Abstract
Despite clear physiological duress, rainbow trout (Oncorhynchus mykiss) infected with the pathogenic haemoflagellate Cryptobia salmositica do not appear to mount a cortisol stress response. Therefore, we hypothesized that the infection suppresses the stress response by inhibiting the key effectors of the hypothalamic–pituitary–interrenal (HPI) axis. To test this, we characterized the basal activity of the HPI axis and the cortisol response to air exposure in saline- and parasite-injected fish. All fish were sampled at 4 and 6 weeks post-injection (wpi). While both the treatment groups had resting plasma cortisol levels, the parasite-infected fish had lower levels of plasma ACTH than the control fish. Relative to the control fish, the infected fish had higher mRNA levels of brain pre-optic area corticotrophin-releasing factor (CRF) and pituitary CRF receptor type 1, no change in pituitary POMC-A1, -A2 and -B gene expression, higher and lower head kidney melanocortin 2 receptor mRNA levels at 4 and 6 wpi respectively and reduced gene expression of key proteins regulating interrenal steroidogenesis: StAR, cytochrome P450scc and 11β-hydroxylase. The parasite-infected fish also had a reduced plasma cortisol response to a 60-s air exposure stressor. Superfusion of the head kidney tissues of the parasite-infected fish led to significantly lower ACTH-stimulated cortisol release rates than that observed in the control fish. These novel findings show that infection of rainbow trout with C. salmositica results in complex changes in the transcriptional activity of both central and peripheral regulators of the HPI axis and in a reduction in the interrenal capacity to synthesize cortisol.
Introduction
Challenges that disturb the homoeostasis of an animal can be met by an activation of the stress response. A key component of this response in fish involves the stimulation of the hypothalamic–pituitary–interrenal (HPI) axis (Wendelaar Bonga 1997). Corticotrophin-releasing factor (CRF) from the pre-optic area (POA) is the principle hypothalamic regulator of the HPI axis (Bernier et al. 2009). CRF stimulates the secretion of the pro-opiomelanocortin (POMC)-derived peptide ACTH from the anterior pituitary via the CRF type 1 receptor (CRF-R1; Flik et al. 2006). In turn, ACTH binds to the melanocortin type 2 receptor (MC2R; Aluru & Vijayan 2008) of the interrenal cells in the head kidney and regulates the synthesis and secretion of cortisol, the primary stress hormone in teleosts (Barton 2002). The key rate-limiting steps for the production of cortisol include the transport of cholesterol across the inner mitochondrial membrane by StAR, the conversion of cholesterol to pregnenolone by the enzyme cytochrome P450 side-chain cleavage (P450scc) and the hydroxylation of 11-deoxycortisol to cortisol by 11β-hydroxylase (Mommsen et al. 1999). Given its importance in the maintenance of the dynamic steady state of the internal milieu in fish, several studies have characterized the impact of physical, environmental and social stressors on the principle effectors of the HPI axis (Huising et al. 2004, Bernier & Craig 2005, Fuzzen et al. 2010, Jeffrey et al. 2012). By contrast, much less is known about the regulation of the HPI axis in response to the challenges associated with diseases.
During immune challenges in mammals, activated macrophages produce pro-inflammatory cytokines such as tumour necrosis factor α (TNF) and interleukin-1β (IL1β (IL1B)) that activate the hypothalamic–pituitary–adrenal (HPA) axis (Turnbull & Rivier 1999). The resulting increase in circulating glucocorticoids affects numerous immune functions. Systemically, glucocorticoids primarily exert anti-inflammatory effects that protect the organism from the damaging effects of an over-stimulation of the immune system (Sapolsky et al. 2000). Similarly in fish, there is evidence that IL1B can stimulate the activity of the HPI axis (Holland et al. 2002, Metz et al. 2006) and that cortisol can inhibit the production of pro-inflammatory cytokines (Holland et al. 2003, Stolte et al. 2008, Castillo et al. 2009). Moreover, the elevated levels of plasma cortisol associated with either stressors or exogenous glucocorticoids are immunosuppressive and promote pathogen proliferation (Woo et al. 1987, Yada et al. 2002, Saeij et al. 2003a , Li et al. 2013). Overall, cortisol seems to play an important role in the regulation of the immune response in fish that can affect disease susceptibility and outcome (Verburg-van Kemenade et al. 2009).
Though cortisol is a key effector of the HPI axis during the immune response, its production during infection with protozoan parasites is equivocal. For example, rainbow trout infected with the pathogenic haemoflagellate Cryptobia salmositica (order Kinetoplastida, family Bodonidae) show no evidence of pituitary–interrenal axis activation either during disease onset or during disease progression (Laidley et al. 1988). Yet, C. salmositica-infected fish are characterized by pronounced abdominal distension with ascites, exophthalmia, anaemia, anorexia, suppressed growth and lethargy, i.e. clear signs of physiological duress (Woo 1979, 2003). Similarly, common carp (Cyprinus carpio) infected with Trypanoplasma borreli (order Kinetoplastida, family Bodonidae), a close relative of C. salmositica, and human patients chronically infected with either Trypanosoma brucei or Trypanosoma cruzi (order Kinetoplastida, family Trypanosomatidae), the causative agents of African trypanosomiasis and Chagas disease respectively, are all characterized by cortisol levels that do not differ from those of the control subjects (Reinecke et al. 1994, Mazon et al. 2006, Pérez et al. 2011). In fact, both African trypanosomiasis and Chagas disease are characterized by dysfunctional adrenocortical and pituitary function (Reinecke et al. 1998, Corrêa-de-Santana et al. 2006, Pérez et al. 2011).
In this study, to determine how the HPI axis of rainbow trout is regulated during infection with C. salmositica, we characterized the basal activity of the HPI axis and the cortisol response to air exposure in saline- and parasite-injected fish. Using an in vitro superfusion set-up, we also determined the impact of C. salmositica infection on the cortisol synthesis capacity of the interrenals. Given the absence of any change in plasma cortisol levels despite evidence of severe illness (Laidley et al. 1988), we hypothesized that C. salmositica infection suppresses the stress response by inhibiting the key effectors of the HPI axis.
Materials and methods
Animals
Sexually immature rainbow trout of either sex were obtained from Rainbow Springs Trout Farm (Thamesford, ON, Canada). Prior to experimental use, the fish were housed in the Hagen Aqualab at the University of Guelph (Guelph, ON, Canada) in 800 l tanks supplied with aerated well water at 12±1 °C, fed daily to satiation with commercial trout feed (4 PT Regular; Martin Mills, Elmira, ON, Canada) and kept under a 12 h light:12 h darkness photoperiod cycle. All procedures were approved by the local Animal Care Committee and conformed to the principles of the Canadian Council for Animal Care.
