal Igf1 gene expression in pituitary-intact animals, after GH treatment (Li et al. 2011b). Since hippocampus represents a brain area essential for learning and memory it is tempting to suggest that an upregulation of the Igf1 gene transcript in the hippocampus may be associated with improved spatial behavior as seen in the rhGH-treated animals. However, in a GH-deficient rat model no alterations of IGF1 were found after 7 and 30 days of GH treatment (Yan et al. 2011). Thus, it seems that there may be differences in the effects exerted by GH when comparing intact and hypophysectomized animals.

Previous studies have shown that both GH and IGF1 interact with the NMDA receptor system. Both hormones were shown to affect the organization of the NMDA receptor subunits in a way that is consistent with increased long-term potentiation (LTP) and thereby improved cognitive capabilities (Le Grevès et al. 2002, 2005). Increased LTP in hippocampal structures has been suggested to activate a cascade of enzymatic reactions to increase CREB leading to the formation of new synapses and improved cognition (Abel & Nguyen 2008, Gould 2010).

Gene expression of Ghr in the hippocampus of young rats has earlier been observed to increase after treatment with GH, although no difference in older rats was observed (Le Grevès et al. 2002). Interestingly, the Ghr gene expression levels in hippocampus showed a trend toward being lower in the AAS treatment group. A recent study demonstrated a negative correlation between GHR expression levels and learning in diabetic mice where higher Ghr gene transcript levels were associated with an increased learning ability (Enhamre et al. 2012). In the present study no effect from the hormone treatments was seen on Igf2 gene expression levels. IGF2 is believed to have a significant role in memory and has recently been proposed as a novel cognitive enhancer (Agis-Balboa et al. 2011, Chen et al. 2011). In addition, this growth factor is highly expressed in the hippocampus (Rotwein et al. 1988).

Administration of GH is known to decrease the endogenous release of the hormone through an autoregulatory feedback mechanism (Andersson et al. 1983) and this may result in less prominent increases of IGF1 levels in intact animals than expected (Tannenbaum 1980). In the present study no significant increase in the IGF1 plasma levels in the animals receiving rhGH could be seen however, no decrease in IGF1 levels were seen either. A limited number of studies have reported the effects of GH administration on IGF1 levels in intact animals, although a previous study demonstrated that rhGH treatment in Wistar rats did not affect the plasma levels of IGF1 and in this case the authors speculated that the IGF1 release is maximized in these intact animals and cannot be enhanced further (Bielohuby et al. 2011). Furthermore, the same authors state that IGF1 is not a reliable biomarker in wild-type mice and other parameters such as total body weight and liver weight may be more suitable as markers of GH administration (Bielohuby et al. 2011). However, in hypophysectomized rats alterations in the IGF1 levels in plasma following GH treatment have been reported (Maiter et al. 1988, Le Grevès et al. 2011). Also in acromegaly elevated levels of IGF1 have been reported although the relationship between GH and IGF1 levels in plasma is not always straightforward (Neggers et al. 2012). In the present study, the IGF1 levels in plasma was measured more than 12 h after the last rhGH injection; perhaps a significant increase would have been detected if plasma had been collected earlier after GH administration. Stress-related increases of cortisol secretion have also been demonstrated to decrease plasma IGF1 levels (Rosmond et al. 1998). Further studies are needed to fully elucidate this mechanism in intact animals. Several studies have demonstrated a relationship between AAS and the GH/IGF1 axis, although an association between AAS administration and IGF1 plasma levels has not yet been verified. In this study the IGF1 plasma level was significantly attenuated in the AAS-treated animals, clearly demonstrating a connection between these two hormone systems. The observed reduction of IGF1 plasma concentration in the AAS-treated animals might depend on a negative feedback inhibition induced by steroid treatment. In humans, testosterone administration to older men was demonstrated to improve spatial cognition; however, no change in IGF1 or IGF2 serum levels was found and the authors suggested that the effects of AAS and GH on cognition may be independent from each other (Cherrier et al. 2004). However, serum levels of IGF1 and IGF2 might also depend on both dose and treatment length and may not in all cases be suitable markers for CNS effects.

In certain MWM parameters, e.g. TZC, a tendency toward impaired performance in the AAS-treated animals was recorded, although no pronounced differences between controls and AAS-treated animals could be detected. The effect of rhGH treatment in the AAS-pretreated rats appears to be relatively weak although the rhGH treatment induced memory improvements in intact nonsteroid-treated rats. Thus, an apparent interaction between the two hormones may in some parameters result in a weaker effect of GH on cognitive function. Changes in spatial learning have earlier been demonstrated following 2 weeks of treatment with nandrolone decanoate (Magnusson et al. 2009). Other studies have not observed any effects on spatial memory in male rats after treatment with AAS compounds (Clark et al. 1995, Smith et al. 1996). Interestingly, a study examining the combined effect of testosterone and GH demonstrated improved long-term memory assessing the extinction response using a passive avoidance test (Schneider-Rivas et al. 2007). This research group also reported that testosterone enanthate facilitates long-term memory applying passive avoidance conditioning in male rats (Vazquez-Pereyra et al. 1995). However, in these experiments all steroids were applied 45 min before the training session. Thus, alterations in spatial learning and memory induced by the AAS may be acute or short term, and in this experiment the MWM probe trial was performed 10 days after the last dose of AAS. It should also be noted that the setups for memory testing and animal strains as well as other conditions in all these experiments are different. We have previously observed strain differences in the sensitivity toward AAS between Wistar and Sprague–Dawley rats regarding their response in a test measuring aggressive behavior (Johansson et al. 2000b, Steensland et al. 2005). Overall, we believe Wistar rats to be more suitable for behavioral studies although behavioral differences within Wistar rats from different suppliers also have been shown (Palm et al. 2011).

The results from weight measurements demonstrated that the weight gain (percentage of initial weight) significantly increased in the animals receiving rhGH. This is in line with a previous study demonstrating increased body weight gain in rats with intact pituitaries receiving GH, where an increase in food intake in the GH-treated rats also was observed (Azain et al. 1995). Also in hypophysectomized rats, GH treatment has been demonstrated to increase weight gain compared with untreated controls (Le Grevès et al. 2006, 2011). Increased lean body mass and reduction of fat mass have been associated with GH treatment and changes of body composition or increased food intake could be an explanation for the weight gain. The reduction in gain of weight observed in the AAS and AAS+GH-treated animals was expected since earlier studies of rats injected with nandrolone decanoate have demonstrated reduced gain of weight in these animals (Johansson et al. 2000a, Lindblom et al. 2003). In addition, a reduction of food intake in animals treated with nandrolone decanoate has been demonstrated (Lindblom et al. 2003). Interestingly, after day 22 when the AAS administration ended and the rhGH treatment was initiated, the AAS+GH group started to increase in weight again as compared with the AAS-treated rats that received saline instead of rhGH. Thus, GH can partly compensate for the effect on body weight induced by AAS, although the underlying mechanisms for the weight increase need further investigations.

To conclude, the results presented here demonstrate that rhGH and AAS both have an impact on body weight gain and that rhGH was able to attenuate the reduction of weight caused by the AAS administration. Furthermore, rhGH induces a significant improvement on memory in pituitary-intact male rats. The spatial performance of the AAS-treated rats was, however, not significantly altered by administration of rhGH, suggesting that the effects induced by AAS and examined in this study are not affected by the pituitary hormone. Although the present study does not fully clarify the mechanism by which GH and AAS affect memory, the ability of GH to enhance spatial memory in rats is impressive. The experiments presented here were conducted with rhGH in rats but nevertheless the knowledge of the significant improvement of memory observed should be considered in the search for effective strategies to treat drug-induced impairments of cognitive function.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This study was supported by grants from the Swedish Medical Research Council (grant number 9459).

Author contribution statement

A G contributed to the design of the study, performed the experiments, evaluated the results and prepared the manuscript. J J participated in performing the animal experiments, conducted the ELISA experiments and contributed in design of the study. A N contributed with statistical advice, statistical analysis and in preparing the manuscript. F N and M H contributed with theoretical background, design of the study and in preparing the manuscript. All authors read and approved the final manuscript.

References

  • AbelTNguyenPV2008Regulation of hippocampus-dependent memory by cyclic AMP-dependent protein kinase. Progress in Brain Research16997115. (doi:10.1016/S0079-6123(07)00006-4)

    • Search Google Scholar
    • Export Citation
  • AbergNDBryweKGIsgaardJ2006Aspects of growth hormone and insulin-like growth factor-I related to neuroprotection, regeneration, and functional plasticity in the adult brain. Scientific World Journal65380. (doi:10.1100/tsw.2006.22)

    • Search Google Scholar
    • Export Citation
  • AbergNDJohanssonIAbergMALindJJohanssonUECooper-KuhnCMKuhnHGIsgaardJ2009Peripheral administration of GH induces cell proliferation in the brain of adult hypophysectomized rats. Journal of Endocrinology201141150. (doi:10.1677/JOE-08-0495)

    • Search Google Scholar
    • Export Citation
  • Agis-BalboaRCArcos-DiazDWittnamJGovindarajanNBlomKBurkhardtSHaladyniakUAgbemenyahHYZovoilisASalinas-RiesterG2011A hippocampal insulin-growth factor 2 pathway regulates the extinction of fear memories. EMBO Journal3040714083. (doi:10.1038/emboj.2011.293)

    • Search Google Scholar
    • Export Citation
  • AnderssonKFuxeKEnerothPIsakssonONybergFRoosP1983Rat growth hormone and hypothalamic catecholamine nerve terminal systems. Evidence for rapid and discrete reductions in dopamine and noradrenaline levels and turnover in the median eminence of the hypophysectomized male rat. European Journal of Pharmacology95271275. (doi:10.1016/0014-2999(83)90645-3)

    • Search Google Scholar
    • Export Citation
  • AzainMJRobertsTJMartinRJKasserTR1995Comparison of daily versus continuous administration of somatotropin on growth rate, feed intake, and body composition in intact female rats. Journal of Animal Science7310191029.

    • Search Google Scholar
    • Export Citation
  • BielohubyMSchaabMKummannMSawitzkyMGebhardtRBinderGFrystykJBjerreMHoeflichAKratzschJ2011Serum IGF-I is not a reliable pharmacodynamic marker of exogenous growth hormone activity in mice. Endocrinology15247644776. (doi:10.1210/en.2011-1432)

    • Search Google Scholar
    • Export Citation
  • BonettiATirelliFCatapanoADazziDDei CasASolitoFCedaGReverberiCMonicaCPipitoneS2008Side effects of anabolic androgenic steroids abuse. International Journal of Sports Medicine29679687. (doi:10.1055/s-2007-965808)

    • Search Google Scholar
    • Export Citation
  • BurmanPDeijenJB1998Quality of life and cognitive function in patients with pituitary insufficiency. Psychotherapy and Psychosomatics67154167. (doi:10.1159/000012276)

    • Search Google Scholar
    • Export Citation
  • BurmanPBromanJEHettaJWiklundIErfurthEMHaggEKarlssonFA1995Quality of life in adults with growth hormone (GH) deficiency: response to treatment with recombinant human GH in a placebo-controlled 21-month trial. Journal of Clinical Endocrinology and Metabolism8035853590. (doi:10.1210/jc.80.12.3585)

    • Search Google Scholar
    • Export Citation
  • ChenDYSternSAGarcia-OstaASaunier-ReboriBPolloniniGBambah-MukkuDBlitzerRDAlberiniCM2011A critical role for IGF-II in memory consolidation and enhancement. Nature469491497. (doi:10.1038/nature09667)

    • Search Google Scholar
    • Export Citation
  • CherrierMMPlymateSMohanSAsthanaSMatsumotoAMBremnerWPeskindERaskindMLatendresseSHaleyAP2004Relationship between testosterone supplementation and insulin-like growth factor-I levels and cognition in healthy older men. Psychoneuroendocrinology296582. (doi:10.1016/S0306-4530(02)00136-1)

    • Search Google Scholar
    • Export Citation
  • ClarkASMitreMCBrinck-JohnsenT1995Anabolic-androgenic steroid and adrenal steroid effects on hippocampal plasticity. Brain Research6796471. (doi:10.1016/0006-8993(95)00202-2)