C. salmositica: preparation of inoculum
An ampoule of frozen C. salmositica (strain TP4; cryopreserved at −90 °C) was thawed and ∼100 000 parasites were injected intraperitoneally into four rainbow trout (∼150 g). At 4 weeks post-injection (wpi), once clinical signs of Cryptobia infection were detected, the fish were terminally anaesthetized using an overdose of tricaine methanesulphonate (MS-222) and parasites were collected from the blood via a caudal puncture using Na2EDTA-treated syringes and needles. The number of parasites was determined using a haemocytometer (Hausser Scientific, Horsham, PA, USA), and the blood was diluted with sterile PBS (pH 7.2) to a concentration of 100 000 parasites per 150 μl.
Experimental design
Experiment 1: effects of Cryptobia infection on the HPI axis in vivo
A total of 80 fish (average weight ∼140 g) were randomly assigned to one of eight 125 l tanks (n=10 per tank) and allowed to acclimatize for 4 weeks. Following the acclimatization period, all fish were anaesthetized using buffered (NaHCO3, 0.2 g/l) MS-222 (0.1 g/l; Syndel, Nanaimo, BC, Canada), and each fish in the four control tanks was inoculated intraperitoneally with 150 μl sterile PBS (control treatment); each fish in the remaining four tanks was injected with 100 000 parasites in 150 μl PBS (parasite treatment). At 4 and 6 wpi, all the fish from one tank in each treatment group were terminally anaesthetized using an overdose of MS-222 and sampled immediately to determine basal parameters. Blood was drawn via caudal puncture using a Na2EDTA-treated syringe, and parasite load was determined as described above. The remaining blood was spun for 3 min at 8000 g , and the plasma was flash frozen in liquid nitrogen and stored at −80 °C for later analysis of plasma cortisol and ACTH concentrations. To quantify crf mRNA levels, the brain was removed, regionally dissected to isolate the POA and immediately frozen in liquid nitrogen. Similarly, the whole pituitary was removed to quantify the expression of crf-r1, pomc-a1, pomc-a2 and pomc-b, and the head kidney was sampled to measure mc2r, star, p450scc and 11β-hydroxylase gene expression.
In addition, to assess the stress responsiveness of the fish, at 4 and 6 wpi, one tank from each treatment group was rapidly drained to air expose the fish for 60 s and immediately filled once more with fresh aerated water. The fish were not handled prior to sampling. One hour after the air exposure stressor, the fish were terminally anaesthetized as described above and a blood sample was collected for later analysis of plasma cortisol concentration.
Experiment 2: effects of Cryptobia infection on cortisol secretion in vitro
A total of 40 fish (average weight ∼140 g) were randomly assigned to one of four 125 l tanks (n=10 per tank) and allowed to acclimatize for 4 weeks. Following the acclimatization period, the fish from two tanks were injected with PBS and those from the other tanks were injected with C. salmositica as in Experiment 1. At 4 and 6 wpi, ten control and ten parasite-infected fish were terminally anaesthetized, and a blood sample was recovered to determine parasite load. To assess cortisol release in vitro, a 1 cm2 area of the midline anterior head kidney was carefully dissected and immediately placed in 5 ml of ice-cold 0.015 M HEPES/Tris-buffered superfusion medium (128 mM NaCl, 2 mM KCl, 2 mM CaCl2.2H2O, 0.25% w/v glucose, 0.03% w/v BSA and 0.1 mM ascorbic acid, pH 7.4) for 30 min to flush residual endogenous cortisol from the dissection process. Individual samples (200–300 mg) were finely diced and placed on a fine-meshed filter in a superfusion chamber. The chamber was sealed and superfused using 13±0.5 °C carbogen (95% O2 and 5% CO2)-saturated medium at a flow-through rate of 40 μl/min via a multichannel peristaltic pump (Minipuls 3, Gilson, Inc., Middleton, WI, USA). During an initial equilibration period of 90 min, fractions were collected every 30 min until endogenous cortisol production reached a steady state. Following equilibration (t=0 min), the head kidney preparations were superfused for 60 min with a medium containing 10−7 M human ACTH (hACTH, American Peptide Co., Sunnyvale, CA, USA) followed by superfusion with the medium alone for the remainder of the experiment. Fractions were collected every 20 min during peak cortisol production between 0 and 180 min and every 30 min thereafter until the end of the superfusion experiments. All fractions were immediately frozen at −20 °C and analysed for cortisol content using RIA. After superfusion, head kidney samples were removed from the chambers, sonicated (Vibracell, Sonics and Materials, Newtown, CT, USA) in 500 μl ddH2O and analysed for protein content (Bio-Rad Protein Assay with BSA standards; Bio-Rad Laboratories). Cortisol release from each sample is expressed relative to the time 0 value and reported in pg/μg protein/min. The maximal cortisol release following the addition of ACTH, the time delay between the addition of ACTH and maximal cortisol release, and the total amount of cortisol released over the duration of the superfusion experiments were also calculated from each superfusion experiment.
Cortisol and ACTH analyses
Plasma and superfusion medium cortisol concentrations were measured in duplicate using RIA (Bernier et al. 2008). Briefly, 200 μl of standard, diluted plasma or superfusion medium were combined with 200 μl 3H-cortisol (5500–6000 c.p.m./tube, 70–100 Ci/mmol, PerkinElmer, Boston, MA, USA) and 200 μl of diluted rabbit anti-cortisol antibody (product code #R4866, Clinical Endocrinology Laboratory, University of California Davis, CA, USA). The samples were incubated at 4 °C for 16 h and then chilled on ice for 10 min prior to the addition of 200 μl of dextran-coated charcoal suspension in phosgel buffer (5.75 g dibasic sodium phosphate, 1.28 g monobasic sodium phosphate, 1 g gelatin and 0.1 g thimerosal per litre of dH2O, pH 7.6). The samples were then vortexed and centrifuged at 1750 g at 4 °C for 12 min. The resultant supernatant was decanted directly into scintillation vials containing 5 ml of scintillation fluid and counted. Cortisol measurement in extracted plasma and medium were diluted to fall within the 20–80% range of the standard curve. A serial dilution of rainbow trout plasma gave a displacement curve that was parallel to the standard curve, and the lower detection of the assay was 15 pg/ml. All plasma cortisol samples were measured in a single assay with an intra-assay variability of 1% (n=4), while inter- and intra-assay variations of superfusion medium cortisol concentrations were 11.4 (n=6) and 1.9% (n=6) respectively.