    • Search Google Scholar
    • Export Citation
  • David AbergNLindJIsgaardJGeorg KuhnH2010Peripheral growth hormone induces cell proliferation in the intact adult rat brain. Growth Hormone & IGF Research20264269. (doi:10.1016/j.ghir.2009.12.003)

    • Search Google Scholar
    • Export Citation
  • DeijenJBde BoerHBlokGJvan der VeenEA1996Cognitive impairments and mood disturbances in growth hormone deficient men. Psychoneuroendocrinology21313322. (doi:10.1016/0306-4530(95)00050-X)

    • Search Google Scholar
    • Export Citation
  • EnhamreECarlssonAGronbladhAWatanabeHHallbergMNybergF2012The expression of growth hormone receptor gene transcript in the prefrontal cortex is affected in male mice with diabetes-induced learning impairments. Neuroscience Letters5238286. (doi:10.1016/j.neulet.2012.06.050)

    • Search Google Scholar
    • Export Citation
  • FalletiMGMaruffPBurmanPHarrisA2006The effects of growth hormone (GH) deficiency and GH replacement on cognitive performance in adults: a meta-analysis of the current literature. Psychoneuroendocrinology31681691. (doi:10.1016/j.psyneuen.2006.01.005)

    • Search Google Scholar
    • Export Citation
  • GarbayoERavalAPCurtisKMDella-MorteDGomezLAD'IppolitoGReinerTPerez-StableCHowardGAPerez-PinzonMA2011Neuroprotective properties of marrow-isolated adult multilineage-inducible cells in rat hippocampus following global cerebral ischemia are enhanced when complexed to biomimetic microcarriers. Journal of Neurochemistry119972988. (doi:10.1111/j.1471-4159.2011.07272.x)

    • Search Google Scholar
    • Export Citation
  • GongXMaMFanXLiMLiuQLiuXXuG2012Down-regulation of IGF-1/IGF-1R in hippocampus of rats with vascular dementia. Neuroscience Letters5132024. (doi:10.1016/j.neulet.2012.01.077)

    • Search Google Scholar
    • Export Citation
  • GouldTJ2010Addiction and cognition. Addiction Science & Clinical Practice5414.

  • HallbergM2011Impact of anabolic androgenic steroids on neuropeptide systems. Mini Reviews in Medicinal Chemistry11399408. (doi:10.2174/138955711795445961)

    • Search Google Scholar
    • Export Citation
  • HobbsCJPlymateSRRosenCJAdlerRA1993Testosterone administration increases insulin-like growth factor-I levels in normal men. Journal of Clinical Endocrinology and Metabolism77776779. (doi:10.1210/jc.77.3.776)

    • Search Google Scholar
    • Export Citation
  • JohanssonPHallbergMKindlundhANybergF2000aThe effect on opioid peptides in the rat brain, after chronic treatment with the anabolic androgenic steroid, nandrolone decanoate. Brain Research Bulletin51413418. (doi:10.1016/S0361-9230(99)00263-4)

    • Search Google Scholar
    • Export Citation
  • JohanssonPLindqvistANybergFFahlkeC2000bAnabolic androgenic steroids affects alcohol intake, defensive behaviors and brain opioid peptides in the rat. Pharmacology Biochemistry and Behavior67271279. (doi:10.1016/S0091-3057(00)00365-8)

    • Search Google Scholar
    • Export Citation
  • KarlssonORomanEBergALBritteboEB2011Early hippocampal cell death, and late learning and memory deficits in rats exposed to the environmental toxin BMAA (β-N-methylamino-l-alanine) during the neonatal period. Behavioral Brain Research219310320. (doi:10.1016/j.bbr.2011.01.056)

    • Search Google Scholar
    • Export Citation
  • Le GrevèsMSteenslandPLe GrevesPNybergF2002Growth hormone induces age-dependent alteration in the expression of hippocampal growth hormone receptor and N-methyl-d-aspartate receptor subunits gene transcripts in male rats. PNAS9971197123. (doi:10.1073/pnas.092135399)

    • Search Google Scholar
    • Export Citation
  • Le GrevèsMLe GrevesPNybergF2005Age-related effects of IGF-1 on the NMDA-, GH- and IGF-1-receptor mRNA transcripts in the rat hippocampus. Brain Research Bulletin65369374. (doi:10.1016/j.brainresbull.2005.01.012)

    • Search Google Scholar
    • Export Citation
  • Le GrevèsMZhouQBergMLe GrevesPFholenhagKMeyersonBNybergF2006Growth hormone replacement in hypophysectomized rats affects spatial performance and hippocampal levels of NMDA receptor subunit and PSD-95 gene transcript levels. Experimental Brain Research173267273. (doi:10.1007/s00221-006-0438-2)

    • Search Google Scholar
    • Export Citation
  • Le GrevèsMEnhamreEZhouQFhölenhagKBergMMeyersonBNybergF2011Growth hormone enhances cognitive functions in hypophysectomized male rats. American Journal of Neuroprotection and Neuroregeneration35358. (doi:10.1166/ajnn.2011.1023)

    • Search Google Scholar
    • Export Citation
  • LiEKimDHCaiMLeeSKimYLimEHoon RyuJUntermanTGParkS2011aHippocampus-dependent spatial learning and memory are impaired in growth hormone-deficient spontaneous dwarf rats. Endocrine Journal58257267. (doi:10.1507/endocrj.K11E-006)

    • Search Google Scholar
    • Export Citation
  • LiRCGuoSZRaccurtMMoudilouEMorelGBrittianKRGozalD2011bExogenous growth hormone attenuates cognitive deficits induced by intermittent hypoxia in rats. Neuroscience196237250. (doi:10.1016/j.neuroscience.2011.08.029)

    • Search Google Scholar
    • Export Citation
  • LindblomJKindlundhAMNybergFBergstromLWikbergJE2003Anabolic androgenic steroid nandrolone decanoate reduces hypothalamic proopiomelanocortin mRNA levels. Brain Research986139147. (doi:10.1016/S0006-8993(03)03223-2)

    • Search Google Scholar
    • Export Citation
  • MagnussonKHanellABazovIClausenFZhouQNybergF2009Nandrolone decanoate administration elevates hippocampal prodynorphin mRNA expression and impairs Morris water maze performance in male rats. Neuroscience Letters467189193. (doi:10.1016/j.neulet.2009.09.041)

    • Search Google Scholar
    • Export Citation
  • MaiterDUnderwoodLEMaesMDavenportMLKetelslegersJM1988Different effects of intermittent and continuous growth hormone (GH) administration on serum somatomedin-C/insulin-like growth factor I and liver GH receptors in hypophysectomized rats. Endocrinology12310531059. (doi:10.1210/endo-123-2-1053)

    • Search Google Scholar
    • Export Citation
  • MarkowskaALMooneyMSonntagWE1998Insulin-like growth factor-1 ameliorates age-related behavioral deficits. Neuroscience87559569. (doi:10.1016/S0306-4522(98)00143-2)

    • Search Google Scholar
    • Export Citation
  • MaruffPFalletiM2005Cognitive function in growth hormone deficiency and growth hormone replacement. Hormone Research64 (Suppl 3) 100108. (doi:10.1159/000089325)

    • Search Google Scholar
    • Export Citation
  • MintoCFHoweCWishartSConwayAJHandelsmanDJ1997Pharmacokinetics and pharmacodynamics of nandrolone esters in oil vehicle: effects of ester, injection site and injection volume. Journal of Pharmacology and Experimental Therapeutics28193102.

    • Search Google Scholar
    • Export Citation
  • NeggersSJBiermaszNRvan der LelyAJ2012What is active acromegaly and which parameters do we have?Clinical Endocrinology76609614. (doi:10.1111/j.1365-2265.2012.04346.x)

    • Search Google Scholar
    • Export Citation
  • Nieves-MartinezESonntagWEWilsonADonahueAMolinaDPBrunso-BechtoldJNicolleMM2010Early-onset GH deficiency results in spatial memory impairment in mid-life and is prevented by GH supplementation. Journal of Endocrinology2043136. (doi:10.1677/JOE-09-0323)

    • Search Google Scholar
    • Export Citation
  • NybergF2000Growth hormone in the brain: characteristics of specific brain targets for the hormone and their functional significance. Frontiers in Neuroendocrinology21330348. (doi:10.1006/frne.2000.0200)

    • Search Google Scholar
    • Export Citation
  • NybergF2009The role of the somatotrophic axis in neuroprotection and neuroregeneration of the addictive brain. International Review of Neurobiology88399427. (doi:10.1016/S0074-7742(09)88014-8)

    • Search Google Scholar
    • Export Citation
  • NybergFSharmaHS2002Repeated topical application of growth hormone attenuates blood–spinal cord barrier permeability and edema formation following spinal cord injury: an experimental study in the rat using Evans blue, ([125])I-sodium and lanthanum tracers. Amino Acids23231239. (doi:10.1007/s00726-001-0134-2)

    • Search Google Scholar
    • Export Citation
  • PalmSRomanENylanderI2011Differences in voluntary ethanol consumption in Wistar rats from five different suppliers. Alcohol45607614. (doi:10.1016/j.alcohol.2010.11.005)

    • Search Google Scholar
    • Export Citation
  • RamseyMMWeinerJLMooreTPCarterCSSonntagWE2004Growth hormone treatment attenuates age-related changes in hippocampal short-term plasticity and spatial learning. Neuroscience129119127. (doi:10.1016/j.neuroscience.2004.08.001)

    • Search Google Scholar
    • Export Citation
  • RigamontiAECellaSGGiordaniCBonomoSMGiuntaMSartorioAMullerE2006Testosterone inhibition of growth hormone release stimulated by a growth hormone secretagogue: studies in the rat and dog. Neuroendocrinology84115122. (doi:10.1159/000096998)

    • Search Google Scholar
    • Export Citation
  • RosmondRDallmanMFBjorntorpP1998Stress-related cortisol secretion in men: relationships with abdominal obesity and endocrine, metabolic and hemodynamic abnormalities. Journal of Clinical Endocrinology and Metabolism8318531859. (doi:10.1210/jc.83.6.1853)

    • Search Google Scholar
    • Export Citation
  • RotweinPBurgessSKMilbrandtJDKrauseJE1988Differential expression of insulin-like growth factor genes in rat central nervous system. PNAS85265269. (doi:10.1073/pnas.85.1.265)

    • Search Google Scholar
    • Export Citation
  • RuijterJMRamakersCHoogaarsWMKarlenYBakkerOvan den HoffMJMoormanAF2009Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Research37e45. (doi:10.1093/nar/gkp045)

    • Search Google Scholar
    • Export Citation
  • Schneider-RivasSParedes-CarbajalCMascherDAngoa-PerezMJaramillo-GonzalezEBorgonio-PerezGRivas-ArancibiaS2007Effects of testosterone and growth hormone on long-term retention and extinction of a passive avoidance response in young and aged rats. International Journal of Neuroscience11714431456. (doi:10.1080/00207450601125782)

    • Search Google Scholar
    • Export Citation
  • SkarbergKNybergFEngstromI2009Multisubstance use as a feature of addiction to anabolic-androgenic steroids. European Addiction Research1599106. (doi:10.1159/000199045)

    • Search Google Scholar
    • Export Citation
  • SmithSTStackmanRWClarkAS1996Spatial working memory is preserved in rats treated with anabolic-androgenic steroids. Brain Research737313316. (doi:10.1016/0006-8993(96)00932-8)

    • Search Google Scholar
    • Export Citation
  • SonntagWERamseyMCarterCS2005Growth hormone and insulin-like growth factor-1 (IGF-1) and their influence on cognitive aging. Ageing Research Reviews4195212. (doi:10.1016/j.arr.2005.02.001)

    • Search Google Scholar
    • Export Citation
  • SteenslandPHallbergMKindlundhAFahlkeCNybergF2005Amphetamine-induced aggression is enhanced in rats pre-treated with the anabolic androgenic steroid nandrolone decanoate. Steroids70199204. (doi:10.1016/j.steroids.2004.11.010)