Plasma ACTH levels were measured in duplicate using RIA. The reagents were provided, and the procedure was carried out as outlined in the ImmuChem Double Antibody hACTH kit (product code #07-106101; MP Biomedicals, Orangeburg, NY, USA). This assay has been validated previously for use in trout plasma (Craig et al. 2005). All samples were analysed in one assay that had a lower detection limit of 10 pg/ml and an intra-assay variation of 5.1% (n=8). Furthermore, a serial dilution of rainbow trout plasma gave a displacement curve parallel to the ACTH standard curve.
RNA extraction, first-strand cDNA synthesis and qRT-PCR
All tissues were homogenized and total RNA was extracted using TRIzol Reagent (Invitrogen). RNA pellets were re-dissolved in RNase-free water and quantified using u.v. (A260) spectrophotometry. One microgram of total RNA was treated with DNase I and reverse transcribed to cDNA using Superscript II RNase H-reverse transcriptase (Invitrogen) according to the manufacturer's protocol. Non-reverse-transcribed (no-RT controls) representatives from each tissue, treatment and sampling time were included during cDNA synthesis to monitor genomic contamination. Triplicates of each cDNA sample were amplified using an ABI StepOne Plus sequence detection system (Applied Biosystems). Each 15 μl reaction mixture contained 7.5 μl of Perfecta SYBR Green 2× PCR FastMix ROX (Quanta BioSciences, Gaithersburg, MD, USA), 3.75 μl of 5- to 15-fold diluted first-strand cDNA template or no-RT controls, and 1.875 μl of both forward and reverse primers (1.6 μM). Default cycling conditions were used: 5 min at 95 °C followed by 40 cycles of 1 s at 95 °C and 30 s at 60 °C. This protocol was followed using a melting curve analysis to verify the specificity of the PCR products. Primer pairs for qRT-PCR were designed using Primer Express 3.0 (Applied Biosystems) based on rainbow trout sequences for each target gene (Table 1). To account for differences in amplification efficiency, standard curves were constructed for each gene using known dilutions of cDNA. Input values were obtained by fitting the average threshold cycle (C T) value to the antilog of the standard curve. To correct for minor variations in template input and transcriptional efficiency, the input values were normalized to the expression level of the housekeeping gene elongation factor 1α (ef1 α). Initial pilot experiments revealed no changes in ef1 α expression with parasite infection and thus ef1 α was selected as a housekeeping gene for this study. Gene expression data are reported as fold change from the 4 wpi control treatment mRNA levels.
Details of primers used for real-time PCR assays
| Gene | GenBank accession no. | Efficiency (%) | Sequence (5′–3′) |
|---|---|---|---|
| 11β-Hydroxylase |
|
88.4 | F: GCAGGAGGATCGCTGAGAAC |
| R: GACGGAAACTCAACAGGATGTG | |||
| crf |
|
90.8 | F: ACAACGACTCAACTGAAGATCTCG |
| R: AGGAAATTGAGCTTCATGTCAGG | |||
| crf-r1 |
|
87.8 | F: ACAGGCCGGCAGTGACA |
| R: CGTTGGCACTGTGGAATCTG | |||
| ef1α |
|
96.0 | F: CCATTGACATTTCTCTGTGGAAGT |
| R: GAGGTACCAGTGATCATGTTCTTGA | |||
| mc2r |
|
89.0 | F: CGCTACGTCACCATCTTCCA |
| R: CGCCTCGTGGTCATGATGT | |||
| P450scc |
|
96.9 | F: GTAGGAGCCAAGATCTGGAGAGAT |
| R: GGTCCGCCTGGTTGAAGA | |||
| pomc-a1 |
|
84.0 | F: CTCGCTGTCAAGACCTCAACTCT |
| R: GAGTTGGGTTGGAGATGGACCTC | |||
| pomc-a2 |
|
87.4 | F: CTGAAAACAACCTCCTGGAGTGT |
| R: GAGAGGAGGGACAGAGGTAAGTAGAG | |||
| pomc-b |
|
89.7 | F: GGCAGCCCAACCGCTAT |
| R: ATTGCTGGGTATATGGCTTCATG | |||
| star |
|
87.1 | F: GGAGGCGCTGCAGAAGTCTA |
| R: ATCTCAGTGGTCCATCCATCCT |
EF1α, elongation factor 1α; F, forward; MC2R, melanocortin 2 receptor; R, reverse.
Accession numbers from the rainbow trout gene index (www.tigr.org).
Statistical analyses
All results are presented as means±s.e.m. For each variable in Experiment 1, a two-way ANOVA was carried out followed by a Holm–Sidak post hoc test to determine differences between the treatment groups and between the sampling times. In Experiment 2, a one-way repeated-measures ANOVA was carried out followed by a Bonferroni post hoc test to determine differences in cortisol release rate from the time 0 value within a given treatment. Differences in cortisol release rate, maximal cortisol release rate, response time to maximal cortisol release rate and total cortisol release between the treatments were determined by two-way ANOVA and by pairwise Holm–Sidak post hoc tests. Non-parametric data were log-transformed prior to analysis. All analyses were performed using SigmaStat 3.5 (SPSS, Inc.), and P<0.05 was considered statistically significant for all tests.
Results
In contrast to the control fish, the infected fish showed clear signs of disease at 4 and 6 wpi. The infected fish were anorexic (B N Madison, P T K Woo & N J Bernier 2013 unpublished observations) and lethargic and characterized by abdominal distension with ascites and exophthalmia. No parasites were detected in the control fish, while the parasitaemias in the infected fish were 2.41±0.75×106 and 1.79±0.62×106 parasites/ml of blood at 4 and 6 wpi respectively.
Experiment 1: effects of Cryptobia infection on the HPI axis in vivo
Resting plasma cortisol levels were similar between the control and infected fish, and they ranged between 1.5 and 3 ng/ml (Fig. 1). Air exposure for 60 s significantly increased plasma cortisol levels in both treatments and sampling times. However, the average stress-induced increase in plasma cortisol levels over both sampling times was 31% lower in the infected fish than in the control fish.
Effects of an i.p. injection of PBS (control treatment) or Cryptobia salmositica (parasite treatment) on plasma cortisol concentrations of rainbow trout. At 4 or 6 wpi, fish were either undisturbed prior to sampling (control and parasite treatments) or air exposed for 60 s and sampled 60 min later (control+stressor and parasite+stressor treatments). Individual bars that do not share a common lowercase letter or treatments that do not share an uppercase letter are significantly different from each other as determined by two-way ANOVA and by pairwise Holm–Sidak post hoc test. The significance level for all the statistical tests was P<0.05 (n=10).