    • Search Google Scholar
    • Export Citation
  • SuTPPagliaroMSchmidtPJPickarDWolkowitzORubinowDR1993Neuropsychiatric effects of anabolic steroids in male normal volunteers. Journal of the American Medical Association26927602764. (doi:10.1001/jama.1993.03500210060032)

    • Search Google Scholar
    • Export Citation
  • SvenssonALBuchtNHallbergMNybergF2008Reversal of opiate-induced apoptosis by human recombinant growth hormone in murine foetus primary hippocampal neuronal cell cultures. PNAS10573047308. (doi:10.1073/pnas.0802531105)

    • Search Google Scholar
    • Export Citation
  • TannenbaumGS1980Evidence for autoregulation of growth hormone secretion via the central nervous system. Endocrinology10721172120. (doi:10.1210/endo-107-6-2117)

    • Search Google Scholar
    • Export Citation
  • Vazquez-PereyraFRivas-ArancibiaSLoaeza-Del CastilloASchneider-RivasS1995Modulation of short term and long term memory by steroid sexual hormones. Life Sciences56PL255PL260. (doi:10.1016/0024-3205(95)00067-G)

    • Search Google Scholar
    • Export Citation
  • VeldhuisJDMetzgerDLMarthaPMJrMaurasNKerriganJRKeenanBRogolADPincusSM1997Estrogen and testosterone, but not a nonaromatizable androgen, direct network integration of the hypothalamo-somatotrope (growth hormone)–insulin-like growth factor I axis in the human: evidence from pubertal pathophysiology and sex-steroid hormone replacement. Journal of Clinical Endocrinology and Metabolism8234143420. (doi:10.1210/jc.82.10.3414)

    • Search Google Scholar
    • Export Citation
  • VeldhuisJDFrystykJIranmaneshAOrskovH2005Testosterone and estradiol regulate free insulin-like growth factor I (IGF-I), IGF binding protein 1 (IGFBP-1), and dimeric IGF-I/IGFBP-1 concentrations. Journal of Clinical Endocrinology and Metabolism9029412947. (doi:10.1210/jc.2004-1314)

    • Search Google Scholar
    • Export Citation
  • van der ViesJ1985Implications of basic pharmacology in the therapy with esters of nandrolone. Acta Endocrinologica. Supplementum2713844.

    • Search Google Scholar
    • Export Citation
  • WeissbergerAJHoKK1993Activation of the somatotropic axis by testosterone in adult males: evidence for the role of aromatization. Journal of Clinical Endocrinology and Metabolism7614071412. (doi:10.1210/jc.76.6.1407)

    • Search Google Scholar
    • Export Citation
  • YanHMitschelenMBixlerGVBrucklacherRMFarleyJAHanSFreemanWMSonntagWE2011Circulating IGF1 regulates hippocampal IGF1 levels and brain gene expression during adolescence. Journal of Endocrinology2112737. (doi:10.1530/JOE-11-0200)

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

 

      Society for Endocrinology

Related Articles

Article Information

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 746 575 21
PDF Downloads 121 106 12

Altmetrics

Figures

  • View in gallery

    Timeline of the procedures in this experiment. The rats were treated with nandrolone decanoate (an AAS) or saline every third day from days 1 to 21. From day 22 the rats were treated with rhGH or saline for 10 consecutive days. D, decapitation.

  • View in gallery

    Performance in the MWM during the 5 days of acquisition trials. (A) The latency (s) to first entry in target (SW) quadrant in the five acquisition trials. (B) The escape latency (s), i.e. latency to climb up on the platform during acquisition trials. (C) Thigmotaxis, i.e. percentage of total time spent in swimming within 15 cm of the walls during the acquisition trials. (D) Swim speed (cm/s) during the acquisition trials. (E) Swim distance (cm) during the acquisition trials. Values are presented as mean±s.e.m. Two-way ANOVA for repeated measures with treatment as between factor was used for measurements over time; see text for further details. Controls, n=12; the GH, n=12; AAS, n=12; and AAS+GH, n=11.

  • View in gallery

    Results from the MWM probe trial. Values are presented as mean±s.e.m., n=11–12. (A) Target zone crossings. (B) Latency to first visit to the target zone. (C) Target zone crossings recorded during the first 30 s of the probe trial. (D) Frequency (%) of visits to SW (target) quadrant. (E) Time spent in quadrants (%) in the 90 s probe trial. *P<0.05. For details regarding the statistical analysis, see text. Controls, n=12; GH, n=12; AAS, n=12; and AAS+GH, n=11.

  • View in gallery

    Results from biochemical experiments, (A) mRNA expression of Igf1 in the hippocampus. (B) Plasma concentration of IGF1 (ng/ml). Values are presented as mean±s.e.m., n=11–12/group. *P<0.05, **P<0.01, ***P<0.001 analyzed with one-way ANOVA and Tukey's post hoc test.

  • View in gallery

    Body weight gain expressed as percentage of initial body weight. Values are expressed as mean±s.e.m., n=11-12/group. Statistical testing was performed with two-way ANOVA for repeated measurements and Bonferroni's post hoc test where appropriate. A significant interaction between day and treatment was found as well as a main effect of both day and treatment (for further details, see text). *P<0.05 compared with controls, #P<0.05 compared with the AAS-treated group.

References

  • AbelTNguyenPV2008Regulation of hippocampus-dependent memory by cyclic AMP-dependent protein kinase. Progress in Brain Research16997115. (doi:10.1016/S0079-6123(07)00006-4)

    • Search Google Scholar
    • Export Citation
  • AbergNDBryweKGIsgaardJ2006Aspects of growth hormone and insulin-like growth factor-I related to neuroprotection, regeneration, and functional plasticity in the adult brain. Scientific World Journal65380. (doi:10.1100/tsw.2006.22)

    • Search Google Scholar
    • Export Citation
  • AbergNDJohanssonIAbergMALindJJohanssonUECooper-KuhnCMKuhnHGIsgaardJ2009Peripheral administration of GH induces cell proliferation in the brain of adult hypophysectomized rats. Journal of Endocrinology201141150. (doi:10.1677/JOE-08-0495)