Citation: Journal of Endocrinology 218, 3; 10.1530/JOE-13-0155
In the pre-optic region of the brain, crf gene expression at both 4 and 6 wpi was fivefold higher in the infected fish than in the uninfected fish (Fig. 2A). Overall, pituitary crf-r1 transcript levels were higher in the infected fish than in the control fish, but the difference between the treatments was greater at 4 wpi than at 6 wpi (Fig. 2B). By contrast, the pituitary mRNA levels of pomc-a1, pomc-a2 and pomc-b did not differ between the treatments at either sampling time (Fig. 2C, D, and E), and basal plasma ACTH levels in the infected fish at both 4 and 6 wpi were 50% lower than those in the control fish (Fig. 2F).
Effects of an i.p. injection of PBS (control treatment) or Cryptobia salmositica (parasite treatment) on the gene expression of (A) pre-optic area CRF and pituitary (B) CRF receptor 1 (crf-r1), (C) pomc-a1, (D) pomc-a2 and (E) pomc-b and (F) on the plasma ACTH concentrations of rainbow trout. Fish were either sampled at 4 or 6 wpi. Gene expression is normalized to the expression of elongation factor 1α (ef1 α) and is reported as fold change from the 4 wpi control treatment. Individual bars that do not share a common lowercase letter or treatments that do not share an uppercase letter are significantly different from each other as determined by two-way ANOVA and by pairwise Holm–Sidak post hoc test. The significance level for all the statistical tests was P<0.05 (n=10).
Citation: Journal of Endocrinology 218, 3; 10.1530/JOE-13-0155
Parasite infection was also associated with multiple changes in transcriptional activity in the interrenal cells of the head kidney. Relative to those in the control fish, while the mRNA levels of mc2r in the infected fish were increased by 2.8-fold at 4 wpi, they were decreased by nearly 70% at 6 wpi (Fig. 3A). Cryptobia infection also reduced the expression of head kidney star, p450scc and 11β-hydroxylase (Fig. 3B, C, and D). However, the reductions in transcript levels were only significant in the time-matched control treatment group at 6 wpi. Relative to those in the control treatment group, the mRNA levels of star, p450scc and 11β-hydroxylase in the infected fish at 6 wpi were reduced by 69, 64 and 75% respectively.
Effects of an i.p. injection of PBS (control treatment) or Cryptobia salmositica (parasite treatment) on the gene expression of head kidney (A) melanocortin 2 receptor (mc2r), (B) star, (C) cytochrome P450 scc (p50scc) or (D) 11β-hydroxylase. Fish were either sampled at 4 or 6 wpi. Gene expression is normalized to the expression of elongation factor 1α (ef1 α) and is reported as fold change from the 4 wpi control treatment. Individual bars that do not share a common lowercase letter or treatments that do not share an uppercase letter are significantly different from each other as determined by two-way ANOVA and by pairwise Holm–Sidak post hoc test. The significance level for all the statistical tests was P<0.05 (n=10).
Citation: Journal of Endocrinology 218, 3; 10.1530/JOE-13-0155
Experiment 2: effects of Cryptobia infection on cortisol secretion in vitro
ACTH (10−7 M) stimulated the rate of cortisol release from head kidney tissues in the control and infected fish at 4 and 6 wpi (Fig. 4A and B). However, the ACTH pulses elicited significantly larger increases in cortisol secretion rate in the control fish than in infected fish. Specifically, relative to the time-matched control fish, the infected fish at 4 and 6 wpi were characterized by 3.2-fold lower ACTH-stimulated maximal cortisol release rates (Fig. 4C). Also, a 40% longer response time to maximal cortisol release rate (Fig. 4D) and 4.1-fold lower total cortisol release over the duration of the superfusion experiments (Fig. 4E) was observed in the infected fish.
In vitro cortisol release rate from rainbow head kidney tissue in a superfusion set-up. Fish received an i.p. injection of either PBS (control treatment) or Cryptobia salmositica (parasite treatment) and head kidney tissues were sampled at 4 (A) and 6 (B) wpi. Following an equilibration period of 90 min, the head kidney tissues were stimulated with 10−7 M human ACTH for 60 min as indicated by the shaded portions. Asterisks indicate statistical differences with time 0 value within a treatment as determined by one-way repeated-measures ANOVA and by Bonferroni post hoc test. The time interval during which a difference was identified between the treatments is indicated by † symbol as determined by two-way ANOVA and by pairwise Holm–Sidak post hoc test. From the data presented in (A) and (B), the maximal cortisol release rate (C), the response time to maximal cortisol release rate (D) and the total cortisol release (E) in response to ACTH stimulation were also determined. Individual bars that do not share a common lowercase letter or treatments that do not share an uppercase letter are significantly different from each other as determined by two-way ANOVA and by pairwise Holm–Sidak post hoc test. The significance level for all the statistical tests was P<0.05 (n=10).
Citation: Journal of Endocrinology 218, 3; 10.1530/JOE-13-0155
Discussion
This study reports the first characterization of the effects of a parasitic infection in a teleost species on the transcriptional activity of the HPI axis and on its principle endocrine products, ACTH and cortisol. While our results confirm an earlier observation (Laidley et al. 1988) that infection of rainbow trout with the haemoflagellate C. salmositica does not affect baseline plasma cortisol levels, they also show that this disease has a significant impact on the HPI axis. Overall, C. salmositica infection of rainbow trout differentially affected the transcriptional activity of POA crf, pituitary crf-r1 and head kidney mc2r, star, p450scc and 11β-hydroxylase, key effectors of the HPI axis. C. salmositica infection also disrupted the stress response of rainbow trout, lowered basal plasma ACTH levels and reduced cortisol synthesis capacity.
Although a variety of stressors are associated with an increase in POA crf gene expression in fish (Bernier et al. 2009), to our knowledge, this is the first study to show that a parasite infection can result in an increase in the transcription of this gene. Studies in mammals have shown that pro-inflammatory cytokines such as IL1β, IL6 and TNFα increase CRF (CRH) gene expression in the hypothalamic paraventricular nucleus (PVN) in response to infection by pathogens (Turnbull & Rivier 1999). Similarly, the increase in brain crf mRNA levels and content in fish given a peripheral injection of the cytokine-inducing bacterial endotoxin lipopolysaccharide (Pepels & Balm 2004, Volkoff & Peter 2004) suggests that pro-inflammatory cytokines may mediate the increase in crf gene expression observed in this study. Although the production of pro-inflammatory cytokines peaks during the early stages of T. borreli infection in common carp, the expression of Il1β and Tnfα is up-regulated in several immune organs up to at least 11 days post-infection (Engelsma et al. 2003, Saeij et al. 2003b ). However, peak C. salmositica infection in rainbow trout (i.e. ∼4 wpi) is associated with marked decreases in head kidney and spleen il1b mRNA expression (L E MacDonald, S L Alderman, S Kramer, P T K Woo & N J Bernier 2013 unpublished observations). Alternatively, the hypoxaemic conditions triggered by the ∼50% reduction in haematocrit in C. salmositica-infected rainbow trout (Chin et al. 2004) may be responsible for the increase in POA crf gene expression. Previously, we have shown that hypoxia exposure can increase the gene expression of POA crf in rainbow trout (Bernier & Craig 2005).