    • Search Google Scholar
    • Export Citation
  • Agis-BalboaRCArcos-DiazDWittnamJGovindarajanNBlomKBurkhardtSHaladyniakUAgbemenyahHYZovoilisASalinas-RiesterG2011A hippocampal insulin-growth factor 2 pathway regulates the extinction of fear memories. EMBO Journal3040714083. (doi:10.1038/emboj.2011.293)

    • Search Google Scholar
    • Export Citation
  • AnderssonKFuxeKEnerothPIsakssonONybergFRoosP1983Rat growth hormone and hypothalamic catecholamine nerve terminal systems. Evidence for rapid and discrete reductions in dopamine and noradrenaline levels and turnover in the median eminence of the hypophysectomized male rat. European Journal of Pharmacology95271275. (doi:10.1016/0014-2999(83)90645-3)

    • Search Google Scholar
    • Export Citation
  • AzainMJRobertsTJMartinRJKasserTR1995Comparison of daily versus continuous administration of somatotropin on growth rate, feed intake, and body composition in intact female rats. Journal of Animal Science7310191029.

    • Search Google Scholar
    • Export Citation
  • BielohubyMSchaabMKummannMSawitzkyMGebhardtRBinderGFrystykJBjerreMHoeflichAKratzschJ2011Serum IGF-I is not a reliable pharmacodynamic marker of exogenous growth hormone activity in mice. Endocrinology15247644776. (doi:10.1210/en.2011-1432)

    • Search Google Scholar
    • Export Citation
  • BonettiATirelliFCatapanoADazziDDei CasASolitoFCedaGReverberiCMonicaCPipitoneS2008Side effects of anabolic androgenic steroids abuse. International Journal of Sports Medicine29679687. (doi:10.1055/s-2007-965808)

    • Search Google Scholar
    • Export Citation
  • BurmanPDeijenJB1998Quality of life and cognitive function in patients with pituitary insufficiency. Psychotherapy and Psychosomatics67154167. (doi:10.1159/000012276)

    • Search Google Scholar
    • Export Citation
  • BurmanPBromanJEHettaJWiklundIErfurthEMHaggEKarlssonFA1995Quality of life in adults with growth hormone (GH) deficiency: response to treatment with recombinant human GH in a placebo-controlled 21-month trial. Journal of Clinical Endocrinology and Metabolism8035853590. (doi:10.1210/jc.80.12.3585)

    • Search Google Scholar
    • Export Citation
  • ChenDYSternSAGarcia-OstaASaunier-ReboriBPolloniniGBambah-MukkuDBlitzerRDAlberiniCM2011A critical role for IGF-II in memory consolidation and enhancement. Nature469491497. (doi:10.1038/nature09667)

    • Search Google Scholar
    • Export Citation
  • CherrierMMPlymateSMohanSAsthanaSMatsumotoAMBremnerWPeskindERaskindMLatendresseSHaleyAP2004Relationship between testosterone supplementation and insulin-like growth factor-I levels and cognition in healthy older men. Psychoneuroendocrinology296582. (doi:10.1016/S0306-4530(02)00136-1)

    • Search Google Scholar
    • Export Citation
  • ClarkASMitreMCBrinck-JohnsenT1995Anabolic-androgenic steroid and adrenal steroid effects on hippocampal plasticity. Brain Research6796471. (doi:10.1016/0006-8993(95)00202-2)

    • Search Google Scholar
    • Export Citation
  • David AbergNLindJIsgaardJGeorg KuhnH2010Peripheral growth hormone induces cell proliferation in the intact adult rat brain. Growth Hormone & IGF Research20264269. (doi:10.1016/j.ghir.2009.12.003)

    • Search Google Scholar
    • Export Citation
  • DeijenJBde BoerHBlokGJvan der VeenEA1996Cognitive impairments and mood disturbances in growth hormone deficient men. Psychoneuroendocrinology21313322. (doi:10.1016/0306-4530(95)00050-X)

    • Search Google Scholar
    • Export Citation
  • EnhamreECarlssonAGronbladhAWatanabeHHallbergMNybergF2012The expression of growth hormone receptor gene transcript in the prefrontal cortex is affected in male mice with diabetes-induced learning impairments. Neuroscience Letters5238286. (doi:10.1016/j.neulet.2012.06.050)

    • Search Google Scholar
    • Export Citation
  • FalletiMGMaruffPBurmanPHarrisA2006The effects of growth hormone (GH) deficiency and GH replacement on cognitive performance in adults: a meta-analysis of the current literature. Psychoneuroendocrinology31681691. (doi:10.1016/j.psyneuen.2006.01.005)

    • Search Google Scholar
    • Export Citation
  • GarbayoERavalAPCurtisKMDella-MorteDGomezLAD'IppolitoGReinerTPerez-StableCHowardGAPerez-PinzonMA2011Neuroprotective properties of marrow-isolated adult multilineage-inducible cells in rat hippocampus following global cerebral ischemia are enhanced when complexed to biomimetic microcarriers. Journal of Neurochemistry119972988. (doi:10.1111/j.1471-4159.2011.07272.x)

    • Search Google Scholar
    • Export Citation
  • GongXMaMFanXLiMLiuQLiuXXuG2012Down-regulation of IGF-1/IGF-1R in hippocampus of rats with vascular dementia. Neuroscience Letters5132024. (doi:10.1016/j.neulet.2012.01.077)

    • Search Google Scholar
    • Export Citation
  • GouldTJ2010Addiction and cognition. Addiction Science & Clinical Practice5414.

  • HallbergM2011Impact of anabolic androgenic steroids on neuropeptide systems. Mini Reviews in Medicinal Chemistry11399408. (doi:10.2174/138955711795445961)

    • Search Google Scholar
    • Export Citation
  • HobbsCJPlymateSRRosenCJAdlerRA1993Testosterone administration increases insulin-like growth factor-I levels in normal men. Journal of Clinical Endocrinology and Metabolism77776779. (doi:10.1210/jc.77.3.776)

    • Search Google Scholar
    • Export Citation
  • JohanssonPHallbergMKindlundhANybergF2000aThe effect on opioid peptides in the rat brain, after chronic treatment with the anabolic androgenic steroid, nandrolone decanoate. Brain Research Bulletin51413418. (doi:10.1016/S0361-9230(99)00263-4)

    • Search Google Scholar
    • Export Citation
  • JohanssonPLindqvistANybergFFahlkeC2000bAnabolic androgenic steroids affects alcohol intake, defensive behaviors and brain opioid peptides in the rat. Pharmacology Biochemistry and Behavior67271279. (doi:10.1016/S0091-3057(00)00365-8)

    • Search Google Scholar
    • Export Citation
  • KarlssonORomanEBergALBritteboEB2011Early hippocampal cell death, and late learning and memory deficits in rats exposed to the environmental toxin BMAA (β-N-methylamino-l-alanine) during the neonatal period. Behavioral Brain Research219310320. (doi:10.1016/j.bbr.2011.01.056)

    • Search Google Scholar
    • Export Citation
  • Le GrevèsMSteenslandPLe GrevesPNybergF2002Growth hormone induces age-dependent alteration in the expression of hippocampal growth hormone receptor and N-methyl-d-aspartate receptor subunits gene transcripts in male rats. PNAS9971197123. (doi:10.1073/pnas.092135399)

    • Search Google Scholar
    • Export Citation
  • Le GrevèsMLe GrevesPNybergF2005Age-related effects of IGF-1 on the NMDA-, GH- and IGF-1-receptor mRNA transcripts in the rat hippocampus. Brain Research Bulletin65369374. (doi:10.1016/j.brainresbull.2005.01.012)

    • Search Google Scholar
    • Export Citation
  • Le GrevèsMZhouQBergMLe GrevesPFholenhagKMeyersonBNybergF2006Growth hormone replacement in hypophysectomized rats affects spatial performance and hippocampal levels of NMDA receptor subunit and PSD-95 gene transcript levels. Experimental Brain Research173267273. (doi:10.1007/s00221-006-0438-2)

    • Search Google Scholar
    • Export Citation
  • Le GrevèsMEnhamreEZhouQFhölenhagKBergMMeyersonBNybergF2011Growth hormone enhances cognitive functions in hypophysectomized male rats. American Journal of Neuroprotection and Neuroregeneration35358. (doi:10.1166/ajnn.2011.1023)

    • Search Google Scholar
    • Export Citation
  • LiEKimDHCaiMLeeSKimYLimEHoon RyuJUntermanTGParkS2011aHippocampus-dependent spatial learning and memory are impaired in growth hormone-deficient spontaneous dwarf rats. Endocrine Journal58257267. (doi:10.1507/endocrj.K11E-006)

    • Search Google Scholar
    • Export Citation
  • LiRCGuoSZRaccurtMMoudilouEMorelGBrittianKRGozalD2011bExogenous growth hormone attenuates cognitive deficits induced by intermittent hypoxia in rats. Neuroscience196237250. (doi:10.1016/j.neuroscience.2011.08.029)

    • Search Google Scholar
    • Export Citation
  • LindblomJKindlundhAMNybergFBergstromLWikbergJE2003Anabolic androgenic steroid nandrolone decanoate reduces hypothalamic proopiomelanocortin mRNA levels. Brain Research986139147. (doi:10.1016/S0006-8993(03)03223-2)

    • Search Google Scholar
    • Export Citation
  • MagnussonKHanellABazovIClausenFZhouQNybergF2009Nandrolone decanoate administration elevates hippocampal prodynorphin mRNA expression and impairs Morris water maze performance in male rats. Neuroscience Letters467189193. (doi:10.1016/j.neulet.2009.09.041)

    • Search Google Scholar
    • Export Citation
  • MaiterDUnderwoodLEMaesMDavenportMLKetelslegersJM1988Different effects of intermittent and continuous growth hormone (GH) administration on serum somatomedin-C/insulin-like growth factor I and liver GH receptors in hypophysectomized rats. Endocrinology12310531059. (doi:10.1210/endo-123-2-1053)

    • Search Google Scholar
    • Export Citation
  • MarkowskaALMooneyMSonntagWE1998Insulin-like growth factor-1 ameliorates age-related behavioral deficits. Neuroscience87559569. (doi:10.1016/S0306-4522(98)00143-2)

    • Search Google Scholar
    • Export Citation
  • MaruffPFalletiM2005Cognitive function in growth hormone deficiency and growth hormone replacement. Hormone Research64 (Suppl 3) 100108. (doi:10.1159/000089325)

    • Search Google Scholar
    • Export Citation
  • MintoCFHoweCWishartSConwayAJHandelsmanDJ1997Pharmacokinetics and pharmacodynamics of nandrolone esters in oil vehicle: effects of ester, injection site and injection volume. Journal of Pharmacology and Experimental Therapeutics28193102.

    • Search Google Scholar
    • Export Citation
  • NeggersSJBiermaszNRvan der LelyAJ2012What is active acromegaly and which parameters do we have?Clinical Endocrinology76609614. (doi:10.1111/j.1365-2265.2012.04346.x)

    • Search Google Scholar
    • Export Citation
  • Nieves-MartinezESonntagWEWilsonADonahueAMolinaDPBrunso-BechtoldJNicolleMM2010Early-onset GH deficiency results in spatial memory impairment in mid-life and is prevented by GH supplementation. Journal of Endocrinology2043136. (doi:10.1677/JOE-09-0323)

    • Search Google Scholar
    • Export Citation
  • NybergF2000Growth hormone in the brain: characteristics of specific brain targets for the hormone and their functional significance. Frontiers in Neuroendocrinology21330348. (doi:10.1006/frne.2000.0200)

    • Search Google Scholar
    • Export Citation
  • NybergF2009The role of the somatotrophic axis in neuroprotection and neuroregeneration of the addictive brain. International Review of Neurobiology88399427. (doi:10.1016/S0074-7742(09)88014-8)

    • Search Google Scholar
    • Export Citation
  • NybergFSharmaHS2002Repeated topical application of growth hormone attenuates blood–spinal cord barrier permeability and edema formation following spinal cord injury: an experimental study in the rat using Evans blue, ([125])I-sodium and lanthanum tracers. Amino Acids23231239. (doi:10.1007/s00726-001-0134-2)