At the pituitary level, peak C. salmositica infection was associated with a significant increase in crf-r1 gene expression. Although increases in crf-r1 gene expression are observed after the application of an acute stressor in mammals, chronic CRF stimulation of pituitary CRF-R1 leads to a down-regulation of crf-r1 mRNA expression (Rabadan-Diehl et al. 1996, Kageyama & Suda 2009). Similarly, 24 h of chronic restraint stress in common carp concomitantly increases the gene expression of POA crf and reduces the gene expression of pituitary crf-r1 (Huising et al. 2004). As such, the chronic increase in POA crf expression of C. salmositica-infected fish is most probably not responsible for the increase in pituitary crf-r1 gene expression. Similarly, pro-inflammatory cytokines are not expected to mediate the increase in crf-r1 gene expression, since previous studies have shown that treatment with either LPS or IL1B decreases pituitary crf-r1 mRNA expression (Schmidt et al. 2003, De La Garza et al. 2005). Instead, since chronic intermittent hypoxia results in a sustained up-regulation of pituitary crf-r1 mRNA expression in rats (Wang et al. 2004), the hypoxaemia that characterizes C. salmositica infection may be responsible for the increase in crf-r1 transcription.
Despite increases in POA crf and pituitary crf-r1 expression, C. salmositica-infected rainbow trout in this study were characterized by a lack of change in pomc-a1, pomc-a2 and pomc-b mRNA levels and by a paradoxical decrease in plasma ACTH levels. Since CRF probably stimulates pituitary pomc gene transcription and ACTH secretion in fish as in mammals via CRF-R1 (Roberts et al. 1987, Flik et al. 2006), our results suggest that Cryptobia infection is associated with an activation of the HPI axis and a disruption in the signalling pathways of the corticotropes that mediate the stimulatory actions of CRF on ACTH release. Similarly, the blunted ACTH and cortisol responses to CRF treatment in patients infected with African trypanosomiasis suggest that a dysfunctional corticotropic response is associated with this parasitic disease (Reinecke et al. 1994).
The marked reduction in the capacity of the interrenal tissue of C. salmositica-infected fish to synthesize cortisol in response to ACTH treatment in vitro also implies that this disease leads to interrenal dysfunction. Likewise, the results of standard ACTH stimulation tests show that patients with African trypanosomiasis are characterized by adrenocortical insufficiency (Reinecke et al. 1994). Given the key role of STAR, P450SCC and 11β-hydroxylase in interrenal cell steroidogenesis (Mommsen et al. 1999, Fuzzen et al. 2010), the parasitaemia-induced reduction in the expression of these genes probably contributed to the observed reduction in cortisol synthesis capacity. However, despite having nearly identical cortisol responses to ACTH in vitro, the 4 and 6 wpi groups of fish infected with C. salmositica had a marked difference in head kidney mc2r gene expression. In a previous study, the up-regulation of mc2r expression in rainbow trout corresponded with an increase in interrenal tissue steroidogenic capacity and elevated cortisol production in vitro (Aluru & Vijayan 2008). Therefore, beyond a reduction in cortisol synthesis capacity, our results suggest that Cryptobia infection in rainbow trout also leads to a disruption in the signalling pathways that mediate the stimulatory actions of ACTH on interrenal steroidogenesis.
In accordance with an impairment of corticotropic and interrenal functions, we observed that C. salmositica-injected fish have a reduced cortisol response to a standardized 60-s air exposure stressor relative to saline-injected fish. While the magnitude of the parasitaemia-induced reduction in the stress response in vivo was relatively small in comparison with the marked suppression in in vitro cortisol synthesis capacity, the ACTH concentration used to stimulate maximal steroidogenesis in the superfusion experiments was approximately two orders of magnitude higher than the concentrations measured in the plasma of stressed rainbow trout (Doyon et al. 2006). By contrast, the lack of difference in baseline plasma cortisol levels between the treatments despite lower plasma ACTH levels in the parasite-infected fish suggest that non-ACTH corticotropic signals may enhance the steroidogenic actions of ACTH in C. salmositica-infected rainbow trout (Bernier et al. 2009).
Parallel studies on the regulation of food intake and growth in C. salmositica-infected rainbow trout suggest that the cytokine leptin may be an important factor in the regulation of the HPI axis during parasitaemia. Leptin is a hypoxia-sensitive gene and its expression is stimulated by hypoxia-inducible factor 1 in response to an oxygen deficit in both mammals (Ambrosini et al. 2002) and fish (Chu et al. 2010, Bernier et al. 2012). In rainbow trout, C. salmositica infection is associated with a marked increase in liver leptin gene expression and plasma leptin concentrations (L E MacDonald, S L Alderman, S Kramer, P T K Woo & N J Bernier 2013 unpublished observations). Besides its important role in the homeostatic control of feeding and energy expenditure (Myers et al. 2008), leptin is involved in controlling the activity of the HPA (Roubos et al. 2012) and HPI (Gorissen et al. 2012) axes. In common carp, for example, leptin suppresses basal and CRF-induced ACTH secretion from superfused anterior pituitary glands and attenuates ACTH-stimulated cortisol production (Gorissen et al. 2012). In mammals, leptin inhibits the synthesis of corticosteroids by suppressing the adrenocortex expression of MC2R, StAR, P450scc, and other key steroidogenic enzymes (Kruse et al. 1998, Su et al. 2012). Moreover, although the actions of leptin on the synthesis and secretion of hypothalamic CRF and pituitary ACTH in mammals are still equivocal, leptin can increase PVN crf gene expression and blunt plasma ACTH responses to stress (Heiman et al. 1997, Malendowicz et al. 2007, Roubos et al. 2012). Therefore, while experiments are needed to identify the specific actions of leptin on the HPI axis of rainbow trout, given the above, it is conceivable that leptin is at least partly responsible for the blunted stress response and reduced cortisol synthesis capacity of C. salmositica-infected fish.
In addition to pro-inflammatory cytokines and leptin, pathophysiological changes associated with parasitaemia may contribute to the changes in HPI axis activity observed in this study. For example, in the head kidney of C. salmositica-infected rainbow trout and T. borreli-infected common carp, parasitaemia is characterized by a gradual proliferation of the interstitial haematopoietic tissue and an infiltration of extravascular parasites and phagocytes (Bunnajirakul et al. 2000, Bahmanrokh & Woo 2001). At peak parasitaemia, the extensive proliferation of lymphoid cells and infiltration of inflammatory cells lead to focal necrosis of the anterior kidney (Bunnajirakul et al. 2000, Bahmanrokh & Woo 2001). Moreover, during the later stages of T. borreli infection in common carp, the activated phagocytes of the head kidney produce high levels of nitric oxide (NO; Wiegertjes & Forlenza 2010). While the role of NO in the regulation of the HPI axis has not been determined and the actions of NO on the HPA axis are complex, in mammals NO can inhibit adrenal steroidogenesis (Monau et al. 2010) and reduce the release of hypothalamic CRF and pituitary ACTH (Mancuso et al. 2010). Whether interrenal cell necrosis or NO production contributes to the dysfunction within the HPI axis in C. salmositica-infected rainbow remains to be determined.
This study reveals that the relative stress hypo-responsiveness of C. salmositica-infected rainbow trout results from complex alterations in the activity of the HPI axis. While the precise mechanisms responsible for this HPI axis dysfunction are not known, recent studies of haemoflagellate parasite-infected fish suggest that leptin, pro-inflammatory cytokines and NO production may be important factors. Whether the hyporesponsive HPI axis of C. salmositica-infected rainbow trout is adaptive or maladaptive remains to be determined. The fact that cortisol implants or stressors can increase parasitaemia and mortality in C. salmositica-infected rainbow trout and T. borreli-infected common carp suggests that a hyporesponsive HPI axis could be adaptive (Woo et al. 1987, Saeij et al. 2003a ). By contrast, given the anti-inflammatory properties of cortisol in fish (Saeij et al. 2003a , Stolte et al. 2008), the lack of a cortisol stress response in C. salmositica-infected rainbow trout could be harmful to the host and contribute to an increased morbidity (Verburg-van Kemenade et al. 2011). An intriguing possibility is that the sensitivity of head kidney phagocytes to the anti-inflammatory effects of cortisol may be mediated through an increase in the expression of glucocorticoid receptors in these cells (Stolte et al. 2008). Overall, our results highlight the need for a better understanding of the contributions of the cortisol stress response to the pathogenesis of parasitic diseases in fish and of the complex interactions between the HPI axis and the immune system.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This research was supported by an Ontario Graduate Scholarship to B N M and by a Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery grant to N J B.
Acknowledgements
The authors thank Steve Cho, Megan Fuzzen, Katie Bell and Jordan Klaiman (University of Guelph) for their assistance with timed sampling.
References
Aluru N & Vijayan MM 2008 Molecular characterization, tissue-specific expression, and regulation of melanocortin 2 receptor in rainbow trout. Endocrinology 149 4577–4588. (doi:10.1210/en.2008-0435)
Ambrosini G , Nath AK , Sierra-Honigmann MR & Flores-Riveros J 2002 Transcriptional activation of the human leptin gene in response to hypoxia: involvement of hypoxia inducible factor I. Journal of Biological Chemistry 277 34601–34609. (doi:10.1074/jbc.M205172200)
Bahmanrokh M & Woo PTK 2001 Relations between histopathology and parasitemias in Oncorhynchus mykiss infected with Cryptobia salmositica, a pathogenic haemoflagellate. Diseases of Aquatic Organisms 46 41–45. (doi:10.3354/dao046041)
Barton BA 2002 Stress in fishes: a diversity of responses with particular reference to changes in circulating corticosteroids. Integrative and Comparative Biology 42 517–525. (doi:10.1093/icb/42.3.517)
Bernier NJ & Craig PM 2005 CRF-related peptides contribute to stress response and regulation of appetite in hypoxic rainbow trout. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 289 R982–R990. (doi:10.1152/ajpregu.00668.2004)
Bernier NJ , Alderman SL & Bristow EN 2008 Heads or tails? Stressor-specific expression of corticotropin-releasing factor and urotensin I in the preoptic area and caudal neurosecretory system of rainbow trout. Journal of Endocrinology 196 637–648. (doi:10.1677/JOE-07-0568)
Bernier NJ, Flik G & Klaren PHM 2009 Chapter 6. Regulation and contribution of the corticotropic, melanotropic and thyrotropic axes to the stress response in fishes. In Fish Physiology, pp 235–311. Eds NJ Bernier, G Van Der Kraak, AP Farrell & CJ Brauner. Burlington, MA: Academic Press. (doi:10.1016/S1546-5098(09)28006-X)
Bernier NJ , Gorissen M & Flik G 2012 Differential effects of chronic hypoxia and feed restriction on the expression of leptin and its receptor, food intake regulation and the endocrine stress response in common carp. Journal of Experimental Biology 215 2273–2282. (doi:10.1242/jeb.066183)