    • Search Google Scholar
    • Export Citation
  • PalmSRomanENylanderI2011Differences in voluntary ethanol consumption in Wistar rats from five different suppliers. Alcohol45607614. (doi:10.1016/j.alcohol.2010.11.005)

    • Search Google Scholar
    • Export Citation
  • RamseyMMWeinerJLMooreTPCarterCSSonntagWE2004Growth hormone treatment attenuates age-related changes in hippocampal short-term plasticity and spatial learning. Neuroscience129119127. (doi:10.1016/j.neuroscience.2004.08.001)

    • Search Google Scholar
    • Export Citation
  • RigamontiAECellaSGGiordaniCBonomoSMGiuntaMSartorioAMullerE2006Testosterone inhibition of growth hormone release stimulated by a growth hormone secretagogue: studies in the rat and dog. Neuroendocrinology84115122. (doi:10.1159/000096998)

    • Search Google Scholar
    • Export Citation
  • RosmondRDallmanMFBjorntorpP1998Stress-related cortisol secretion in men: relationships with abdominal obesity and endocrine, metabolic and hemodynamic abnormalities. Journal of Clinical Endocrinology and Metabolism8318531859. (doi:10.1210/jc.83.6.1853)

    • Search Google Scholar
    • Export Citation
  • RotweinPBurgessSKMilbrandtJDKrauseJE1988Differential expression of insulin-like growth factor genes in rat central nervous system. PNAS85265269. (doi:10.1073/pnas.85.1.265)

    • Search Google Scholar
    • Export Citation
  • RuijterJMRamakersCHoogaarsWMKarlenYBakkerOvan den HoffMJMoormanAF2009Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Research37e45. (doi:10.1093/nar/gkp045)

    • Search Google Scholar
    • Export Citation
  • Schneider-RivasSParedes-CarbajalCMascherDAngoa-PerezMJaramillo-GonzalezEBorgonio-PerezGRivas-ArancibiaS2007Effects of testosterone and growth hormone on long-term retention and extinction of a passive avoidance response in young and aged rats. International Journal of Neuroscience11714431456. (doi:10.1080/00207450601125782)

    • Search Google Scholar
    • Export Citation
  • SkarbergKNybergFEngstromI2009Multisubstance use as a feature of addiction to anabolic-androgenic steroids. European Addiction Research1599106. (doi:10.1159/000199045)

    • Search Google Scholar
    • Export Citation
  • SmithSTStackmanRWClarkAS1996Spatial working memory is preserved in rats treated with anabolic-androgenic steroids. Brain Research737313316. (doi:10.1016/0006-8993(96)00932-8)

    • Search Google Scholar
    • Export Citation
  • SonntagWERamseyMCarterCS2005Growth hormone and insulin-like growth factor-1 (IGF-1) and their influence on cognitive aging. Ageing Research Reviews4195212. (doi:10.1016/j.arr.2005.02.001)

    • Search Google Scholar
    • Export Citation
  • SteenslandPHallbergMKindlundhAFahlkeCNybergF2005Amphetamine-induced aggression is enhanced in rats pre-treated with the anabolic androgenic steroid nandrolone decanoate. Steroids70199204. (doi:10.1016/j.steroids.2004.11.010)

    • Search Google Scholar
    • Export Citation
  • SuTPPagliaroMSchmidtPJPickarDWolkowitzORubinowDR1993Neuropsychiatric effects of anabolic steroids in male normal volunteers. Journal of the American Medical Association26927602764. (doi:10.1001/jama.1993.03500210060032)

    • Search Google Scholar
    • Export Citation
  • SvenssonALBuchtNHallbergMNybergF2008Reversal of opiate-induced apoptosis by human recombinant growth hormone in murine foetus primary hippocampal neuronal cell cultures. PNAS10573047308. (doi:10.1073/pnas.0802531105)

    • Search Google Scholar
    • Export Citation
  • TannenbaumGS1980Evidence for autoregulation of growth hormone secretion via the central nervous system. Endocrinology10721172120. (doi:10.1210/endo-107-6-2117)

    • Search Google Scholar
    • Export Citation
  • Vazquez-PereyraFRivas-ArancibiaSLoaeza-Del CastilloASchneider-RivasS1995Modulation of short term and long term memory by steroid sexual hormones. Life Sciences56PL255PL260. (doi:10.1016/0024-3205(95)00067-G)

    • Search Google Scholar
    • Export Citation
  • VeldhuisJDMetzgerDLMarthaPMJrMaurasNKerriganJRKeenanBRogolADPincusSM1997Estrogen and testosterone, but not a nonaromatizable androgen, direct network integration of the hypothalamo-somatotrope (growth hormone)–insulin-like growth factor I axis in the human: evidence from pubertal pathophysiology and sex-steroid hormone replacement. Journal of Clinical Endocrinology and Metabolism8234143420. (doi:10.1210/jc.82.10.3414)

    • Search Google Scholar
    • Export Citation
  • VeldhuisJDFrystykJIranmaneshAOrskovH2005Testosterone and estradiol regulate free insulin-like growth factor I (IGF-I), IGF binding protein 1 (IGFBP-1), and dimeric IGF-I/IGFBP-1 concentrations. Journal of Clinical Endocrinology and Metabolism9029412947. (doi:10.1210/jc.2004-1314)

    • Search Google Scholar
    • Export Citation
  • van der ViesJ1985Implications of basic pharmacology in the therapy with esters of nandrolone. Acta Endocrinologica. Supplementum2713844.

    • Search Google Scholar
    • Export Citation
  • WeissbergerAJHoKK1993Activation of the somatotropic axis by testosterone in adult males: evidence for the role of aromatization. Journal of Clinical Endocrinology and Metabolism7614071412. (doi:10.1210/jc.76.6.1407)

    • Search Google Scholar
    • Export Citation
  • YanHMitschelenMBixlerGVBrucklacherRMFarleyJAHanSFreemanWMSonntagWE2011Circulating IGF1 regulates hippocampal IGF1 levels and brain gene expression during adolescence. Journal of Endocrinology2112737. (doi:10.1530/JOE-11-0200)

    • Search Google Scholar
    • Export Citation

Cited By

PubMed

Google Scholar