Bunnajirakul S , Steinhagen D , Hetzel U , Körting W & Drommer W 2000 A study of sequential histopathology of Trypanoplasma borreli (Protozoa: Kinetoplastida) in susceptible common carp Cyprinus carpio. Diseases of Aquatic Organisms 39 221–229. (doi:10.3354/dao039221)
Castillo J , Teles M , Mackenzie S & Tort L 2009 Stress-related hormones modulate cytokine expression in the head kidney of gilthead seabream (Sparus aurata). Fish & Shellfish Immunology 27 493–499. (doi:10.1016/j.fsi.2009.06.021)
Chin A , Guo FC , Bernier NJ & Woo PTK 2004 Effect of Cryptobia salmositica-induced anorexia on feeding behavior and immune response in juvenile rainbow trout Oncorhynchus mykiss. Diseases of Aquatic Organisms 58 17–26. (doi:10.3354/dao058017)
Chu DLH , Li VWT & Yu RMK 2010 Leptin: clue to poor appetite in oxygen-starved fish. Molecular and Cellular Endocrinology 319 143–146. (doi:10.1016/j.mce.2010.01.018)
Corrêa-de-Santana E , Paez-Pereda M , Theodoropoulou M , Nihei OK , Gruebler Y , Bozza M , Arzt E , Villa-Verde DMS , Renner U & Stalla J et al. 2006 Hypothalamus–pituitary–adrenal axis during Trypanosoma cruzi acute infection in mice. Journal of Neuroimmunology 173 12–22. (doi:10.1016/j.jneuroim.2005.08.015)
Craig PM , Al-Timimi H & Bernier NJ 2005 Differential increase in forebrain and caudal neurosecretory system corticotropin-releasing factor and urotensin I gene expression associated with seawater transfer in rainbow trout. Endocrinology 146 3851–3860. (doi:10.1210/en.2005-0004)
De La Garza R II , Asnis GM , Fabrizio KR & Pedrosa E 2005 Acute diclofenac treatment attenuates lipopolysaccharide-induced alterations to basic reward behavior and HPA axis activation in rats. Psychopharmacology 179 356–365. (doi:10.1007/s00213-004-2053-x)
Doyon C , Leclair J , Trudeau VL & Moon TW 2006 Corticotropin-releasing factor and neuropeptide Y mRNA levels are modified by glucocorticoids in rainbow trout, Oncorhynchus mykiss. General and Comparative Endocrinology 146 126–135. (doi:10.1016/j.ygcen.2005.10.003)
Engelsma MY , Stet RJM , Saeij JP & Lidy Verburg-van Kemenade BM 2003 Differential expression and haplotypic variation of two interleukin-1β genes in the common carp (Cyprinus carpio L.). Cytokine 22 21–32. (doi:10.1016/S1043-4666(03)00102-9)
Flik G , Klaren PH , Van den Burg EH , Metz JR & Huising MO 2006 CRF and stress in fish. General and Comparative Endocrinology 146 36–44. (doi:10.1016/j.ygcen.2005.11.005)
Fuzzen MLM , Van Der Kraak G & Bernier NJ 2010 Stirring up new ideas about the regulation of the hypothalamic–pituitary–interrenal axis in zebrafish (Danio rerio). Zebrafish 7 349–358. (doi:10.1089/zeb.2010.0662)
Gorissen M , Bernier NJ , Manuel R , de Gelder S , Metz JR , Huising MO & Flik G 2012 Recombinant human leptin attenuates stress axis activity in common carp (Cyprinus carpio L.). General and Comparative Endocrinology 178 75–81. (doi:10.1016/j.ygcen.2012.04.004)
Heiman ML , Ahima RS , Craft LS , Schoner B , Stephens TW & Flier JS 1997 Leptin inhibition of the hypothalamic–pituitary–adrenal axis in response to stress. Endocrinology 138 3859–3863. (doi:10.1210/en.138.9.3859)
Holland JW , Pottinger TG & Secombes CJ 2002 Recombinant interleukin-1β activates the hypothalamic–pituitary–interrenal axis in rainbow trout, Oncorhynchus mykiss. Journal of Endocrinology 175 261–267. (doi:10.1677/joe.0.1750261)
Holland JW , Gould CRW , Jones CS , Noble LR & Secombes CJ 2003 The expression of immune-regulatory genes in rainbow trout, Oncorhynchus mykiss, during a natural outbreak of proliferative kidney disease (PKD). Parasitology 126 S95–S102. (doi:10.1017/S0031182003003767)
Huising MO , Metz JR , van Schooten C , Taverne-Thiele AJ , Hermsen T , Verburg-van Kemenade BML & Flik G 2004 Structural characterisation of a cyprinid (Cyprinus carpio L.) CRH, CRH-BP and CRH-R1, and the role of these proteins in the acute stress response. Journal of Molecular Endocrinology 32 627–648. (doi:10.1677/jme.0.0320627)
Jeffrey JD , Esbaugh AJ , Vijayan MM & Gilmour KM 2012 Modulation of hypothalamic–pituitary–interrenal axis function by social status in rainbow trout. General and Comparative Endocrinology 176 201–210. (doi:10.1016/j.ygcen.2012.01.016)
Kageyama K & Suda T 2009 Regulatory mechanisms underlying corticotropin-releasing factor gene expression in the hypothalamus. Endocrine Journal 56 335–344. (doi:10.1507/endocrj.K09E-075)
Kruse M , Bornstein SR , Uhlmann K , Paeth G & Scherbaum WA 1998 Leptin down-regulates the steroid producing system in the adrenal. Endocrine Research 24 587–590. (doi:10.3109/07435809809032650)
Laidley CW , Woo PTK & Leatherland JF 1988 The stress–response of rainbow trout to experimental infection with the blood parasite Cryptobia salmositica Katz, 1951. Journal of Fish Biology 32 253–261. (doi:10.1111/j.1095-8649.1988.tb05359.x)
Li M , Leatherland JF & Woo PTK 2013 Cortisol and dexamethasone increase the in vitro multiplication of the haemoflagellate, Cryptobia salmositica, possibly by interaction with a glucocorticoid receptor-like protein. International Journal for Parasitology 43 353–360. (doi:10.1016/j.ijpara.2012.11.009)
Malendowicz LK, Rucinski M, Belloni AS, Ziolkowska A, Nussdorfer GG & Kwang WJ 2007 Leptin and the regulation of the hypothalamic–pituitary–adrenal axis. In International Review of Cytology, vol 263, pp 63–102.
Mancuso C , Navarra P & Preziosi P 2010 Roles of nitric oxide, carbon monoxide, and hydrogen sulfide in the regulation of the hypothalamic–pituitary–adrenal axis. Journal of Neurochemistry 113 563–575. (doi:10.1111/j.1471-4159.2010.06606.x)
Mazon AF , Verburg-van Kemenade BML , Flik G & Huising MO 2006 Corticotropin-releasing hormone-receptor 1 (CRH-R1) and CRH-binding protein (CRH-BP) are expressed in the gills and skin of common carp Cyprinus carpio L. and respond to acute stress and infection. Journal of Experimental Biology 209 510–517. (doi:10.1242/jeb.01973)
Metz JR , Huising MO , Leon K , Verburg-van Kemenade BML & Flik G 2006 Central and peripheral interleukin-1β and interleukin-1 receptor I expression and their role in the acute stress response of common carp, Cyprinus carpio L. Journal of Endocrinology 191 25–35. (doi:10.1677/joe.1.06640)
Mommsen TP , Vijayan MM & Moon TW 1999 Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Reviews in Fish Biology and Fisheries 9 211–268. (doi:10.1023/A:1008924418720)
Monau TR , Vargas VE , Lubo Z , Myers DA & Ducsay CA 2010 Nitric oxide inhibits ACTH-induced cortisol production in near-term, long-term hypoxic ovine fetal adrenocortical cells. Reproductive Sciences 17 955–962. (doi:10.1177/1933719110376092)
Myers MG , Cowley MA & Münzberg H 2008 Mechanisms of leptin action and leptin resistance. Annual Review of Physiology 70 537–556. (doi:10.1146/annurev.physiol.70.113006.100707)
Pepels PPLM & Balm PHM 2004 Ontogeny of corticotropin-releasing factor and of hypothalamic–pituitary–interrenal axis responsiveness to stress in tilapia (Oreochromis mossambicus; Teleostei). General and Comparative Endocrinology 139 251–265. (doi:10.1016/j.ygcen.2004.09.013)
Pérez AR , Silva-Barbosa SD , Berbert LR , Revelli S , Beloscar J , Savino W & Bottasso O 2011 Immunoneuroendocrine alterations in patients with progressive forms of chronic Chagas disease. Journal of Neuroimmunology 235 84–90. (doi:10.1016/j.jneuroim.2011.03.010)
Rabadan-Diehl C , Kiss A , Camacho C & Aguilera G 1996 Regulation of messenger ribonucleic acid for corticotropin releasing hormone receptor in the pituitary during stress. Endocrinology 137 3808–3814. (doi:10.1210/en.137.9.3808)
Reinecke M , Heppner C , Petzke F , Allolio B , Arlt W , Mbulamberi D , Siekmann L , Vollmer D , Winkelmann W & Chrousos GP 1994 Impairment of adrenocortical function associated with increased plasma tumor necrosis factor-α and interleukin-6 concentrations in African trypanosomiasis. Neuroimmunomodulation 1 14–22. (doi:10.1159/000095930)
Reinecke M , Arlt W , Heppner C , Petzke F , Chrousos GP & Allolio B 1998 Neuroendocrine dysfunction in African trypanosomiasis: the role of cytokines. Annals of the New York Academy of Sciences 840 809–821. (doi:10.1111/j.1749-6632.1998.tb09619.x)
Roberts JL , Lundblad JR , Eberwine JH , Fremeau RT , Salton SRJ & Blum M 1987 Hormonal regulation of POMC gene expression in pituitary. Annals of the New York Academy of Sciences 512 275–285. (doi:10.1111/j.1749-6632.1987.tb24966.x)
Roubos EW , Dahmen M , Kozicz T & Xu L 2012 Leptin and the hypothalamo–pituitary–adrenal stress axis. General and Comparative Endocrinology 177 28–36. (doi:10.1016/j.ygcen.2012.01.009)
Saeij JPJ , Verburg-van Kemenade LBM , van Muiswinkel WB & Wiegertjes GF 2003a Daily handling stress reduces resistance of carp to Trypanoplasma borreli: in vitro modulatory effects of cortisol on leukocyte function and apoptosis. Developmental and Comparative Immunology 27 233–245. (doi:10.1016/S0145-305X(02)00093-9)
Saeij JPJ , Vries BJd & Wiegertjes GF 2003b The immune response of carp to Trypanoplasma borreli: kinetics of immune gene expression and polyclonal lymphocyte activation. Developmental and Comparative Immunology 27 859–874. (doi:10.1016/S0145-305X(03)00083-1)
Sapolsky RM , Romero LM & Munck AU 2000 How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions. Endocrine Reviews 21 55–89. (doi:10.1210/er.21.1.55)
Schmidt ED , Aguilera G , Binnekade R & Tilders FJH 2003 Single administration of interleukin-1 increased corticotropin releasing hormone and corticotropin releasing hormone-receptor mRNA in the hypothalamic paraventricular nucleus which paralleled long-lasting (weeks) sensitization to emotional stressors. Neuroscience 116 275–283. (doi:10.1016/S0306-4522(02)00555-9)
Stolte EH , Nabuurs SB , Bury NR , Sturm A , Flik G , Savelkoul HFJ & Lidy Verburg-van Kemenade BM 2008 Stress and innate immunity in carp: corticosteroid receptors and pro-inflammatory cytokines. Molecular Immunology 46 70–79. (doi:10.1016/j.molimm.2008.07.022)
Su Y , Carey LC , Rose JC & Pulgar VM 2012 Leptin alters adrenal responsiveness by decreasing expression of ACTH-R, StAR, and P450c21 in hypoxemic fetal sheep. Reproductive Sciences 19 1075–1084. (doi:10.1177/1933719112442246)
Turnbull AV & Rivier CL 1999 Regulation of the hypothalamic–pituitary–adrenal axis by cytokines: actions and mechanisms of action. Physiological Reviews 79 1–71.
Verburg-van Kemenade BML, Stolte EH, Metz JR & Chadzinska M 2009 Chapter 7. Neuroendocrine-immune interactions in teleost fish. In Fish Physiology, pp 313–364. Eds NJ Bernier, G Van Der Kraak, AP Farrell & CJ Brauner. Burlington, MA: Academic Press. (doi:10.1016/S1546-5098(09)28007-1)
Verburg-van Kemenade BML , Ribeiro CMS & Chadzinska M 2011 Neuroendocrine-immune interaction in fish: Differential regulation of phagocyte activity by neuroendocrine factors. General and Comparative Endocrinology 172 31–38.
Volkoff H & Peter RE 2004 Effects of lipopolysaccharide treatment on feeding of goldfish: role of appetite-regulating peptides. Brain Research 998 139–147. (doi:10.1016/j.brainres.2003.11.011)
Wang TY , Chen XQ , Du JZ , Xu NY , Wei CB & Vale WW 2004 Corticotropin-releasing factor receptor type 1 and 2 mRNA expression in the rat anterior pituitary is modulated by intermittent hypoxia, cold and restraint. Neuroscience 128 111–119. (doi:10.1016/j.neuroscience.2004.06.023)
Wendelaar Bonga SE 1997 The stress response in fish. Physiological Reviews 77 591–625.
Wiegertjes GF & Forlenza M 2010 Nitrosative stress during infection-induced inflammation in fish: lessons from a host-parasite infection model. Current Pharmaceutical Design 16 4194–4202. (doi:10.2174/138161210794519138)
Woo PTK 1979 Trypanoplasma salmositica: experimental infections in rainbow trout, Salmo gairdneri. Experimental Parasitology 47 36–48. (doi:10.1016/0014-4894(79)90005-5)
Woo PTK 2003 Cryptobia (Trypanoplasma) salmositica and salmonid cryptobiosis. Journal of Fish Diseases 26 627–646. (doi:10.1046/j.1365-2761.2003.00500.x)
Woo PTK , Leatherland JF & Lee MS 1987 Cryptobia salmositica: cortisol increases the susceptibility of Salmo gairdneri Richardson to experimental cryptobiosis. Journal of Fish Diseases 10 75–83. (doi:10.1111/j.1365-2761.1987.tb00722.x)
Yada T , Nakanishi T & Kwang WJ 2002 Interaction between endocrine and immune systems in fish. International Review of Cytology 220 35–92. (doi:10.1016/S0074-7696(02)20003-0)
